ID: 947821319 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:233073070-233073092 |
Sequence | CAGGGTGAGTGAAGGGGGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2020 | |||
Summary | {0: 1, 1: 0, 2: 8, 3: 137, 4: 1874} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
947821319_947821328 | 4 | Left | 947821319 | 2:233073070-233073092 | CCATCCCCCCTTCACTCACCCTG | 0: 1 1: 0 2: 8 3: 137 4: 1874 |
||
Right | 947821328 | 2:233073097-233073119 | TGCCTCGCTTCAGCCAAACCTGG | 0: 1 1: 0 2: 0 3: 5 4: 93 |
||||
947821319_947821332 | 20 | Left | 947821319 | 2:233073070-233073092 | CCATCCCCCCTTCACTCACCCTG | 0: 1 1: 0 2: 8 3: 137 4: 1874 |
||
Right | 947821332 | 2:233073113-233073135 | AACCTGGGTAAAGCAGCCCCCGG | 0: 1 1: 0 2: 1 3: 9 4: 151 |
||||
947821319_947821329 | 5 | Left | 947821319 | 2:233073070-233073092 | CCATCCCCCCTTCACTCACCCTG | 0: 1 1: 0 2: 8 3: 137 4: 1874 |
||
Right | 947821329 | 2:233073098-233073120 | GCCTCGCTTCAGCCAAACCTGGG | 0: 1 1: 0 2: 1 3: 6 4: 87 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
947821319 | Original CRISPR | CAGGGTGAGTGAAGGGGGGA TGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |