ID: 947821319

View in Genome Browser
Species Human (GRCh38)
Location 2:233073070-233073092
Sequence CAGGGTGAGTGAAGGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2020
Summary {0: 1, 1: 0, 2: 8, 3: 137, 4: 1874}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947821319_947821328 4 Left 947821319 2:233073070-233073092 CCATCCCCCCTTCACTCACCCTG 0: 1
1: 0
2: 8
3: 137
4: 1874
Right 947821328 2:233073097-233073119 TGCCTCGCTTCAGCCAAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 93
947821319_947821332 20 Left 947821319 2:233073070-233073092 CCATCCCCCCTTCACTCACCCTG 0: 1
1: 0
2: 8
3: 137
4: 1874
Right 947821332 2:233073113-233073135 AACCTGGGTAAAGCAGCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 151
947821319_947821329 5 Left 947821319 2:233073070-233073092 CCATCCCCCCTTCACTCACCCTG 0: 1
1: 0
2: 8
3: 137
4: 1874
Right 947821329 2:233073098-233073120 GCCTCGCTTCAGCCAAACCTGGG 0: 1
1: 0
2: 1
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947821319 Original CRISPR CAGGGTGAGTGAAGGGGGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr