ID: 947820940

View in Genome Browser
Species Human (GRCh38)
Location 2:233069001-233069023
Sequence TGCAGAGGGTACTGAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947820937_947820940 -6 Left 947820937 2:233068984-233069006 CCAATTGAGGGGGTGGGTGCAGA 0: 1
1: 0
2: 2
3: 12
4: 158
Right 947820940 2:233069001-233069023 TGCAGAGGGTACTGAAGTCCTGG 0: 1
1: 0
2: 2
3: 10
4: 189
947820933_947820940 4 Left 947820933 2:233068974-233068996 CCACTGGGCTCCAATTGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 95
Right 947820940 2:233069001-233069023 TGCAGAGGGTACTGAAGTCCTGG 0: 1
1: 0
2: 2
3: 10
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947820940 Original CRISPR TGCAGAGGGTACTGAAGTCC TGG Intronic
900226916 1:1537207-1537229 TGCTGAGGGGACTGACCTCCGGG - Intronic
900978053 1:6029474-6029496 TGCAGATGGCACAGATGTCCAGG + Intronic
901563928 1:10096434-10096456 TGAAGAGGGGAATTAAGTCCGGG + Intronic
904312089 1:29635525-29635547 TGCTGAGGGAATTGGAGTCCAGG - Intergenic
904672872 1:32179519-32179541 TGCATAAGGGACTGTAGTCCTGG - Intergenic
906660117 1:47575947-47575969 TGCAGGGGAAACTGATGTCCTGG - Intergenic
907404668 1:54246617-54246639 TGGAGAGGCTCCTGAAGGCCAGG - Intronic
908714198 1:67053397-67053419 TGCAGGGGACACTGAAGCCCCGG + Intronic
910129681 1:83888599-83888621 TACAGAGGGTACAGAAGTTTGGG + Intronic
915412208 1:155710523-155710545 TATAGAAGGTACTGAAGGCCGGG - Intronic
915456065 1:156041629-156041651 TGCTGAGGGTGCTGGGGTCCGGG + Exonic
918695751 1:187544339-187544361 TGCAGAGGGTAGTGAATCACTGG - Intergenic
918956090 1:191209578-191209600 TTCAGAGGATACTTAAGTTCTGG - Intergenic
919259528 1:195174198-195174220 TGCAGATGGAAATGCAGTCCAGG - Intergenic
1065239915 10:23694906-23694928 CGGAGAGGGTGCTGCAGTCCTGG + Intronic
1065689426 10:28317964-28317986 TGCACAGGGTACTGCAGTCATGG - Intronic
1069236235 10:66077997-66078019 TGATGAGGTCACTGAAGTCCTGG - Intronic
1069560579 10:69426603-69426625 TGATGAGGACACTGAAGTCCAGG + Intergenic
1070679457 10:78438426-78438448 TGCAGCTGGTTCTGGAGTCCAGG + Intergenic
1070719668 10:78747272-78747294 TGGAGAAAATACTGAAGTCCAGG - Intergenic
1071108419 10:82125865-82125887 CACAGAGCATACTGAAGTCCAGG - Intronic
1071291792 10:84194352-84194374 TTCCCAGGGTACTTAAGTCCTGG - Intergenic
1073594558 10:104786914-104786936 TGCAGAGGGCACTGAAAAGCAGG - Intronic
1077611555 11:3645983-3646005 TGCAGAGGGTGCAGAGGGCCAGG + Intronic
1077975496 11:7243970-7243992 GGTGGAGGGTACTGAGGTCCAGG + Intronic
1079382152 11:19947765-19947787 TGAAGAGGGAACTCAAGCCCAGG + Intronic
1081793769 11:45805851-45805873 TGCAGAGGGGTCTGAGGCCCCGG - Exonic
1083756408 11:64794012-64794034 TGCAGAGGGTAGGGGAGGCCAGG - Intronic
1083761051 11:64817988-64818010 TGGAGAAGGTAGTGAAGACCAGG + Intergenic
1085335209 11:75688142-75688164 TGGAAAGGGTACTGAAGCCAGGG - Intergenic
1087225381 11:95592838-95592860 TGCAGAGGGTCCTGAAGCCCAGG + Intergenic
1089161562 11:116441766-116441788 TTCAGAATGTTCTGAAGTCCAGG + Intergenic
