ID: 947820406

View in Genome Browser
Species Human (GRCh38)
Location 2:233065024-233065046
Sequence TATCCAAGGCTGACTGTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947820402_947820406 -8 Left 947820402 2:233065009-233065031 CCGGCCAAGGGGCTTTATCCAAG 0: 1
1: 0
2: 2
3: 7
4: 106
Right 947820406 2:233065024-233065046 TATCCAAGGCTGACTGTGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 159
947820401_947820406 0 Left 947820401 2:233065001-233065023 CCAGAAAGCCGGCCAAGGGGCTT 0: 1
1: 0
2: 1
3: 4
4: 67
Right 947820406 2:233065024-233065046 TATCCAAGGCTGACTGTGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 159
947820396_947820406 26 Left 947820396 2:233064975-233064997 CCAGAGCTACTGACATCTGGCTC 0: 1
1: 0
2: 1
3: 8
4: 144
Right 947820406 2:233065024-233065046 TATCCAAGGCTGACTGTGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947820406 Original CRISPR TATCCAAGGCTGACTGTGCC GGG Intronic
901050469 1:6423735-6423757 TTTCCAGTGCTGACTGTGCCAGG + Intronic
901846516 1:11986390-11986412 TGTGCACAGCTGACTGTGCCTGG - Intronic
902822920 1:18954554-18954576 AATGGAAGGCTGCCTGTGCCTGG + Intronic
903359230 1:22766497-22766519 TGAGCTAGGCTGACTGTGCCAGG + Intronic
903679397 1:25087229-25087251 TAGCCAAGGCTTTGTGTGCCTGG - Intergenic
904070214 1:27789993-27790015 TATGGAAGGCTGACTGTAGCTGG - Intronic
904285176 1:29449372-29449394 TATTGAAAGCTGACTGTGCCAGG - Intergenic
904420155 1:30386009-30386031 TATTGAAAGCTGACTGTGTCAGG + Intergenic
906635037 1:47403781-47403803 TACCCAAAGCTGATTGGGCCAGG - Intergenic
907047161 1:51306285-51306307 TGCCCATGGCTGAGTGTGCCAGG - Intronic
908586424 1:65575027-65575049 TATCCAAGGCATACTATGGCTGG + Intronic
917442940 1:175082843-175082865 TATCCCAGGCTGAGGGAGCCTGG - Intronic
918869007 1:189942210-189942232 AATCCAAGGGAGACTGTGACTGG + Intergenic
919351824 1:196466890-196466912 TACCCAAGGCTGACCCTGCTTGG - Intronic
922648297 1:227313963-227313985 TATGCAAGGCTGTCTGTACATGG - Intronic
923539635 1:234878593-234878615 TATCCCAGGCTGATTGTTCTCGG + Intergenic
923950077 1:238940438-238940460 TATGGAAAGCTGACTGTGCAAGG - Intergenic
1063683726 10:8215326-8215348 TAGCCTAGGCTGAATGTGCTTGG + Intergenic
1063973244 10:11396133-11396155 TCTCCTGAGCTGACTGTGCCTGG - Intergenic
1065494361 10:26313669-26313691 TCTCCACGGCTGGCTGGGCCGGG + Intergenic
1068709565 10:60118901-60118923 TATCAAAGCCAGAGTGTGCCAGG + Intronic
1069003979 10:63297344-63297366 TGTCCAAGCCTGGCTGAGCCCGG - Intronic
1069994597 10:72334799-72334821 GATCCATGGCTGACTCTGCCTGG - Exonic
1071591648 10:86880123-86880145 TATCCCAGGCTGACTCAGTCAGG - Intronic
1073086991 10:100898124-100898146 TATCTAAGCATGACTGTGCCTGG + Intergenic
1073368308 10:102963581-102963603 GATTCAAGGCTGATTGTTCCCGG + Intronic
1076356761 10:129858770-129858792 GCTCCAGGGCTCACTGTGCCAGG + Intronic
1076427444 10:130377680-130377702 CATCCAAGGATGGCTGTGCGGGG + Intergenic
1076621378 10:131790466-131790488 GATACAAGGATGAGTGTGCCTGG - Intergenic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1078108344 11:8372672-8372694 TTCCCAAGGCTGACTGGGACAGG + Intergenic
1079021291 11:16911293-16911315 TCTCTAAGGCTGACAGGGCCAGG + Intronic
1080050939 11:27858309-27858331 TACCCATGCCTGACTGTGCTAGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083947826 11:65934954-65934976 TATCCAAGGCTGAGAGTGTAAGG - Intergenic
