ID: 947825713

View in Genome Browser
Species Human (GRCh38)
Location 2:233104945-233104967
Sequence GCCTGATCTCACAGGAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947825709_947825713 10 Left 947825709 2:233104912-233104934 CCAGGTGTGGTTTCAGGTGAAGT 0: 1
1: 0
2: 1
3: 13
4: 133
Right 947825713 2:233104945-233104967 GCCTGATCTCACAGGAGCTGTGG 0: 1
1: 1
2: 3
3: 29
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947825713 Original CRISPR GCCTGATCTCACAGGAGCTG TGG Intronic