1089876351 11:121725354-121725376 GGCAGAGGGCAATGAAGTCAAGG - Intergenic
1090187798 11:124749666-124749688 GGAAGAGGGTACTGGAGACCTGG - Intronic
1091488644 12:914207-914229 TTCAGAAGGTACTGAAGACATGG - Intronic
1091735993 12:2922372-2922394 TGGAGACGCTCCTGAAGTCCTGG - Exonic
1092956111 12:13551814-13551836 TGCAGAGGGTTCTTATGTCATGG + Exonic
1095600814 12:44011141-44011163 TTCAGAGGGTACAGAATTCTAGG + Intronic
1101127786 12:101655662-101655684 TTCAGAGGGTACAGAATTCTAGG - Intronic
1102090573 12:110183963-110183985 TGCAGAGGGAGCTGAAAACCAGG - Intronic
1104283740 12:127404062-127404084 TGCAAAGTGTGCTTAAGTCCAGG + Intergenic
1105288473 13:19028824-19028846 TGCAGATGGGACTGAACTGCTGG - Intergenic
1107105387 13:36637169-36637191 TGCACAGGGTAGTGAGGCCCTGG + Intergenic
1107343833 13:39438645-39438667 TGCAGAGGGCAGTGAGGCCCTGG - Intronic
1109224317 13:59674058-59674080 TGCAGCTGGTACTGAAGTGAAGG + Intronic
1112451929 13:99520402-99520424 TACAGAGGGTCCTGAAACCCGGG + Intronic
1115017470 14:28634142-28634164 TGCACAGGGTACTCAAATGCTGG - Intergenic
1118743441 14:68757669-68757691 TGCAGAGGGTGCTGAACTCTTGG + Intergenic
1118768868 14:68928584-68928606 TGCAAAGGGAACTGAAGTTTAGG - Intronic
1121616467 14:95317043-95317065 TGCAGAGGGTAGTCAAGTTATGG - Intronic
1122626873 14:103089456-103089478 GGCAGAGGGAAGGGAAGTCCAGG - Intergenic
1125267158 15:37896033-37896055 GACAGTGGGTACTGATGTCCAGG - Intergenic
1125732866 15:41903881-41903903 AGCAGCGGGTACTGCAGGCCGGG + Intronic
1125916549 15:43492990-43493012 TGCAGTGGGCTCTGAAGGCCTGG - Intronic
1126554065 15:49966285-49966307 TGGAAAGGGGACTGAAGTCAGGG + Intronic
1129382378 15:75176417-75176439 CGCACAGGGTTCTGAACTCCAGG + Intergenic
1130216660 15:81978083-81978105 TTCAGAGGGTATTGAAGTAAAGG - Intergenic
1130446595 15:84007885-84007907 TGGAGAGGGAAGTGGAGTCCAGG - Intronic
1131391930 15:92056799-92056821 TCCTGAGGATCCTGAAGTCCAGG - Intronic
1131435310 15:92417198-92417220 GGCAGAGGGGACTGGAGTTCTGG - Intronic
1131655398 15:94452147-94452169 TGTATAGGAAACTGAAGTCCAGG - Intronic
1132251840 15:100340861-100340883 TATAGAGGGTACCGAAGGCCGGG + Intronic
1133889864 16:9868700-9868722 TGCAGAGGGAAGGGAAGGCCTGG - Intronic
1139662359 16:68429793-68429815 AGGAGAGGGTAGTGAAGTCTGGG + Intronic
1140356163 16:74308613-74308635 TGGAGAGGGTCCTGAAGTCAAGG + Intergenic
1143658823 17:8312510-8312532 TGAAGGGGGTGCTGAAGGCCGGG + Exonic
1146214933 17:30971382-30971404 TGGAGAGGGAACTGGAGCCCGGG - Exonic
1148119125 17:45197478-45197500 AGCAGAAGGAACTGAAGTCTAGG + Intergenic
1148559776 17:48599197-48599219 TGTAGAGGGTACTGGAGTGAGGG - Intronic
1150653631 17:67025503-67025525 TGCAGAGGAAGCAGAAGTCCAGG + Intronic
1150983514 17:70169529-70169551 TGCAGAGCGCACTGGAGCCCTGG + Exonic
1152120866 17:78417468-78417490 GGCAGGGGGTAATGAAGTCGGGG + Intronic
1152170645 17:78745139-78745161 TGCACAGGAGACTGCAGTCCTGG - Intronic
1152495901 17:80671185-80671207 TGCAGAGGGCACTAAAGGCCAGG - Intronic
1152879163 17:82805532-82805554 GGCAGAGGGTCCCGAAGGCCGGG + Intronic