1084012410 11:66359905-66359927 TAGCCAGGGCTGACTGGACCAGG - Intronic
1084162934 11:67360281-67360303 TATCAAAGTTTTACTGTGCCAGG + Intronic
1084423330 11:69071431-69071453 TCCCCAATGCTGGCTGTGCCTGG + Intronic
1088121538 11:106376120-106376142 TATCCAAAGTTGACTGTGAGAGG + Intergenic
1088735767 11:112726585-112726607 AATCCATGGCTGCCTTTGCCTGG + Intergenic
1090967519 11:131611948-131611970 TATCCAAGGGTGTGTGTACCAGG - Intronic
1093149461 12:15604149-15604171 TATGCTATGCTGACTCTGCCAGG - Intergenic
1093518089 12:20014993-20015015 TCACCAGGGCTGACTGTGGCTGG - Intergenic
1095643758 12:44517769-44517791 TTTCCAAGGGTGACTGTGTCTGG + Intronic
1098536086 12:71595067-71595089 CATCCAATGCTGCCTGTGACTGG - Intergenic
1102416729 12:112769099-112769121 TATTGAATACTGACTGTGCCAGG - Intronic
1104837847 12:131803378-131803400 TTTCCAAGGGTGACTTTGGCTGG + Intergenic
1105705998 13:22967717-22967739 TATCCCAGGCTCCCTGTTCCAGG - Intergenic
1107374188 13:39784450-39784472 TATCCAATGCTTACTGCCCCTGG - Intronic
1115418383 14:33163795-33163817 TATTCCAGGCCGAATGTGCCAGG + Intronic
1116083804 14:40208532-40208554 TAACAAAGGCTGACTGTCCCTGG + Intergenic
1118041424 14:61921169-61921191 TTTTCAAGGCTTACTGTGCCAGG - Intergenic
1118320915 14:64752894-64752916 TATCTAGGGCTGTCTCTGCCTGG - Intronic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1121683063 14:95810402-95810424 TAGCCAAGGTTCTCTGTGCCTGG + Intergenic
1123105383 14:105839044-105839066 GATCCCAGACTGTCTGTGCCTGG + Intergenic
1123915746 15:25024833-25024855 TATCCAAGGTTGACAGTGAAGGG + Intergenic
1125938274 15:43656381-43656403 AAACCAAGGGTCACTGTGCCAGG - Intronic
1125950545 15:43747697-43747719 AAACCAAGGGTCACTGTGCCAGG - Intronic
1127659611 15:61088063-61088085 TATCAAGGCCTGAATGTGCCAGG + Intronic
1127783285 15:62334754-62334776 TATAGATGTCTGACTGTGCCTGG + Intergenic
1128469163 15:67937538-67937560 TATCAAAGGCTGACAGTGGTAGG - Intergenic
1138217448 16:55216840-55216862 TGTCCAAGAATGACTATGCCTGG - Intergenic
1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG + Intronic
1144859048 17:18288579-18288601 GATCCAAGCCTGACTTTGCAGGG - Intronic
1146376667 17:32299182-32299204 TTTACAAGGCTGACGCTGCCCGG - Intronic
1149419481 17:56495123-56495145 TATCCAAGTCTGTGTGTACCTGG - Intronic
1151254292 17:72863675-72863697 TCTACAAGGCTTACTGAGCCAGG - Intronic
1151541751 17:74768164-74768186 TCTCCAAGGCTGCCTCTGCCAGG - Exonic
1152250378 17:79209382-79209404 TCTCCAGGGCTGAGTGTGGCAGG + Intronic
1152529284 17:80907594-80907616 CAGCCAATGCTGACTGTGCCAGG + Intronic
1152600311 17:81258957-81258979 TTGCCAAGGATGACTGTTCCCGG - Intronic
1159169975 18:64753530-64753552 TATGAAAGGCTCACTATGCCAGG - Intergenic
1159392561 18:67812363-67812385 TAGCCTAGGCTGATTGTGTCCGG + Intergenic
1161285785 19:3467597-3467619 CAGCCAAGTCTGTCTGTGCCTGG - Intronic
1161352404 19:3801348-3801370 CCTGCAAGGCTGACTGTGACTGG + Intronic
1161698743 19:5783961-5783983 TATACAGGGCTGACTGGCCCAGG + Exonic
1162214727 19:9124282-9124304 TATGGAAGGCTGACTGTACTTGG - Intergenic
1164783561 19:30912325-30912347 TATGCAAGACAGAGTGTGCCAGG + Intergenic
1165299608 19:34960500-34960522 TTCCTAAGCCTGACTGTGCCAGG - Intronic
1166730194 19:45054861-45054883 CATGGAGGGCTGACTGTGCCAGG - Intronic
