ID: 947821918

View in Genome Browser
Species Human (GRCh38)
Location 2:233078177-233078199
Sequence CATGGGTGTTAGCTGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947821911_947821918 5 Left 947821911 2:233078149-233078171 CCTTCTGGCCTCAGCAGCCGATG 0: 1
1: 0
2: 0
3: 15
4: 176
Right 947821918 2:233078177-233078199 CATGGGTGTTAGCTGCTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 160
947821907_947821918 23 Left 947821907 2:233078131-233078153 CCCTCGATCTCCTGACAGCCTTC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 947821918 2:233078177-233078199 CATGGGTGTTAGCTGCTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 160
947821910_947821918 13 Left 947821910 2:233078141-233078163 CCTGACAGCCTTCTGGCCTCAGC 0: 1
1: 0
2: 0
3: 35
4: 322
Right 947821918 2:233078177-233078199 CATGGGTGTTAGCTGCTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 160
947821913_947821918 -3 Left 947821913 2:233078157-233078179 CCTCAGCAGCCGATGGATTCCAT 0: 1
1: 0
2: 0
3: 5
4: 106
Right 947821918 2:233078177-233078199 CATGGGTGTTAGCTGCTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 160
947821908_947821918 22 Left 947821908 2:233078132-233078154 CCTCGATCTCCTGACAGCCTTCT 0: 1
1: 0
2: 0
3: 22
4: 194
Right 947821918 2:233078177-233078199 CATGGGTGTTAGCTGCTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947821918 Original CRISPR CATGGGTGTTAGCTGCTGCC AGG Intronic
900193249 1:1360282-1360304 CATGGGGGTCAGCTGCCCCCAGG - Intronic
901583975 1:10271210-10271232 CAAGGGTGTTATATGTTGCCAGG + Intronic
901691127 1:10973983-10974005 CAGGGGTGTCTTCTGCTGCCTGG + Intronic
901916617 1:12505134-12505156 CAGGGGTGTAGGCTGCTTCCGGG + Intronic
902330525 1:15729052-15729074 CTTGGGGCTTAGCTGCTGCCTGG - Intronic
902412473 1:16219474-16219496 CATGGAGTTTAGCTGCAGCCTGG - Intergenic
903771432 1:25766846-25766868 CAGGAGTGTGAGCTGCAGCCTGG + Intronic
905264528 1:36742160-36742182 CATGGGTGTGAAGTGCTGCATGG + Intergenic
907062949 1:51449773-51449795 AATGGGTGCTTGCTGCTGACTGG + Intronic
909104980 1:71396049-71396071 CATGTGTGTTTCCTGTTGCCTGG - Exonic
909240353 1:73205255-73205277 CCTGGTTGTTAGCTGGGGCCAGG - Intergenic
909495085 1:76269318-76269340 CATGGGTGTTTCCTGACGCCAGG + Intronic
912374411 1:109198652-109198674 CCTGGAAGTTTGCTGCTGCCAGG + Exonic
915709980 1:157886255-157886277 CATGGGAGAAAGCTGCTGGCTGG - Intronic
917314818 1:173713743-173713765 AATGGGTGCTTGCTGCTGACTGG - Intergenic
917970600 1:180204287-180204309 AGTTGGTGTTGGCTGCTGCCTGG + Intergenic
920967720 1:210715096-210715118 CATGAGTCTTTGCTGCTGTCAGG - Intronic
921080685 1:211736589-211736611 CCTGGATGCGAGCTGCTGCCCGG + Intergenic
922475449 1:225904346-225904368 CATTGGTGCTAAATGCTGCCAGG + Intronic
922980880 1:229825829-229825851 AATGGGTGCTAGCTGCTGAATGG + Intergenic
