ID: 947820249

View in Genome Browser
Species Human (GRCh38)
Location 2:233064122-233064144
Sequence CCCTCTCTGCAGGAGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947820245_947820249 -2 Left 947820245 2:233064101-233064123 CCAATGTCAGTATATAGGCTGCC 0: 1
1: 0
2: 0
3: 24
4: 274
Right 947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG 0: 1
1: 0
2: 5
3: 47
4: 392
947820244_947820249 -1 Left 947820244 2:233064100-233064122 CCCAATGTCAGTATATAGGCTGC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG 0: 1
1: 0
2: 5
3: 47
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947820249 Original CRISPR CCCTCTCTGCAGGAGCAGCT GGG Intronic
900003573 1:29357-29379 TCCGCTCTGCCGGAGCCGCTGGG + Intergenic
900004343 1:34865-34887 ATCTCACTGCAGGGGCAGCTGGG + Intergenic
900023293 1:199873-199895 TCCGCTCTGCCGGAGCCGCTGGG + Intergenic
900024068 1:205381-205403 ATCTCACTGCAGGGGCAGCTGGG + Intergenic
900203206 1:1420412-1420434 CCCGCGCTGCAGCAGCAGCTCGG + Exonic
900565463 1:3329758-3329780 CCCTCTCTCCAGAAGCCGCACGG - Intronic
900684582 1:3939960-3939982 CCCAGTCTGCAGGAGCAGGAAGG - Intergenic
901391595 1:8949610-8949632 CCCTCTCTGGAAGAGCCACTAGG - Intronic
901527212 1:9831138-9831160 CCCTCTGTGGATGGGCAGCTGGG + Intergenic
902542568 1:17165310-17165332 CCCTGTCTGCAGGAACCTCTGGG + Intergenic
902548617 1:17206121-17206143 CCATCCCTGCTGGAGCAGGTGGG + Intronic
902994267 1:20211594-20211616 CTCTCTGTGTAGGGGCAGCTTGG + Intergenic
903280909 1:22249306-22249328 CCCTGCCTGCAGGAGGTGCTGGG - Intergenic
903344762 1:22677150-22677172 CCCGCTCCCCAGGAGCAGATGGG - Intergenic
904009796 1:27383065-27383087 CCGTCTCCCCAGGAGCAGCCTGG - Intronic
904768862 1:32870251-32870273 CCAACTCTGCAGGGGCAGATGGG - Intronic
906676002 1:47694183-47694205 CTCTCGCTGCAGGAGCAGCTTGG + Intergenic
912543880 1:110437145-110437167 CCACCTCAGCAGGAGCAGCTGGG + Intergenic
912548065 1:110465531-110465553 GCCCCACTGCAGGAGCTGCTGGG + Intergenic
912738666 1:112173688-112173710 CCCACTCTGCTTCAGCAGCTTGG + Intergenic
914197387 1:145454542-145454564 CCCTCCCTGCCGGGGCCGCTGGG - Intergenic
915041811 1:152974093-152974115 CCATCTCTGCATGAGTAGGTGGG + Intergenic
915648190 1:157288759-157288781 CCCTCCCTCCAGGAGCTGCTGGG - Intergenic
916499301 1:165373329-165373351 CCTGCTCTGCAGGAACAGCTTGG - Intergenic
918606580 1:186434499-186434521 CTTTCTCTGAAGGAGCAGCAAGG - Intergenic
919486918 1:198157309-198157331 CCCTCCCGGCAGGAGCTGCCCGG - Intronic
920298706 1:204975534-204975556 CCCCCTCTGCAGAAGCTCCTTGG - Intronic
920693069 1:208161427-208161449 GCCTCTCTGGAGAATCAGCTAGG + Intronic
922141719 1:222894321-222894343 GCCTCTCTGCAGGAACAGCCTGG - Intronic
922313105 1:224414911-224414933 CCGTCTCAGCCTGAGCAGCTGGG - Intronic
923148952 1:231217218-231217240 CCCCGTCTCCAGGAGCTGCTCGG + Intronic
923366337 1:233265377-233265399 GCCTCACTGCAAGAGAAGCTAGG - Intronic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
923652130 1:235883844-235883866 CCCTCTCTGCAGAAGAATCAGGG - Intergenic
1063662973 10:8046527-8046549 CCTTCTCGGCAGCAGCCGCTAGG - Intergenic
1064076512 10:12273219-12273241 TCCTCTCTGCACGAGCAGGTAGG - Intergenic
1065806079 10:29394781-29394803 GCCTCTCTGCATGAACAGCCTGG + Intergenic
1066066578 10:31765382-31765404 TCCTCTCTCCAGGAGCAGATGGG - Intergenic
1066160569 10:32723213-32723235 CACTCTCTCCAGGACCATCTGGG - Intronic
1067525660 10:47036848-47036870 CCGTGTCTGTAGCAGCAGCTAGG + Intergenic
1069121770 10:64576837-64576859 ACCCCTCTGCAGAAACAGCTTGG + Intergenic
1069832420 10:71289419-71289441 ACCTCTCTGCCCCAGCAGCTGGG + Intronic
1070848533 10:79543500-79543522 CCCTCTCCCCATCAGCAGCTAGG - Intergenic
1070925253 10:80216685-80216707 CCCTCTCCCCATCAGCAGCTAGG + Intergenic
1072026691 10:91467130-91467152 CCCTTTCCACAGGAGCTGCTGGG - Intronic
1072431981 10:95380468-95380490 CTTTCTTTGCAGGAGCACCTGGG + Intronic
1073192149 10:101659179-101659201 ACCCCTCTGCAGGTGCTGCTTGG - Intronic