1166861202 19:45812383-45812405 TTTCAAAGGCTGACTGTGGCCGG - Intronic
1167508152 19:49881970-49881992 TGTCCCAGGCTGTCTGTGCTCGG - Intronic
926478893 2:13363351-13363373 TGTCCAATGCTGAATGTGCAGGG - Intergenic
927137187 2:20105540-20105562 GATCCAGGGCTGGCTTTGCCCGG + Intergenic
930026046 2:47029749-47029771 CATCCTTGGCTGACTGTGTCAGG - Intronic
930618752 2:53622840-53622862 TGTCCAGGGCTGCCAGTGCCTGG - Intronic
931177720 2:59870526-59870548 TGTTCAAGGCTGGCTGAGCCTGG - Intergenic
934041019 2:88127494-88127516 TATGGAGCGCTGACTGTGCCAGG - Intronic
938020947 2:127905441-127905463 GATCCAAGGGTGACTGTGTGAGG - Intergenic
941210801 2:162636453-162636475 TAGCCAAGGCTGATTTTGCATGG - Intronic
946234908 2:218318155-218318177 CATCCCAGGCTGCCTGTCCCTGG - Intronic
946681021 2:222216032-222216054 TATCAAAGGCTGCATGTGTCAGG - Intronic
947114897 2:226759077-226759099 TATCCAAAACTGCCTGTGTCCGG + Intronic
947820406 2:233065024-233065046 TATCCAAGGCTGACTGTGCCGGG + Intronic
1169880526 20:10341796-10341818 TACCCAAGTCTGGCTGTGTCTGG - Intergenic
1171316741 20:24202051-24202073 TAGCTAAGTCTGGCTGTGCCTGG + Intergenic
1171344466 20:24455446-24455468 TTTCCAGGGCTGGCTGAGCCTGG - Intergenic
1173749925 20:45469121-45469143 TGATCAGGGCTGACTGTGCCAGG - Intergenic
1174465848 20:50716691-50716713 CATCAAAGGCTCACTGTGTCAGG - Intergenic
1175077602 20:56389324-56389346 TATCCAAGTCTGACAGTCCAAGG - Intronic
1175705639 20:61174588-61174610 TCTCCCAGGCTGACTGGTCCAGG - Intergenic
1175776290 20:61655894-61655916 GCTCCAAGGCTGCATGTGCCTGG + Intronic
1175894962 20:62332089-62332111 CAACCAACGCTGTCTGTGCCAGG + Intronic
1179474792 21:41636255-41636277 CATCCAGTGCTGACTCTGCCAGG + Intergenic
1180154666 21:45972157-45972179 TACCCCAGGCTGGATGTGCCAGG - Intergenic
1181316711 22:21975264-21975286 TATCCAGGGGTGACAATGCCTGG + Intronic
1182739708 22:32558787-32558809 TAGCCAAGGCAGACTGTGCCAGG + Intronic
1184393027 22:44216311-44216333 TTGCCAAAGCTGACTTTGCCTGG - Intronic
1185003925 22:48264070-48264092 CCTCCAAGGATGCCTGTGCCTGG + Intergenic
950505475 3:13391850-13391872 GAGCCAAGGCTGGCTGGGCCTGG - Intronic
952861637 3:37817595-37817617 TAAACAAGGCTGACTGTATCGGG - Intronic
954262446 3:49449335-49449357 TATCCAAGGCTGATGGGGCCTGG + Intergenic
954375627 3:50192833-50192855 TAATAAAGGCTGCCTGTGCCGGG + Intronic
954441866 3:50526450-50526472 TTTCCAAGGCTGCCTCAGCCAGG + Intergenic
956051893 3:65257051-65257073 TATCAGAGGCTGTCTCTGCCTGG + Intergenic
957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG + Intergenic
960623822 3:119661023-119661045 TCTGCCAGGCTGCCTGTGCCTGG - Intronic
962376899 3:134866133-134866155 TGTCCAAGGCTGACCTTCCCTGG - Intronic
963267392 3:143252897-143252919 TAGCCAAGGATAACTGAGCCAGG + Intergenic
965477756 3:169178112-169178134 TATTGAATGCTGACTGTGTCAGG - Intronic
965479967 3:169206145-169206167 AATCCAAGCCTGTCTGTGGCAGG + Intronic
965847336 3:172979282-172979304 TATCCAAGGGGCACTGTGGCTGG - Intronic
967319717 3:188183668-188183690 TACCCAGTGCTCACTGTGCCAGG + Intronic
968293787 3:197557805-197557827 TCTTCAAGGCTGTATGTGCCAGG - Intronic
970008401 4:11431770-11431792 TATCTAAGGCTTATAGTGCCAGG + Intergenic
972586576 4:40442967-40442989 TATTCAAGGCTGAATAAGCCGGG - Intronic