1066095085 10:32064704-32064726 CAGGGGTGGTGGCTGATGCCTGG - Intergenic
1066258655 10:33706777-33706799 GATGAGTGTAAGGTGCTGCCTGG - Intergenic
1069974283 10:72199683-72199705 CAGGCGTGTTAGCTCATGCCGGG - Intronic
1070287288 10:75093159-75093181 CAGGGGTGTTTGCACCTGCCAGG + Intergenic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1075564830 10:123495618-123495640 CATTGGTCTTATCTGCTGCCAGG - Intergenic
1076312681 10:129519782-129519804 CATGGGTGTTGACTGGTGGCCGG + Intronic
1080548556 11:33347666-33347688 CAGGGGTGTCACCTGTTGCCAGG - Exonic
1082160217 11:48882114-48882136 CTTGGGTGTCTGCTGCTTCCAGG + Intergenic
1082162149 11:48898292-48898314 CTTGGGTGTCTGCTGCTTCCAGG - Intergenic
1082235817 11:49819913-49819935 CTTGGGTGTCTGCTGCTTCCAGG + Intergenic
1082239283 11:49854469-49854491 CTTGGGTGTCTGCTGCTTCCAGG + Intergenic
1082242869 11:49889884-49889906 CTTGGGTGTCTGCTGCTTCCAGG - Intergenic
1082609330 11:55279841-55279863 CTTGGGTGTCTGCTGCTTCCAGG + Intergenic
1082657366 11:55870692-55870714 CTTGGGTGTCTGCTGCTTCCAGG - Intergenic
1083144713 11:60749606-60749628 CATGGGCTGCAGCTGCTGCCTGG - Intergenic
1085792532 11:79508222-79508244 CATGGGTTGTGGCTGCAGCCGGG - Intergenic
1090890461 11:130918367-130918389 GACGGGTGTGAGCTCCTGCCTGG + Intergenic
1093162980 12:15771007-15771029 CATGTGTGTTACCTGATACCAGG - Intronic
1096774986 12:53958104-53958126 GATGGGAGTTAACTGCAGCCTGG + Exonic
1097512769 12:60564828-60564850 CATGCTTGTTGGCTGCTGCAGGG + Intergenic
1098659783 12:73077016-73077038 CATGTGTGTTATCTGTTTCCTGG - Intergenic
1100119168 12:91348341-91348363 CATGTGTGTTGGCTGATGGCAGG + Intergenic
1102815325 12:115860647-115860669 CTTGGGGGTCAGCTTCTGCCTGG - Intergenic
1103208360 12:119148314-119148336 CTTGGGTGTGAGCTGAGGCCAGG - Intronic
1103922718 12:124407443-124407465 CATGGGTGTTAGCCCTGGCCAGG - Intronic
1105699721 13:22926817-22926839 CGTGGGTGGGAGCTGCGGCCTGG + Intergenic
1105851603 13:24340489-24340511 CGTGGGTGGGAGCTGCGGCCTGG + Intergenic
1108525512 13:51282710-51282732 GATGGTTGGTAACTGCTGCCTGG - Intronic
1109370521 13:61415101-61415123 CCTGGGAGTGAGCTGGTGCCCGG - Exonic
1110523137 13:76504661-76504683 CATGGGAGTTTGCTTCTCCCAGG + Intergenic
1111243134 13:85501868-85501890 AATGGGTGCTGGCTGCTGTCTGG - Intergenic
1113086229 13:106571887-106571909 CATGTCTTTTGGCTGCTGCCAGG + Intergenic
1113320462 13:109227736-109227758 AATTGGAGTTAGCTGCTGCAAGG - Intergenic
1113901744 13:113801683-113801705 CATCGGCGTCAGCGGCTGCCAGG + Exonic
1116458822 14:45147562-45147584 CTTAGGCGTGAGCTGCTGCCCGG + Intronic
1119775244 14:77244180-77244202 CTTGGGTGTCAGCCTCTGCCTGG + Intronic
1119846353 14:77833154-77833176 CCTGGAAGTTAGCTGCTGTCAGG - Intronic
1121118537 14:91360693-91360715 CATGACTGATAGCTGATGCCTGG - Intronic
1126510555 15:49467406-49467428 CATAGGTGTTAACTCCTCCCTGG + Intronic