1073483961 10:103805020-103805042 CCCTCTCTCCAGGGGCGGATTGG - Intronic
1074857565 10:117484564-117484586 CCCTAGCTGCAGGAAGAGCTGGG + Intergenic
1076042259 10:127260169-127260191 CCCGCGCTGCAGCAGCAGGTTGG + Intronic
1076063197 10:127429178-127429200 CCTTCTCTGTAGCACCAGCTGGG + Intronic
1076064423 10:127438112-127438134 TCCTCACAGCAGGAGCTGCTAGG + Intronic
1076230248 10:128814447-128814469 GCCTCTCAGCAGGAGCACCTTGG - Intergenic
1076452887 10:130568995-130569017 CCATCTCTGGAGGAGCAGGTTGG + Intergenic
1076507825 10:130989644-130989666 CTCTCTCTGCATGAGCAGAGGGG - Intergenic
1076744324 10:132505107-132505129 CCCTCCCTGCACCAGCAGCCTGG - Intergenic
1077102768 11:829497-829519 CACACTGTGCTGGAGCAGCTGGG + Exonic
1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG + Intergenic
1077506632 11:2932579-2932601 CCCTTTCTGCATCTGCAGCTTGG - Intergenic
1078461706 11:11519731-11519753 CCCTGACTGCAGGAGCAACCAGG + Intronic
1080690218 11:34549996-34550018 TCACCTCTGCAGGAGCAGCTGGG + Intergenic
1081284044 11:41246155-41246177 CCCCCTCTGCAGGAACAACCTGG - Intronic
1081597260 11:44467658-44467680 CCCTCTCTGCTGGGACAACTGGG + Intergenic
1081967362 11:47177862-47177884 CCGGCTCTCCAGGAGAAGCTGGG + Exonic
1083618490 11:64037547-64037569 CCCTCACTGCTGGCCCAGCTAGG - Intronic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG + Intronic
1084230118 11:67746134-67746156 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
1084315574 11:68343502-68343524 CCCTCGCCACAGGAGCAGCCAGG + Intronic
1084331915 11:68435582-68435604 CCCTCTCCGCAGTAGCAAATGGG - Intronic
1084616064 11:70236678-70236700 CCCTCTCTCCTGGAGGAGGTGGG - Intergenic
1084707950 11:70826582-70826604 CCCTCGGTGCTAGAGCAGCTGGG + Intronic
1084888367 11:72224641-72224663 CCGTCCCCGCAGGAGGAGCTGGG + Intronic
1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG + Intergenic
1085682894 11:78594840-78594862 CGTTATCTGCAGGAGCAACTGGG - Intergenic
1086092890 11:83021525-83021547 CCCGCCCGGCAGCAGCAGCTGGG + Intronic
1089007560 11:115105275-115105297 CCCTCAAAGCAGGTGCAGCTGGG - Intergenic
1089784211 11:120896420-120896442 CCATCTCTGCAAGGGCAGCATGG - Intronic
1089985210 11:122806018-122806040 ACCTCTCTTCAAGAGCAGCAAGG - Intronic
1091376992 12:31411-31433 TCCGCTCTGCCGGAGCCGCTGGG + Intergenic
1091377764 12:36913-36935 ATCTCACTGCAGGGGCAGCTGGG + Intergenic
1091649746 12:2301145-2301167 CACTATCTGCAGGAGGCGCTTGG + Intronic
1094319011 12:29164572-29164594 CCGTCTCTGCAGGGCCAGCCGGG - Intronic
1094501054 12:31021022-31021044 CTCTCACTGCAGGGGCAGCGGGG + Intergenic
1095430305 12:42126720-42126742 CCCTCTCTACAAAAACAGCTGGG + Intronic
1097078608 12:56413155-56413177 GCCCCTCAGCAGGAACAGCTTGG - Intergenic
1097279781 12:57837782-57837804 CCCTCTCTGCACCAGCAACTGGG + Intronic
1097688381 12:62712006-62712028 CTCTAGCTGCAGGAGCAGCAGGG - Intronic
1098671075 12:73232090-73232112 CCCCCGCTGCTGGAGCAGGTAGG - Intergenic
1099115918 12:78623913-78623935 CCTGCTCTGCAGGAGCAGTCAGG - Intergenic
1100518301 12:95349581-95349603 CCCTAGCTGCAGGAGAAACTGGG + Intergenic
1101055378 12:100907054-100907076 TCCTCTCTGGAGGAGAACCTTGG - Intronic
1101420909 12:104550188-104550210 CCCCCAGTGCAGGAGTAGCTTGG + Intronic
1101719751 12:107341164-107341186 CCCTGTCTGCACCTGCAGCTTGG - Intronic
1102073149 12:110038342-110038364 CTGTCCCTGAAGGAGCAGCTAGG + Exonic
1102453120 12:113056126-113056148 CCCTCTCACCTGGAGCAGGTGGG + Intergenic
1103215122 12:119195803-119195825 CCCTCTCTGAATGAGCACCTAGG - Intronic
1104498045 12:129259214-129259236 CACTCACTGCAGGAGGATCTAGG + Intronic
1104831320 12:131753835-131753857 CCCTCGCTGCTGGAGAAGCTAGG - Intronic
1105572266 13:21613847-21613869 ACCTCACTGCAGGGGAAGCTGGG - Intergenic
1107446736 13:40476034-40476056 CCCTATCTACAGTAGCAACTGGG + Intergenic
1108958527 13:56190092-56190114 CCCACCCTGCAGCAGCATCTAGG - Intergenic
1109484080 13:62996334-62996356 CCATCACTGCAGGCACAGCTTGG - Intergenic
1113165813 13:107440828-107440850 CCATCTCTGAAGGAGCTCCTTGG - Intronic