978370187 4:108022337-108022359 TACTGAGGGCTGACTGTGCCGGG + Intronic
978703595 4:111678258-111678280 TAACCAAGCCTGACAGTGCTAGG + Intergenic
979645989 4:123069902-123069924 TATTAAAGGCTGACTGTTCTGGG + Intronic
980639211 4:135553051-135553073 TTTCAAAGGGTGACTTTGCCTGG + Intergenic
987040342 5:14056169-14056191 AAGCCGAGGCTGACTGAGCCAGG - Intergenic
987640775 5:20609178-20609200 TATGCAGTGCTGACTGTGCAAGG + Intergenic
988606155 5:32680038-32680060 TATCTAAGGCAGCTTGTGCCAGG + Intergenic
992062928 5:73074756-73074778 TTTCCAAGGCTGACAGGGCTGGG - Exonic
995459517 5:112388273-112388295 TATTTAAGGCTGACTCTGGCTGG - Intronic
997749953 5:136334897-136334919 AAGCCAAGGCTGACTGTTCAAGG + Intronic
1001798435 5:174521325-174521347 TTTCCAAGGCTAAATCTGCCTGG - Intergenic
1003690861 6:8352373-8352395 TAACCAAGACTGACTGTTGCTGG + Intergenic
1005295292 6:24419817-24419839 TATGCAAGGTTGACTGTACTGGG - Intronic
1006191237 6:32210832-32210854 ATTCCAAGGCAGCCTGTGCCAGG - Exonic
1014625290 6:123717501-123717523 TATACAAGGCTGTCTGTCCAAGG - Intergenic
1014988875 6:128048822-128048844 TATCCAAGGAGGACTGGTCCCGG - Intronic
1015830430 6:137363112-137363134 TCTCCAGGGCTGTCTGTGACAGG - Intergenic
1016236608 6:141875449-141875471 TATCCAAGTCTGGATGTGTCAGG + Intergenic
1016837966 6:148498091-148498113 TATCAAAGGCTGGCTGGGCGTGG + Intronic
1017390404 6:153932633-153932655 TTACCAAGACTGACTGTGCCTGG - Intergenic
1019497609 7:1347759-1347781 TATCCAGTCCTCACTGTGCCTGG - Intergenic
1022505574 7:30907122-30907144 TACCCCAGGCTGGCCGTGCCTGG - Intergenic
1022513994 7:30964020-30964042 TAGCCAAGGCTTACTGAGGCTGG + Exonic
1026880702 7:73905063-73905085 TGTTCGAGGCTGGCTGTGCCCGG + Intergenic
1026977593 7:74507942-74507964 TATCCAGGGCTGACCTTCCCTGG - Intronic
1034845804 7:154443447-154443469 TATCTAGGGCTTACTATGCCAGG - Intronic
1038387547 8:27163413-27163435 TATCCAATGCCCAGTGTGCCAGG - Intergenic
1046877003 8:119266261-119266283 TATCAAGGGCTGACTATGTCAGG + Intergenic
1048291193 8:133182940-133182962 TTTCAAAGCCAGACTGTGCCAGG - Intergenic
1049011289 8:139889372-139889394 TATCTGTGGCTGTCTGTGCCTGG - Intronic
1049011558 8:139890889-139890911 TATCTGTGGCTGTCTGTGCCTGG + Intronic
1053680796 9:40484047-40484069 CATCCATGCCTGACTCTGCCAGG + Intergenic
1053930784 9:43112359-43112381 CATCCATGCCTGACTCTGCCAGG + Intergenic
1054282917 9:63140888-63140910 CATCCATGCCTGACTCTGCCAGG - Intergenic
1054293878 9:63319562-63319584 CATCCATGCCTGACTCTGCCAGG + Intergenic
1054391903 9:64624051-64624073 CATCCATGCCTGACTCTGCCAGG + Intergenic
1054503826 9:65892277-65892299 CATCCATGCCTGACTCTGCCAGG - Intronic
1055913059 9:81373398-81373420 TTCCCATGGCTGACTGTCCCAGG - Intergenic
1059740343 9:117143925-117143947 AATCCGTGGCTGACTGTGTCTGG - Intronic
1062451613 9:136618068-136618090 TCTCCTAGGCTGGCTGTGGCTGG - Intergenic
1185784421 X:2877970-2877992 TCTCCAAGGGTGACTGTCCAGGG - Intronic
1187100478 X:16186328-16186350 TATCCAAAGCTGTCTTTGCTTGG + Intergenic
1188266125 X:28077261-28077283 TATTAAAGGCTGACTGTCTCTGG + Intergenic
1189401139 X:40669768-40669790 TATCTCAGGCAGACTGTGCAGGG - Intronic
1190309960 X:49110194-49110216 TCTCCCAGGCTGATTGTGCAGGG - Intergenic
1193629424 X:83863965-83863987 TCTCCTAGTCTGACTGTTCCTGG + Intronic
1196212244 X:113009133-113009155 TATCCATGACTGGCTGTGACTGG + Intergenic