1152900762 17:82939769-82939791 AGCAGAGGGCACTGAAGGCCTGG + Intronic
1155380387 18:25216193-25216215 TTCAGAGCCTACTCAAGTCCCGG - Intronic
1156229367 18:35139009-35139031 TGCTGAGGTTACTGAGGTCAGGG - Intronic
1161399522 19:4061207-4061229 TGAGGAGGGGACTGAATTCCCGG - Intronic
1162212982 19:9107901-9107923 TAGTGAGGGTACAGAAGTCCTGG + Intergenic
1162952842 19:14082038-14082060 GGCAGGGGGCACTCAAGTCCAGG - Intronic
1163562746 19:18030111-18030133 TTTACAGGGTACTGAGGTCCTGG + Intergenic
1168252641 19:55149203-55149225 TGCTGAGGGCACTGAAGCTCCGG + Exonic
925476754 2:4225486-4225508 TACAGAAGGAACTGAGGTCCAGG + Intergenic
926053086 2:9757153-9757175 TGCAGAGGGGATTCAAGCCCTGG - Intergenic
928013711 2:27634735-27634757 TGCAGAGGTTACTCCAGTCTTGG + Intronic
932863225 2:75316177-75316199 TGCAGAGGGCACTGCAGAGCAGG + Intergenic
933847807 2:86339381-86339403 TTCAGCGGGTTCTGAAGTACAGG - Intergenic
934087101 2:88519076-88519098 TGAAGAGGGCACTGAGCTCCTGG + Intergenic
935709492 2:105884762-105884784 AGCAGTAGGTACTGAAGTTCAGG - Intronic
937288793 2:120769411-120769433 TGCACAGGGCACTGAGGTTCAGG - Intronic
939569937 2:143829236-143829258 TGCAGAAGGGGCTGCAGTCCTGG + Intergenic
941575047 2:167219599-167219621 TGCACAGGGTCCTGTACTCCAGG + Intronic
942092866 2:172510997-172511019 TGCTGATGGAACTGAAGTTCTGG + Intergenic
942918248 2:181338720-181338742 TGGAGAGGCAAATGAAGTCCAGG - Intergenic
945724772 2:213463022-213463044 TGCTGATAGTAATGAAGTCCAGG + Intronic
946163154 2:217848192-217848214 TGCAAAGGGGACTGAATTCGTGG - Exonic
946463090 2:219887438-219887460 TGCAGAGGAGACTGCAGACCTGG - Intergenic
947820940 2:233069001-233069023 TGCAGAGGGTACTGAAGTCCTGG + Intronic
1170561036 20:17558786-17558808 TGGAGAGGGTTTTGGAGTCCTGG - Intronic
1170657699 20:18305240-18305262 AGCAGAGAGTAGTGAAGCCCTGG - Intronic
1170877984 20:20268301-20268323 TGCTGATGTTACTGAAGCCCAGG + Intronic
1172281946 20:33714155-33714177 TGCAGAAGGCCCTGAAGGCCAGG + Intronic
1175683489 20:61008865-61008887 AGCAGAGGGAAATGAAGTCCTGG - Intergenic
1175873269 20:62218245-62218267 TGCAGATGGTCCTGAAGGCAGGG - Intronic
1177600489 21:23304411-23304433 TGCAGAGGGGACTAAACTCCAGG - Intergenic
1179610150 21:42545018-42545040 TGGAGCGGGTGCTGAGGTCCCGG - Intronic
1180007609 21:45030179-45030201 AGCAAAGGGTCCTGAAGCCCCGG + Intergenic
1183076684 22:35431806-35431828 CACAGAGGGAACTGAAGTCTGGG - Intergenic
1183291462 22:37004235-37004257 GGCAGAGGCTGCAGAAGTCCAGG - Intronic
1183485234 22:38084791-38084813 TCTAGGGGGTACTGAGGTCCTGG - Intergenic
1184478636 22:44735022-44735044 TGCAGGGGGTACATGAGTCCAGG + Exonic
1184782958 22:46658286-46658308 TGCAGGAGGTGCTGAAGGCCAGG + Exonic
1184895520 22:47404371-47404393 TGCAGTGGGTACTCAGGCCCTGG - Intergenic
1185157002 22:49199154-49199176 TGCAGAGGGGACTCATTTCCAGG - Intergenic
1185364742 22:50432287-50432309 TGCAGAGGATCCTGGAGGCCTGG + Exonic
950877605 3:16290493-16290515 AGCAGAGGGCACTGTAGTTCAGG + Intronic