1113699149 13:112370904-112370926 CAATCTCTGCAGGAATAGCTGGG - Intergenic
1113752183 13:112784113-112784135 CCCGCTCTGCAGGGGCAGTCAGG - Intronic
1113926963 13:113947024-113947046 CCCTCTCTCCCAGAGCATCTTGG - Intergenic
1114041749 14:18685164-18685186 CCCTCCCTACAGCAGCAGGTGGG + Intergenic
1115399445 14:32939912-32939934 CCGTCTCCGCGCGAGCAGCTAGG + Intronic
1117496705 14:56312715-56312737 CCATTTCTGCAGGAGATGCTAGG - Intergenic
1118089190 14:62453872-62453894 CCCTCTCTTCACGAGTAGTTGGG - Intergenic
1118200135 14:63663766-63663788 ACCACTCTGCAAGAGCAGCCTGG - Intergenic
1119028036 14:71169328-71169350 CCCTCTCTGTTGGTGAAGCTGGG + Intergenic
1119530244 14:75354977-75354999 CACTCCCTGCAGGAGGAGCTGGG - Intergenic
1119779946 14:77270899-77270921 CCAGCTCTGCCGGATCAGCTCGG + Exonic
1121442249 14:93956587-93956609 CCATCTCAGCAGGAGCAGTGGGG + Intronic
1122405194 14:101496626-101496648 CCGGCTCTGCAGAAGCATCTCGG - Intergenic
1122549679 14:102543310-102543332 ACTCCTCTGCAGGAGCAGCCTGG + Intergenic
1122937552 14:104967058-104967080 CCCTGGCAGCAGGTGCAGCTGGG + Intronic
1123574994 15:21656967-21656989 CTCCCTCTGCAGGAGGAGCCTGG + Intergenic
1123611610 15:22099456-22099478 CTCCCTCTGCAGGAGGAGCCTGG + Intergenic
1124077288 15:26458244-26458266 GCCTCTCTTCAGGTACAGCTAGG - Intergenic
1126543659 15:49848548-49848570 CTCTCTCTGGAGGAGCAGAGAGG + Intergenic
1126793742 15:52243518-52243540 CCTTCTCTGCATGACCAGCGTGG - Intronic
1127023345 15:54775702-54775724 CCCTGTCCCCAGCAGCAGCTGGG + Intergenic
1128398551 15:67254168-67254190 CACTCTCTCCCGGAGCAGCAAGG + Intronic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1128680678 15:69649180-69649202 CCTTCTCTGCCAGAGCAGCTTGG - Intergenic
1129393207 15:75230912-75230934 CCCCCTGTTCAGGAGCACCTGGG - Intergenic
1129592640 15:76931485-76931507 CCCTCTCTGCAGTCCCAGCATGG + Intergenic
1130656863 15:85797827-85797849 TCCTACCTGCAAGAGCAGCTGGG + Intergenic
1131838160 15:96410330-96410352 CCCACCCTGCAAGATCAGCTGGG - Intergenic
1131861103 15:96653910-96653932 CAGTCTCTTCAGGATCAGCTAGG + Intergenic
1132007393 15:98241203-98241225 ACCTCTCTGCAGGAGAGGCTGGG - Intergenic
1132115211 15:99131046-99131068 CCCTCTCTGGAGGGGGACCTGGG + Exonic
1132449161 15:101956079-101956101 ATCTCACTGCAGGGGCAGCTGGG - Intergenic
1132449928 15:101961583-101961605 TCCGCTCTGCCGGAGCCGCTGGG - Intergenic
1202983862 15_KI270727v1_random:391211-391233 CTCCCTCTGCAGGAGGAGCCTGG + Intergenic
1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG + Intronic
1132923824 16:2416432-2416454 ACCTCTCTGCAGGGCCACCTAGG - Intergenic
1133065279 16:3201983-3202005 CCTCCTCTGCAGGAGCAGTCAGG + Intergenic
1133076616 16:3285176-3285198 CCCAGGCTGCAGGAGCTGCTAGG + Exonic
1133752619 16:8736466-8736488 CCATCTCTGCAGGGACCGCTGGG + Intronic
1134799263 16:17069564-17069586 CCCTCTCTGCAAAAGCTTCTAGG + Intergenic
1136276798 16:29183590-29183612 CCATGTCTCCAGGAGCTGCTGGG - Intergenic
1138078596 16:54066850-54066872 CCATCTCTGCAGCCCCAGCTTGG + Intronic
1138591043 16:58000107-58000129 CCCTGCCTGCAGGCCCAGCTGGG + Intronic
1139393341 16:66620316-66620338 CCCTCTCTGTGGGAGCAGAGGGG + Intronic
1139476309 16:67204212-67204234 CCCTCCCTGCAGGCCCAGCATGG - Intergenic
1139636249 16:68260220-68260242 CCCTGCCTGCAGGAGCTACTAGG - Exonic
1141643411 16:85354736-85354758 CCCTCGCAGCAGGAGCCTCTGGG + Intergenic
1141799595 16:86297875-86297897 CTCTGTCTGCAGAAGCAGATTGG + Intergenic
1141949526 16:87331653-87331675 CTGTCTCTGCAGGGGCAGCTGGG + Intronic
1142081177 16:88149650-88149672 CCATGTCTCCAGGAGCTGCTGGG - Intergenic
1142151746 16:88515561-88515583 CCCTGTCTGCCAGGGCAGCTGGG + Intronic
1142379323 16:89722519-89722541 CGCTCTGTGCAGGAGCAGGCCGG + Exonic
1142520330 17:500067-500089 CCCTTTCCGCAGCAGCAGGTGGG - Intergenic
1143086710 17:4421517-4421539 CCACGTCTGCAGGAGAAGCTGGG - Intergenic
1144961206 17:19045145-19045167 CCATCTCTGCACGAGCAGCCTGG - Intronic
1144973955 17:19129379-19129401 CCATCTCTGCACGAGCAGCCTGG + Intronic