1129926308 15:79367441-79367463 AAGAGGTGTTAGATGCTGCCAGG - Intronic
1132403560 15:101528681-101528703 CCTGGGTGGTGGCTGCTGGCCGG + Intergenic
1132415758 15:101617704-101617726 CAGGGGTGTTTGCAGCTGGCGGG + Intergenic
1140536568 16:75715081-75715103 CATAGTTGTGAGCTGCAGCCTGG + Intronic
1142260799 16:89041719-89041741 CACAGGAGTTTGCTGCTGCCAGG - Intergenic
1143064068 17:4229720-4229742 CATGGGACTCAGCTGCTGGCAGG + Intronic
1143947698 17:10608557-10608579 CATGAGGTTCAGCTGCTGCCTGG + Intergenic
1145868544 17:28256011-28256033 CATGGGTGGCAGCTGCTTCCAGG - Intergenic
1148911222 17:50944248-50944270 GATCAGTGTTAGCTGCAGCCTGG + Intergenic
1150395992 17:64822332-64822354 CATGGATGTGGGCCGCTGCCGGG - Intergenic
1150641904 17:66954969-66954991 CATGGCTGGAAGCAGCTGCCTGG - Intergenic
1154313610 18:13286102-13286124 CATGGGTGTCAGCGGCTGGAGGG - Intronic
1157198267 18:45637902-45637924 CCAGGGTGTCAGCTGCGGCCTGG + Intronic
1157490724 18:48121909-48121931 CATGGGTCTCTGCTGCTGCTTGG - Intronic
1159513129 18:69422136-69422158 CATGTGTGTCTCCTGCTGCCTGG + Intronic
1159938084 18:74384550-74384572 AATGGGTGCTTGCTGCTGACTGG - Intergenic
1160439048 18:78875150-78875172 CAAGCATGTCAGCTGCTGCCTGG - Intergenic
1160943945 19:1632559-1632581 TCTGGGTGTTAGCTGCTGACTGG - Intronic
1163565622 19:18049522-18049544 CCGTGGTGTTGGCTGCTGCCCGG - Intergenic
1164699109 19:30269827-30269849 CATGGGTGCCAGCTGCCTCCGGG - Intronic
1165489446 19:36114802-36114824 CGTGGGTATTCGCTTCTGCCAGG - Exonic
1165849889 19:38843646-38843668 CATGGGTCTTCACTGCTGCTTGG - Intronic
1166241597 19:41498545-41498567 CCTGGCTGCTAGCTGTTGCCAGG + Intergenic
925387736 2:3473982-3474004 CATGGCTGTGAGCTGTTGACTGG - Intronic
928209159 2:29311111-29311133 CAGCAGTGTTAGCAGCTGCCAGG + Intronic
928757952 2:34547920-34547942 CATGGCTGGCTGCTGCTGCCAGG - Intergenic
932072217 2:68632238-68632260 CATTTGTTTGAGCTGCTGCCAGG - Intergenic
933416790 2:81996593-81996615 CTTAGGTGATAGCTGCTGCTGGG + Intergenic
934588941 2:95529196-95529218 CTTGGGTGTCTGCTGCTTCCAGG + Intergenic
937642110 2:124225138-124225160 CCTGGTTGTAAGCTGATGCCTGG + Intronic
939177030 2:138760683-138760705 CATGGGTTTAAGGTGGTGCCAGG - Intronic
943589988 2:189784856-189784878 CATGGGTTAAATCTGCTGCCTGG - Intronic
944932907 2:204538556-204538578 CTTTGGTTTTAGCTCCTGCCAGG + Intergenic
945676258 2:212858735-212858757 CATGCATGTTAGGTGATGCCAGG + Intergenic
946033185 2:216721352-216721374 CATGGGTGATGGCTGTTGGCAGG - Intergenic
947821918 2:233078177-233078199 CATGGGTGTTAGCTGCTGCCAGG + Intronic
948072705 2:235140592-235140614 CATGGGTGTTGGATGGTGGCTGG - Intergenic
948816660 2:240513726-240513748 CCTGGGAGTCAGCAGCTGCCTGG - Intronic
948816830 2:240514824-240514846 CCTGGGAGTCAGCAGCTGCCTGG + Intronic
949040853 2:241849473-241849495 CAGGGGTGGTACCTGGTGCCAGG - Intergenic