952317057 3:32240141-32240163 TGCAGAAGTGACTGAAGACCTGG + Intronic
952953940 3:38545087-38545109 TGCAGAGGGCACTGCTGTCAGGG + Intergenic
954273194 3:49525256-49525278 TCCCCAGGGTCCTGAAGTCCCGG - Intronic
956885531 3:73555426-73555448 TGCAGAGATTCCTGCAGTCCAGG + Intronic
957983618 3:87544456-87544478 TTCAGATGGTCCTGAAGCCCAGG - Intergenic
958581915 3:96038014-96038036 TTCACAGGGTACAGAATTCCAGG + Intergenic
960851778 3:122062726-122062748 TACAGAGGACACTGAAGTTCAGG - Intronic
961379556 3:126488105-126488127 GGCTGAGGTTCCTGAAGTCCTGG - Intronic
961633491 3:128318387-128318409 TGCAGTGGGGACAGATGTCCTGG + Intronic
963732322 3:148986158-148986180 TGCTGAGGGTGCTGGGGTCCGGG + Intergenic
963861084 3:150311326-150311348 TCCAGAGGGCCCTGAAGTCATGG + Intergenic
964899078 3:161635655-161635677 AGATCAGGGTACTGAAGTCCAGG + Intergenic
965658673 3:171017732-171017754 AGCAGAGGGGAATGAAGTCCTGG + Intronic
966291179 3:178361272-178361294 TGGAAAGGGGACTGAAGTCAGGG + Intergenic
966817053 3:183897867-183897889 TGCAGAGGTTACTTAATCCCAGG - Intergenic
967865157 3:194184021-194184043 TGCAGAGGTCATTTAAGTCCAGG - Intergenic
968883308 4:3312750-3312772 TGGAGATGGTCCTGATGTCCGGG + Intronic
969875404 4:10132402-10132424 TCCAGATGGTCCTGCAGTCCTGG - Intergenic
970200209 4:13596738-13596760 TGGAGAGGCTACTGAAGTAGTGG + Intronic
971103998 4:23501247-23501269 TGCAGAGGACATTGGAGTCCTGG + Intergenic
971545491 4:27880219-27880241 TGCACAGGGAAGTGAAGCCCTGG + Intergenic
972347589 4:38205841-38205863 TGCAGAGGGTACGACAATCCTGG - Intergenic
975533074 4:75420907-75420929 TGGAGAGGGGACTGAAGCCAGGG - Intergenic
975920204 4:79377926-79377948 TGCTGAGGGTACTGATTGCCTGG - Intergenic
976331181 4:83832757-83832779 TGCTGAGGATACAGAAGTTCTGG - Intergenic
976617585 4:87094034-87094056 TTCAGAGGGCTCTGAAGGCCAGG - Intronic
978344837 4:107756337-107756359 TGCACAGAGTAATGGAGTCCTGG - Intergenic
978583813 4:110257410-110257432 TGGAGATGGTCCTGAAGTCAAGG - Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
981392363 4:144206020-144206042 AGCAGAAGGTTCTGGAGTCCAGG - Intergenic
982627675 4:157787826-157787848 TGCATAGGGTATTGCATTCCAGG - Intergenic
983012996 4:162572660-162572682 TGCAAAGGGTAGTGAAGTAATGG + Intergenic
986374973 5:7121782-7121804 TTCTGAGGCTTCTGAAGTCCTGG + Intergenic
991698110 5:69292600-69292622 TGCATGGGGTAGTGAGGTCCAGG - Intronic
994628509 5:102251817-102251839 TGAGAAGGGTACTGAAGTCTTGG + Intronic
997621105 5:135296810-135296832 TGCAGAGAAGACTGAGGTCCAGG + Intronic
997746476 5:136303947-136303969 TGCTGTGGGTATTGACGTCCAGG + Intronic
999329475 5:150662757-150662779 TGCAGAGGAGACTGAGGCCCAGG - Intronic
1001080918 5:168666691-168666713 TGCAGAGGGCATAGAAGTCAGGG + Intronic
1002781439 6:369814-369836 TGGAGAGAGTTCTGAATTCCTGG + Intergenic
1004517498 6:16332856-16332878 TGCAGAGGATGCTGATGTCACGG - Intronic
1004826429 6:19426201-19426223 TAGTGAGGGTACAGAAGTCCTGG - Intergenic
1013413650 6:109905169-109905191 TGTAGAGGAAACTGAAGTTCTGG + Intergenic