1145081184 17:19895711-19895733 GCCTCTTTGTAGGAGCAGATAGG + Intergenic
1145220882 17:21087495-21087517 CCATCTCAGCAGAAACAGCTTGG - Intergenic
1146053321 17:29568708-29568730 CCCTCGCTGGCGGAGCGGCTGGG + Exonic
1146255199 17:31388338-31388360 ACTTCTCTGCAGGAGCACATGGG + Intergenic
1146387347 17:32389069-32389091 CCCTCTCTTGAGGGGGAGCTGGG - Intergenic
1146484149 17:33229835-33229857 CACTCCCTCCAGGAGCAGCCAGG - Intronic
1149932450 17:60769580-60769602 CCCCCTCAGTAGGAGCAGCTAGG + Intronic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1150065608 17:62106403-62106425 CAGTCTCTGCAGAAGAAGCTAGG + Intergenic
1150291166 17:63983235-63983257 CCCCCACTGCAGGTGAAGCTTGG - Intergenic
1150442570 17:65203229-65203251 CCCTCCCTGTGGGAGGAGCTGGG - Intronic
1150983372 17:70169026-70169048 CCCTCTCTGCCGGAGCCCCTCGG - Intronic
1151732127 17:75917832-75917854 CCAGCACTGCAGGAGCGGCTGGG - Exonic
1151865098 17:76796508-76796530 CCGACTCTGCAGCACCAGCTGGG + Intergenic
1152089497 17:78238947-78238969 CCATGTCTGCAGGACCACCTGGG + Intronic
1152408446 17:80110364-80110386 CCCCCGCTGAGGGAGCAGCTAGG + Intergenic
1152453201 17:80396784-80396806 CCCTCTCTGCAGGATATGCTGGG + Exonic
1152570998 17:81121243-81121265 CGCTCTCTGCAGAAGCAGGTGGG - Exonic
1152587823 17:81196933-81196955 CGCTCTCTGCAGCAGCAGCATGG + Exonic
1153838765 18:8987727-8987749 CTCTCTCTGCAGGCTCACCTGGG - Intergenic
1154175600 18:12086019-12086041 CCCACTCCACAGGAGCCGCTGGG - Intergenic
1155437435 18:25827680-25827702 CCTTCTCTGAACGAGCAGGTTGG - Intergenic
1158947497 18:62459598-62459620 GGCTCTCTGCAGGGGCTGCTGGG + Intergenic
1159564326 18:70031896-70031918 CCCCCTCTGCAGGAGTTGTTGGG - Intronic
1159975656 18:74708640-74708662 CCCTTTCTGGGGGAGCAGCCTGG + Intronic
1160234653 18:77076429-77076451 AGCCCTCTGCAGGTGCAGCTGGG - Intronic
1160521249 18:79509385-79509407 CCTTCACTGTAGGAGGAGCTGGG + Intronic
1160635326 19:70964-70986 TCCGCTCTGCCGGAGCCGCTGGG + Intergenic
1160636095 19:76474-76496 ATCTCACTGCAGGGGCAGCTGGG + Intergenic
1160717709 19:583893-583915 CCCACTCTCCAGGAGCAGCCAGG - Intergenic
1161010241 19:1956288-1956310 TCATCTGTGCAGGTGCAGCTGGG + Intronic
1162569888 19:11465719-11465741 CCTTCTCAGCAGCTGCAGCTGGG - Intronic
1162958803 19:14114246-14114268 CCCTGCCTGCAGGGGGAGCTAGG + Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163281138 19:16318521-16318543 CTCTCTGTGCAGGAGAGGCTTGG - Intergenic
1163855795 19:19701141-19701163 CCCTATCTGCAGGACTTGCTCGG + Intergenic
1163888938 19:19993801-19993823 CCCTATCTGCAGGACTTGCTCGG + Intergenic
1163968891 19:20773540-20773562 CCCTATCTGCAGGACTTGCTTGG + Intronic
1164590693 19:29505269-29505291 ACTTGTCTGCAGGAACAGCTGGG - Intergenic
1164809682 19:31146445-31146467 CTGTCTCAGCAGGGGCAGCTTGG - Intergenic
1165366027 19:35365570-35365592 CCCTCACTACAGGAGCAGCAGGG + Intergenic
1166227615 19:41406367-41406389 CCCTCTCTGGAGTATCTGCTGGG + Intronic
1167369154 19:49070636-49070658 CCCTCGCTGCCGGGCCAGCTCGG + Exonic
1168257546 19:55174986-55175008 TCCTTTCAGCAGGAGAAGCTTGG - Exonic
1168676871 19:58284963-58284985 CCCTGTCTGAAGGAGCAGCAGGG - Intronic
925162389 2:1695030-1695052 TCTGCTCTGGAGGAGCAGCTTGG - Intronic
928941963 2:36735466-36735488 CCCACTCTGCTGGAGCAGAGAGG - Intronic
929030849 2:37648871-37648893 GACTGCCTGCAGGAGCAGCTGGG + Intronic
929822342 2:45283517-45283539 TCCTCTCTGCTGTAGCAACTGGG - Intergenic
930725892 2:54681008-54681030 CCCTTGCTGCAAGTGCAGCTGGG + Intergenic
932496312 2:72147482-72147504 TCCTCTCTGCCGCAGCAGCCCGG - Intronic
932811237 2:74827966-74827988 CCCTCGCTGCAAGAGAATCTGGG - Intergenic
934637830 2:96007132-96007154 CCCTCTGTCCAGGAGCACCCAGG - Intergenic
934795832 2:97098279-97098301 CCCTCTGTCCAGGAGCACCCAGG + Intergenic
935492125 2:103734021-103734043 CCCTTTCCTCAGGAGCTGCTGGG + Intergenic
936398790 2:112150210-112150232 CCATCTCTGAAGGAGGGGCTGGG + Intronic
936565386 2:113578576-113578598 ATCTCACTGCAGGGGCAGCTGGG - Intergenic
