ID: 947825713 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:233104945-233104967 |
| Sequence | GCCTGATCTCACAGGAGCTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 324 | |||
| Summary | {0: 1, 1: 1, 2: 3, 3: 29, 4: 290} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947825709_947825713 | 10 | Left | 947825709 | 2:233104912-233104934 | CCAGGTGTGGTTTCAGGTGAAGT | 0: 1 1: 0 2: 1 3: 13 4: 133 |
||
| Right | 947825713 | 2:233104945-233104967 | GCCTGATCTCACAGGAGCTGTGG | 0: 1 1: 1 2: 3 3: 29 4: 290 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947825713 | Original CRISPR | GCCTGATCTCACAGGAGCTG TGG | Intronic | ||