1013618055 6:111863027-111863049 TACAGAAGGCACTGAAGGCCAGG + Intronic
1019798779 7:3072430-3072452 TGCAGAGGTTACAGAGCTCCAGG - Intergenic
1020023941 7:4885310-4885332 TACAGAGGGTCCTGTATTCCTGG - Intergenic
1021275021 7:18639859-18639881 GGCTGAAGGTTCTGAAGTCCAGG + Intronic
1021602751 7:22380500-22380522 GAAAGAGGGCACTGAAGTCCTGG - Intergenic
1026103220 7:67399650-67399672 TGTACAGGGTACTGAAATACTGG + Intergenic
1028701437 7:93785417-93785439 TGCAGATGGTGATGAAGTCTAGG + Intronic
1029513036 7:101008731-101008753 TGAAGAGGGTACTGAAGTTCTGG - Exonic
1029612018 7:101631478-101631500 TCCAGAGGTAACTGAGGTCCTGG + Intergenic
1030612653 7:111706178-111706200 TGGAAAGGGTGCTGAAGCCCGGG - Intergenic
1032393072 7:131569149-131569171 TTCAGAGGTTAATGAAGTCATGG - Intergenic
1034277088 7:149828779-149828801 TGCAGGGGGTACCGGAGCCCAGG - Intergenic
1035376360 7:158409428-158409450 TGGAGAGGGCACAGAAGACCTGG + Intronic
1036813709 8:11885844-11885866 TGCAGAGGCCACTGATGTCCTGG + Intergenic
1038010539 8:23472404-23472426 TGCAGTGGGTCCTGAATCCCAGG - Intergenic
1038084007 8:24173667-24173689 TGAGGAGGGGCCTGAAGTCCTGG + Intergenic
1040602951 8:48902391-48902413 TCCACAGGGTACAGAAGTCCAGG + Intergenic
1041180260 8:55239932-55239954 GGCAGAGGGTGCTGAGGTCTGGG - Intronic
1045151806 8:99416393-99416415 TGGAAAGGGGACTGAAGTCAGGG - Intronic
1046179392 8:110623774-110623796 TGTAGAGAGAACAGAAGTCCAGG - Intergenic
1047132728 8:122038937-122038959 TGCGGAGGGTCAGGAAGTCCAGG - Intergenic
1048616689 8:136082656-136082678 TGGAGAGCGTGCTGAAGTACTGG - Intergenic
1048948001 8:139468263-139468285 TGCAGAGGGTACAAAAGTTAGGG - Intergenic
1049514015 8:143044058-143044080 TGCTGAGGGTGCTGAGGGCCTGG + Intronic
1053264581 9:36701364-36701386 TGGAGAGGTTACTGGAGACCTGG - Intergenic
1055489154 9:76787011-76787033 TGCAGAGGACACTGAAGGCAGGG - Intronic
1056258338 9:84823438-84823460 TGCAAGGGCTGCTGAAGTCCAGG - Intronic
1056428163 9:86499673-86499695 TTCACAGGGTACAGAATTCCAGG + Intergenic
1060293748 9:122329120-122329142 TGCAGAAGTTACTGAATGCCAGG - Intergenic
1060741720 9:126103155-126103177 TGAAGAGAGTACTGGGGTCCAGG - Intergenic
1061016914 9:127986676-127986698 TCCAGAGGGTCCTGAATGCCAGG - Intergenic
1061768693 9:132900290-132900312 TGCAGATGGTAGTTCAGTCCTGG - Intronic
1061806476 9:133140185-133140207 GGCAGAAGGTATTTAAGTCCTGG - Intronic
1062297588 9:135841013-135841035 TGGAAAGGGTGCTGAAGTCAGGG + Intronic
1062329336 9:136030312-136030334 TAAAGAGGGTACTGGAGGCCGGG + Intronic
1188561261 X:31471126-31471148 TGGAAAGGGGACTGAAGTCAGGG - Intronic
1190966946 X:55309807-55309829 TGCAAAGGATCCTGGAGTCCAGG - Intergenic
1191777333 X:64829741-64829763 TGTAGAGAGGACTTAAGTCCAGG + Intergenic
1192556706 X:72095745-72095767 TGCAGAGCATATTGAAATCCAGG - Intergenic
1192994003 X:76492837-76492859 TGGAAAGGGTACTGAAGCCAGGG + Intergenic
1199442683 X:147886318-147886340 TGCAAAGGGTAGTGGGGTCCTGG - Intergenic
1201442130 Y:14019753-14019775 TGCAGAGAGTACTGATGTTGTGG + Intergenic