936566153 2:113584078-113584100 TCCGCTCTGCCGGAGCCGCTGGG - Intergenic
939471804 2:142631632-142631654 CCCTCTCTGCAGCAGTAGATTGG - Intergenic
939471889 2:142633125-142633147 CCCTCTCTGCAGCAGTAGATTGG + Intergenic
941684631 2:168435979-168436001 TTCTCGCTACAGGAGCAGCTGGG + Intergenic
943083012 2:183279283-183279305 CCCTGACTGCAGGAGAAACTGGG + Intergenic
943093889 2:183405332-183405354 CCCTTTCTGCAGGAGTTGTTGGG + Intergenic
946417550 2:219547972-219547994 CCCACTCTGCTGGCGAAGCTGGG + Exonic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
947875349 2:233464173-233464195 CCGCCTCAGAAGGAGCAGCTGGG + Exonic
948635035 2:239329415-239329437 CAGCCTCTGCAGCAGCAGCTTGG + Intronic
948635174 2:239330046-239330068 CAGCCTCTGCAGCAGCAGCTTGG - Intronic
948654976 2:239470947-239470969 ACCTGTCTGCAGCAGAAGCTAGG - Intergenic
948705859 2:239792144-239792166 CCCTGGCTGCAGGAGCATGTGGG - Intronic
948731830 2:239969381-239969403 TCCTCCCTGCAGTAGGAGCTCGG - Intronic
948907491 2:240986762-240986784 CCCACTCTGCAGGGCCAGCCTGG - Intronic
949031559 2:241799631-241799653 CCCTGTCTGGAGGCACAGCTGGG - Intronic
1168928312 20:1600616-1600638 GCTTCTCTGCAGAATCAGCTGGG + Intronic
1169017978 20:2307222-2307244 CCCTCTCTCCAGTGGCAGGTTGG + Intronic
1169207893 20:3750210-3750232 CGCTCTGCGCAGGAGCAGGTGGG + Exonic
1171360099 20:24581519-24581541 CTATCTCTGCAGGAGATGCTCGG - Intronic
1172846962 20:37935307-37935329 CGCTGTCTGCACGAGGAGCTTGG - Intronic
1173726378 20:45301137-45301159 CCCTCTCTGCAGTGGCACCGTGG + Exonic
1174098950 20:48112320-48112342 CACTCTCTGCCTGAGCATCTGGG + Intergenic
1175312900 20:58024278-58024300 ACCCCTCTGCATGAGCAGCTTGG - Intergenic
1175601052 20:60273506-60273528 CCTTCTCTGCCTGGGCAGCTCGG + Intergenic
1177571354 21:22890860-22890882 CCCTCTGTGCAGAATCACCTGGG + Intergenic
1178121869 21:29477509-29477531 CACTCTTTGCAGGTCCAGCTGGG + Intronic
1178270231 21:31182749-31182771 GCCTGTCTGCAGCAGCACCTGGG - Intronic
1178429553 21:32506901-32506923 CCCCCAAAGCAGGAGCAGCTGGG + Intronic
1178771311 21:35506975-35506997 CCCTCTCCCCAGGGGCATCTTGG - Intronic
1178958769 21:37045290-37045312 TCCTATCAGCAGCAGCAGCTGGG + Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1179288307 21:39996840-39996862 CCTTCTCTGCAGGAGCACCGTGG - Intergenic
1179317242 21:40254663-40254685 AGCTCTTTGCAGGATCAGCTGGG + Intronic
1179615284 21:42579580-42579602 GCCTCCCTGCAAGAGCAGCGGGG - Intronic
1179809199 21:43859447-43859469 CCCACTTTGCAGGAGGAGATGGG + Intergenic
1179905998 21:44423715-44423737 GCCTCCCTGGAGGAGCAGGTGGG + Exonic
1180008357 21:45033589-45033611 CCCTGTCTGCCGGAGCAGCTGGG + Intergenic
1180972046 22:19820886-19820908 CCCTCTCTGGAAGAGGAGCAAGG - Intronic
1181003450 22:19998590-19998612 GCCTCTCTGCAGGAGCTGGGGGG + Intronic
1181030862 22:20148362-20148384 CCCTCGCTGCAGGATCGCCTGGG + Intergenic
1181163583 22:20971755-20971777 TCCTCCCTGCAGCAGCAGCCTGG + Intronic
1181277744 22:21697163-21697185 CCTCCTCTGCAGGCCCAGCTTGG - Exonic
1182978721 22:34647898-34647920 CCATCTCTGCAGCAGTAGATGGG - Intergenic
1184225838 22:43128444-43128466 CCATTACTGCAGGAGCAGGTAGG - Intronic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1184506658 22:44907854-44907876 CCCTCTTTGCTGTGGCAGCTAGG - Intronic
1184608112 22:45585976-45585998 CCCTCCCTGCAGCAGCTCCTGGG + Intronic
1184707529 22:46224737-46224759 TCCTCCCTGCAGGGGCTGCTGGG + Intronic
1184746986 22:46461894-46461916 GCCTCTCTGAAGGGCCAGCTTGG - Intronic
1185169667 22:49285503-49285525 TTCTCTCTGCAGGAGCAGACAGG + Intergenic
1185258594 22:49849544-49849566 CCCTCTCCGCAGAGGCAGCGCGG - Intergenic
1185379856 22:50503359-50503381 CCCTCTCAGGACGTGCAGCTGGG + Exonic
949089483 3:10980-11002 CCCTCTCTGCAGGCGCAGAGAGG + Intergenic
950092240 3:10304260-10304282 ACCTCTCTGCAGGAACAGGGTGG + Intronic
950111603 3:10422205-10422227 CCATGTGTGCAGGAGCATCTGGG - Intronic
950234342 3:11305593-11305615 CTCTCTCTTCAAGACCAGCTTGG + Intronic
950692249 3:14669093-14669115 ACCTCACTGTAGGAGAAGCTGGG + Intronic