1172106256 20:32518845-32518867 CAGGGGTTGCAGCTGCTGCCTGG + Intronic
1172205408 20:33159776-33159798 CAGTGAGGTTAGCTGCTGCCTGG + Intergenic
1173257172 20:41402033-41402055 CTTGGGTGTCTCCTGCTGCCTGG - Intergenic
1175297976 20:57922395-57922417 CAAGTGTGTCAGCTACTGCCAGG - Intergenic
1176018664 20:62951887-62951909 CCTGGGTGGTGGCTGCTGCGTGG + Intergenic
1176327020 21:5509903-5509925 CATGGTTGTTAGTGGCAGCCGGG + Intergenic
1176400737 21:6311048-6311070 CATGGTTGTTAGTGGCAGCCGGG - Intergenic
1176436420 21:6678056-6678078 CATGGTTGTTAGTGGCAGCCGGG + Intergenic
1176460682 21:7005126-7005148 CATGGTTGTTAGTGGCAGCCGGG + Intergenic
1176484243 21:7386904-7386926 CATGGTTGTTAGTGGCAGCCGGG + Intergenic
1177682927 21:24397483-24397505 AATTTGTGTTTGCTGCTGCCAGG - Intergenic
1178451378 21:32704615-32704637 CATGGGTGTTAGGGGCACCCCGG + Intronic
1178788017 21:35672500-35672522 CATGGTAGTTAGCTCCTGCAAGG - Intronic
1179351649 21:40617072-40617094 TCTGGGTGTTGGCTTCTGCCTGG - Intronic
1180089423 21:45526133-45526155 CCTGGGTGCTGGCTCCTGCCTGG - Intronic
1182314912 22:29439243-29439265 TATGGGGATTAGCTGCTGTCTGG + Intronic
1182506628 22:30787848-30787870 GAGGGGTGTTAGCTGGAGCCTGG + Intronic
1182695035 22:32192801-32192823 CATGGGGATTAGCTGCTGTCTGG - Intronic
1182716319 22:32358523-32358545 CATGGGGATTAGCTGCTGTCTGG + Intronic
1182766224 22:32760114-32760136 CATGGGTGCTGGCTGCTGGTGGG - Intronic
1184702791 22:46188045-46188067 CATGCCTGGTAGCTGGTGCCAGG - Intronic
949699990 3:6745606-6745628 AATGGGTGCTTGCTGCTGACTGG + Intergenic
951946064 3:28137615-28137637 CATGGCTGTTCCCTGCTCCCTGG - Intergenic
953740466 3:45534270-45534292 CATGGGTATTAGGTGCCCCCAGG + Intronic
958151216 3:89696980-89697002 AATGGGTCGTAGCTGGTGCCAGG + Intergenic
961933053 3:130554331-130554353 CATGGGGGTGGGCTGCTGGCTGG + Intergenic
968637813 4:1691123-1691145 CATGGGCGGAAGCTGCTGCCAGG - Intergenic
971271143 4:25147106-25147128 CTTGGCTGTTAGCTTCTGACTGG + Intronic
972581268 4:40397658-40397680 TATGGGTGTGAGCCACTGCCTGG + Intergenic
972684279 4:41336523-41336545 CAGGTGTGGTAGCTCCTGCCTGG + Intergenic
974076778 4:57174116-57174138 CATGGGTGTTTGCAGCTCCTTGG - Intergenic
975917234 4:79340263-79340285 CATGGTTGGTTGCTGTTGCCAGG + Intergenic
979437790 4:120714784-120714806 CATTTGTGTTTGCTGCTGCCAGG + Intronic
981456081 4:144954496-144954518 CAGCTGTGTTAGCTGCTGACAGG - Intergenic
982138727 4:152297174-152297196 AATGGGTGTTGGCTGGTTCCTGG + Intergenic
982398770 4:154942676-154942698 CATGGGTGCCAGCAGTTGCCTGG + Intergenic
985386735 4:189455101-189455123 AATGGGTGTTGGCTGGTGCCTGG - Intergenic
990922268 5:60980240-60980262 TATGGATATTCGCTGCTGCCTGG - Intronic
995203244 5:109449675-109449697 CACAGGTGCTAGCTGCCGCCTGG + Intergenic
995966144 5:117910233-117910255 AATGAGTGTTTGCTGCTGACTGG + Intergenic
1001700406 5:173702479-173702501 CATGGAGGTGAGCTGCTGCTAGG + Intergenic