952547597 3:34437211-34437233 CCCTCTTTGTAAGAGCAGCAGGG + Intergenic
953770925 3:45778129-45778151 CCTTCTCAGCAGGAGCACCTGGG - Intronic
954107234 3:48415913-48415935 CACTCTCTGAAGGAGCAGACTGG + Intronic
954199019 3:49013224-49013246 CCCTCTCTGCACGGGAAGCAGGG + Exonic
954995112 3:54874253-54874275 CCCACTCTGCAGGATGAGTTAGG + Intronic
957046686 3:75381162-75381184 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
957083092 3:75655546-75655568 CCTTCTCTGCTGGGCCAGCTCGG + Intergenic
959430249 3:106245667-106245689 GTCTCTCACCAGGAGCAGCTTGG - Intergenic
961462229 3:127058291-127058313 TGCTCTCTGGAGGAACAGCTTGG - Intergenic
961878751 3:130045230-130045252 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
962908698 3:139828097-139828119 CCTTCACTTCAGCAGCAGCTGGG - Intergenic
963286079 3:143435910-143435932 CCCTCCCTGCAGGGGCTGCCTGG + Intronic
966721215 3:183064431-183064453 CCCTCGCTCCAGGAGACGCTTGG + Intronic
966926620 3:184648587-184648609 CGCTCAGTGCTGGAGCAGCTAGG + Intronic
967188414 3:186965017-186965039 CCCTCTCTACAGGGGCAGGGAGG - Intronic
967742639 3:193020228-193020250 CCTTCTCTCCATGAGAAGCTGGG - Intergenic
968288452 3:197521646-197521668 CCCGCACTGCAGGAGCAGGTGGG - Intronic
968492610 4:898321-898343 CCAGCTCTGCACCAGCAGCTCGG + Intronic
968662647 4:1805154-1805176 CCCTGTCTGGAGGGGCAGCAAGG + Intronic
968873311 4:3252355-3252377 ACCTGTCTGCAGGAGTAGGTGGG + Intronic
969238935 4:5887370-5887392 CCATGTATGCAGGAGCAGCCCGG - Intronic
969599565 4:8167991-8168013 CTCTCTCTGCTGGGGCTGCTGGG - Intergenic
969824365 4:9745257-9745279 CCCCCAAAGCAGGAGCAGCTGGG + Intergenic
970322199 4:14886001-14886023 CCCTCTCAGAAGGAGGATCTAGG - Intergenic
971963646 4:33522242-33522264 CCCTCTCAGCAGGTAGAGCTTGG + Intergenic
972413027 4:38811695-38811717 CCTGCTCTGCAGGAGCAGTCAGG + Intronic
973606008 4:52588426-52588448 CCTTCTCTGCTGGAGCAAATTGG + Intergenic
974260320 4:59518068-59518090 ACCTCTCTGCACAAGCAGCCTGG - Intergenic
974650598 4:64748989-64749011 CCCCTTCTGCAGGAGTGGCTGGG + Intergenic
975983495 4:80183918-80183940 CGGTCTCTGCTGCAGCAGCTGGG - Intronic
976217242 4:82726961-82726983 CCCACTCTGCAGGATGAGCTTGG - Intronic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
979436722 4:120701986-120702008 CCCTCTCTGCAGGAAATGTTTGG + Intronic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
980448227 4:132939143-132939165 CCCTCTGTGCCTGAGCTGCTAGG + Intergenic
980738391 4:136918933-136918955 CCCACTCTGCTGCAGCAGCTGGG + Intergenic
981089844 4:140721112-140721134 CCCTCTCTGAGGGTGCAGCGGGG + Intronic
983462897 4:168048869-168048891 CAGTCACTGCTGGAGCAGCTGGG - Intergenic
983891243 4:173032570-173032592 CCCTCTCAGCCTGAGTAGCTGGG - Intronic
986442392 5:7793606-7793628 GCCTCACTGCAAGGGCAGCTCGG + Intronic
990711146 5:58582172-58582194 CTTTCTCTGCAGCTGCAGCTTGG + Intergenic
991009481 5:61868016-61868038 CCATCTTTGCAGGTGCAGCAGGG + Intergenic
992627676 5:78649211-78649233 CGCTCTCCGCCGGAGCAGCCTGG - Intronic
992667005 5:79020153-79020175 CCATCTCTGCAGAATCACCTGGG + Intronic
993256045 5:85591402-85591424 CAGTCACGGCAGGAGCAGCTGGG + Intergenic
994188095 5:96838010-96838032 CTCTCTCTGCTGGTGGAGCTTGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995761557 5:115567229-115567251 CCCTAGCTGCAAGAGCAACTGGG + Intergenic
996488088 5:124059938-124059960 CTCTCTCTGCAGGAGCACAAAGG - Intergenic
996874036 5:128222151-128222173 CCCTCTCCCCAGGAGCACCTGGG - Intergenic
999083158 5:148863395-148863417 CCCACTCTGCAGAGCCAGCTGGG - Intergenic
999242114 5:150133755-150133777 CCCACTCTGCAGCAACAGGTTGG + Exonic
999763670 5:154722246-154722268 GCCTCCCTGCAGGAGGAGGTAGG - Intronic
1001547662 5:172580422-172580444 CCTGCTCTCCAGGAGCAGCTGGG - Intergenic
1002762952 6:215970-215992 CTCGCTCTGCAGGAGGAGCCCGG + Intergenic
1003395293 6:5747679-5747701 TCCTCACTGCAGGGGCTGCTGGG - Intronic
1003931200 6:10926142-10926164 ACCTCCCTACAGGACCAGCTCGG - Intronic
1004173176 6:13315091-13315113 CCCTGTCTGCAGTAGAGGCTGGG - Intronic
1006154372 6:32006349-32006371 GCTTGTCTGCAGGAGGAGCTGGG - Intergenic
1006455020 6:34126715-34126737 CCATGTCTGCAGCAACAGCTGGG - Intronic
1006588955 6:35140732-35140754 CCCTCCCTGTAGGTCCAGCTCGG - Exonic
1007367653 6:41406222-41406244 CTCTGTTTGCAGGAGCAGTTGGG + Intergenic
1007927159 6:45659342-45659364 CCCTACCTGAAGGAGCAGATCGG - Intronic
1008381438 6:50842920-50842942 CCCTCCCTTCTCGAGCAGCTGGG - Intronic
1009871085 6:69452464-69452486 CCCAGTCTGCAGCAGGAGCTGGG + Intergenic
1011795377 6:90947265-90947287 CCCTCCCCGCAGCAGCAGCCGGG - Intergenic
1017724467 6:157267494-157267516 TCCTCACTGCAGGGGGAGCTGGG + Intergenic
1018163075 6:161066738-161066760 CCCTTCCTGCTGGAGGAGCTTGG - Intronic
1018221234 6:161581777-161581799 CACCCTCTGCACTAGCAGCTCGG - Intronic
1019565981 7:1679344-1679366 CCCTCCCTGCAGGAGGCTCTGGG + Intergenic
1019980814 7:4620544-4620566 CTCTCCTTGCAGGAGCAGCTGGG + Intergenic
1020313807 7:6890158-6890180 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
1021613387 7:22478978-22479000 GCCTCTCTGAGGGTGCAGCTGGG - Intronic
1023000453 7:35801913-35801935 GCCTCTCTCCAGGCGCAGCCCGG + Intronic
1023695434 7:42841121-42841143 CCGTCTCAGCAGCACCAGCTGGG + Intergenic
1024250852 7:47504714-47504736 CATACCCTGCAGGAGCAGCTGGG + Intronic
1024534413 7:50418308-50418330 CCCTCTCCCCACGAGGAGCTGGG - Intergenic
1024562226 7:50654187-50654209 CCCACACTTCAGGAGAAGCTGGG - Intronic
1025020627 7:55476723-55476745 CCATGGCTGGAGGAGCAGCTGGG - Intronic
1025150380 7:56542357-56542379 CCCTCTCAGCATGAGACGCTTGG + Intergenic
1026168607 7:67933180-67933202 ACCTCTCTCCAAGAGGAGCTGGG - Intergenic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1029274506 7:99396246-99396268 CCCTCTCTGAATGAGCACCCAGG + Exonic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1032127963 7:129208521-129208543 CCCCTTCTTCAGGGGCAGCTGGG + Intronic
1032743133 7:134759621-134759643 CCCTCTGTCCAGGGGCATCTTGG - Intronic
1032864159 7:135909327-135909349 CCCTCTCTCCAGAGGCAGCCTGG - Intergenic
1033031868 7:137834581-137834603 GCCCCTTTCCAGGAGCAGCTGGG - Intronic
1033265301 7:139880515-139880537 GCCTCTGTGAAGGAGCAGATGGG - Intronic
1034251224 7:149692582-149692604 GCCTCCCTGAAGGAGCAGCCAGG + Intergenic
1034435584 7:151061385-151061407 CCCTCCCTGCAGGGGCATCTTGG + Intronic
1034594996 7:152181401-152181423 CCCAATCTTCAGGAACAGCTAGG - Exonic
1035049447 7:155990214-155990236 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049463 7:155990271-155990293 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049471 7:155990300-155990322 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049479 7:155990329-155990351 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049487 7:155990358-155990380 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049495 7:155990387-155990409 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035049796 7:155992211-155992233 CTGTCCCTGGAGGAGCAGCTGGG + Intergenic
1035066140 7:156106215-156106237 GCCTGTCTGCAGGCGCAGCCCGG - Intergenic
1035263235 7:157674826-157674848 CCCCCCCGGCAGGAGGAGCTCGG - Intronic
1036285475 8:7441332-7441354 CCCTCTCTCCAGGAGCACACAGG - Intergenic
1036335999 8:7870197-7870219 CCCTCTCTCCAGGAGCACACAGG + Intergenic
1036430171 8:8682357-8682379 CCATCTCTGCAGAACCAGTTTGG - Intergenic
1036457730 8:8924442-8924464 CAGTCACTGCTGGAGCAGCTGGG + Intergenic
1037879273 8:22565263-22565285 CTCTCTCTCCAGCAGCACCTGGG - Exonic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038045773 8:23764467-23764489 CACCCTCTGCTGGAGCAACTGGG + Intergenic
1039887823 8:41665210-41665232 CCCTCTCGGCTGAAGCAGCCCGG + Intronic
1039895522 8:41714115-41714137 CCTGCTCTCCAGGGGCAGCTGGG + Intronic
1041795859 8:61747239-61747261 CCTTCTCTGCAGCTGCAGGTAGG - Intergenic
1042194587 8:66221486-66221508 CCCTGTCAGCAGGAGGAGGTAGG - Intergenic
1042953218 8:74222035-74222057 CCCTCTCTACCGCTGCAGCTAGG - Intergenic
1043475744 8:80604188-80604210 CCCTCTCTGCAAGAGATGCTGGG - Intergenic
1043978333 8:86608735-86608757 CCCTCTCTGCCTCGGCAGCTAGG + Intronic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1045888014 8:107122886-107122908 GCCTCTCCGCAGGAACAGCCTGG + Intergenic
1047589154 8:126309028-126309050 CTCTGTCTGCAGGTGCAGGTTGG + Intergenic
1047771135 8:128031051-128031073 CCCTCAGTCCAGGAGCAACTTGG + Intergenic
1048174047 8:132135458-132135480 CCGTCAGTGGAGGAGCAGCTGGG - Intronic
1048899264 8:139022170-139022192 CCCCCTCTGCAGGAGCCTCTGGG + Intergenic
1048906274 8:139092633-139092655 CTCCCTCTGCTGGGGCAGCTGGG - Intergenic
1049261617 8:141642041-141642063 CTCTCTCTGCGGAAGAAGCTGGG - Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049483527 8:142839477-142839499 CCTCCACCGCAGGAGCAGCTGGG - Intronic
1049595969 8:143483521-143483543 CCCTCCCTGCCGGCCCAGCTTGG - Intronic
1049887038 9:34648-34670 ATCTCACTGCAGGGGCAGCTGGG + Intergenic
1050947914 9:11549665-11549687 GCCGCTCGGCAGGAGCAGCCTGG + Intergenic
1051542368 9:18234167-18234189 ACATTTCTGCATGAGCAGCTGGG + Intergenic
1052352691 9:27473469-27473491 CCCTCTCTGCTTGTCCAGCTTGG - Intronic
1053016527 9:34665363-34665385 CTCTCTCTGCAGGATCTACTGGG - Exonic
1054898652 9:70343012-70343034 ACCTCTCAGCAGGAGCAGATTGG - Intronic
1056735321 9:89204768-89204790 CTGTCTCTCCTGGAGCAGCTGGG + Intergenic
1056841363 9:90000226-90000248 CTCTTTCTGCAGGAGCAGCAGGG - Intergenic
1057114986 9:92512583-92512605 CCATCTCTGCATAAGAAGCTTGG + Intronic
1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG + Intronic
1059153159 9:111967130-111967152 TCTTCTCTGCAGGATCTGCTGGG - Intergenic
1059438240 9:114289062-114289084 CCCTCCCTGCAGGAGGGTCTGGG + Intronic
1060170454 9:121456993-121457015 CCCTCTAAGCAGGAGTAGGTTGG + Intergenic
1060342914 9:122792740-122792762 CTCTCTCTGCAGGAGCAGACAGG + Intergenic
1060405671 9:123371855-123371877 GCCTTTCTGCAGGAGCTACTTGG + Intronic
1060496859 9:124125598-124125620 CTGGCTCTTCAGGAGCAGCTTGG + Intergenic
1061061473 9:128252715-128252737 CCCTATCTCCATGAGCAGCACGG + Intronic
1061087194 9:128405983-128406005 CCTTCTCAGCAGCAGGAGCTGGG + Intergenic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1061490487 9:130941259-130941281 CACTCCCAGCAGGAGCCGCTAGG - Intergenic
1061638091 9:131928225-131928247 TCCTCTCTGGAGGAGCAGGGAGG - Intronic
1061789571 9:133051956-133051978 TCCTCTCTGGAGGGGCCGCTGGG + Intronic
1061824848 9:133251858-133251880 GCTTCGCAGCAGGAGCAGCTGGG - Intronic
1062016071 9:134292019-134292041 CCCCTTCTCCAGGAGCAACTTGG - Intergenic
1062034335 9:134376169-134376191 GCCCCTCTGCAGGCGCAGCCAGG + Intronic
1062463656 9:136672061-136672083 TCCTTCCTGGAGGAGCAGCTGGG + Exonic
1062696295 9:137877883-137877905 CCCTCCCTGCCGGGGCCGCTGGG + Exonic
1185844509 X:3425110-3425132 CCCTCTCTGGTGCTGCAGCTTGG + Intergenic
1188135913 X:26494811-26494833 CCTTCCCTACAGGAGCATCTGGG + Intergenic
1189051679 X:37651989-37652011 ACCTGTCTTCAGCAGCAGCTGGG + Intronic
1190137204 X:47807844-47807866 CCGACTCTGCAGCACCAGCTTGG + Intergenic
1190561165 X:51686685-51686707 CCCTCTCTGCTGAAGCAGAAAGG + Intergenic
1190563126 X:51706632-51706654 CCCTCTCTGCTGAAGCAGAAAGG - Intergenic
1192221082 X:69197750-69197772 GCCTCTTTGCATTAGCAGCTTGG - Intergenic
1192370614 X:70509828-70509850 GCCTCTCAGCAGGAGCCACTGGG - Intergenic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1194756043 X:97741204-97741226 CCCTCTCTGGAGAAGGGGCTGGG + Intergenic
1195279633 X:103318491-103318513 ACCTCTCTGAAGGAGAGGCTTGG + Intergenic
1195544662 X:106101069-106101091 CCCCCTCTGCAGGAGTCACTGGG + Intergenic
1197137779 X:123083072-123083094 CCCTCGCTGCAGGGTCATCTTGG + Intergenic
1198033094 X:132774455-132774477 GTCTCTCTGCATGAGAAGCTGGG - Intronic
1199120343 X:144045421-144045443 CTCTATTTGCAGTAGCAGCTAGG + Intergenic
1200044569 X:153394322-153394344 CCCTCGCTGCAGGAGAAGCTGGG + Intergenic
1201391597 Y:13503138-13503160 CCATCACTGCAGACGCAGCTGGG + Intergenic