1001842248 5:174887993-174888015 AATGGGTTTTAGCTGCTTGCTGG - Intergenic
1002637862 5:180617057-180617079 CATGCTTGTTAGCTGTTCCCTGG - Intronic
1003148006 6:3525344-3525366 CATGGGTGATCACTGCTGCTTGG + Intergenic
1012240371 6:96864299-96864321 CATGGGTGTTTGCTGATTCTTGG - Intergenic
1019917602 7:4143731-4143753 CATGGGTGTTTGCTTCTCCCAGG + Intronic
1023921885 7:44636234-44636256 AATGGGTGTCAGCTACTGCTGGG + Intronic
1024226271 7:47328635-47328657 CATGGGTGTAGGCTCCTGCCGGG - Intronic
1026649270 7:72200706-72200728 CATCATTGTTTGCTGCTGCCAGG - Intronic
1026953437 7:74362309-74362331 GATGGGGGCTGGCTGCTGCCTGG - Intronic
1026962251 7:74416469-74416491 CTTGGGTCTCAGCTGCTGCAAGG - Intergenic
1028840188 7:95421149-95421171 GATGTGTGTGAGCTGCTGTCTGG - Intronic
1029474170 7:100773299-100773321 CAGGGGCTGTAGCTGCTGCCAGG - Exonic
1031372264 7:120982662-120982684 CAAGGGTGCTAGATGCTCCCAGG + Intergenic
1032108647 7:129056173-129056195 CTTGGGAGCTAGCTTCTGCCGGG - Intergenic
1032261593 7:130341807-130341829 CTTTGGTGTTAGATGATGCCGGG + Intergenic
1034087587 7:148334338-148334360 CATGGGTTTTAGGTGCAGCCTGG + Intronic
1034196874 7:149254771-149254793 CATAGGGGTGAGCAGCTGCCTGG + Exonic
1035327752 7:158075863-158075885 CATGGAGCTGAGCTGCTGCCAGG - Intronic
1035411293 7:158644725-158644747 GATGGATGTTGGATGCTGCCAGG - Intronic
1042587115 8:70352902-70352924 TATGGGTGTTATCTGCTGCCAGG - Intronic
1047757855 8:127932211-127932233 CATGGGTATAAGGTGCTCCCAGG + Intergenic
1047870915 8:129081135-129081157 CATGGGTGCTAGCTGCTGGTGGG - Intergenic
1048426476 8:134328464-134328486 CTTGGGTGCTAACTGCTTCCTGG - Intergenic
1049767168 8:144360257-144360279 CAGGGGTGGTGCCTGCTGCCTGG - Exonic
1056021202 9:82440309-82440331 CATGGGTGTTAGAAGCAGCCAGG - Intergenic
1058115824 9:101083025-101083047 CATGGGAGTAAGCTGAGGCCCGG + Intronic
1058960620 9:109989635-109989657 CAGGAGTGTTTGCTGCTGTCAGG + Intronic
1060171287 9:121463428-121463450 CCTGGGTTTTAGCTGCTTCCTGG + Intergenic
1060376538 9:123119580-123119602 GATAGGCGTCAGCTGCTGCCAGG - Intronic
1061175777 9:128995779-128995801 GCTGGGTCTTAGCTGCTCCCTGG + Intronic
1061852747 9:133425455-133425477 CCTGGGAGTCAGCAGCTGCCTGG + Intronic
1062472832 9:136713748-136713770 GAGGGGTGTTGGCTGCTCCCAGG + Intronic
1185542388 X:912649-912671 CATGGGTTTGAGCTTCTGCCTGG - Intergenic
1186052938 X:5618866-5618888 AATGGGTGTTTGCTGCTGACTGG + Intergenic
1187476303 X:19614113-19614135 CAAGTGTGTGAGCTGCTGCCAGG - Intronic
1188837676 X:34978414-34978436 CATGGGTGGCAGCTGCTGCTAGG - Intergenic
1192325696 X:70130137-70130159 CATAGGTGGTACCTTCTGCCTGG - Intergenic
1195062114 X:101206316-101206338 AATGGGTGTCAGTTGCTGGCAGG - Intergenic
1197847832 X:130822395-130822417 AATGGCTTTTTGCTGCTGCCTGG - Intronic
1200758812 Y:7016954-7016976 GGTGGCTGTCAGCTGCTGCCTGG + Intronic