ID: 947826263

View in Genome Browser
Species Human (GRCh38)
Location 2:233107804-233107826
Sequence GCGGGTGGTTGGAGACAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947826249_947826263 24 Left 947826249 2:233107757-233107779 CCGGGTGTCTGGGGTGGGAGTCA 0: 1
1: 0
2: 1
3: 31
4: 274
Right 947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG 0: 1
1: 0
2: 0
3: 26
4: 428
947826255_947826263 -6 Left 947826255 2:233107787-233107809 CCTGCTGGCCCCAGCTGGCGGGT 0: 1
1: 0
2: 1
3: 20
4: 243
Right 947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG 0: 1
1: 0
2: 0
3: 26
4: 428
947826253_947826263 -5 Left 947826253 2:233107786-233107808 CCCTGCTGGCCCCAGCTGGCGGG 0: 1
1: 0
2: 3
3: 23
4: 269
Right 947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG 0: 1
1: 0
2: 0
3: 26
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947826263 Original CRISPR GCGGGTGGTTGGAGACAGGG TGG Intronic
900574273 1:3375266-3375288 GCCGGTGGGTGGACACAGTGGGG - Intronic
900638374 1:3676458-3676480 GGGGATGCTTGGGGACAGGGAGG + Intronic
901792360 1:11661135-11661157 GCGGGTAGTTGGAGAATGTGTGG - Exonic
903008595 1:20314669-20314691 CAGGGTGGGGGGAGACAGGGAGG + Intronic
903396713 1:23007088-23007110 GAGGATGGCTTGAGACAGGGAGG + Intergenic
904090116 1:27939201-27939223 CCTTATGGTTGGAGACAGGGGGG - Intronic
904493213 1:30872887-30872909 GCTGGTGGTGGAAGAAAGGGTGG - Intronic
904674818 1:32192458-32192480 GGGGGTGGGAGGAGACAGGCTGG + Intronic
905797261 1:40822766-40822788 GCAGCTGGTTGGAGAAAGTGTGG + Intronic
906646764 1:47480908-47480930 GAGAGAGGCTGGAGACAGGGAGG - Intergenic
907301590 1:53490247-53490269 GAGGAAGGTGGGAGACAGGGTGG - Intergenic
907318523 1:53588201-53588223 GCTGGATGATGGAGACAGGGAGG - Intronic
907429918 1:54405879-54405901 GCGGGCGGTGGGAGGCAGGTGGG - Intronic
908128294 1:61050961-61050983 GCCGGTGGGTGGGGGCAGGGAGG + Intronic
912737642 1:112164394-112164416 GTGGGTGGAGGGAGAGAGGGTGG + Intergenic
912777408 1:112514393-112514415 GCAGGGGGGTGGTGACAGGGAGG - Intronic
912971812 1:114290589-114290611 GAGGATGCTTGGACACAGGGAGG + Intergenic
913198601 1:116477915-116477937 GGTGGTGGATGGACACAGGGAGG - Intergenic
913959140 1:143326267-143326289 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
914053457 1:144151647-144151669 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
914125740 1:144814894-144814916 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
915079313 1:153340697-153340719 CAGGGTGGTTGGGGGCAGGGTGG - Intronic
915107984 1:153546148-153546170 GGGGGTGGTGGGTGACAGGTGGG + Intronic
915310536 1:155003966-155003988 GCTGGTGTTTAGAGAGAGGGCGG + Intronic
915835493 1:159172361-159172383 GCGGGTGGTGGGGGACGGGCGGG - Intronic
916820841 1:168397220-168397242 GAGAGTGGTTGGAGACTGAGGGG + Intergenic
917779394 1:178376042-178376064 GGGGGTGGGTGGAGACAAAGAGG + Intronic
917848609 1:179041653-179041675 ACGGGAGATGGGAGACAGGGAGG + Intronic
918032104 1:180824854-180824876 ACGTATGGTTGGAGACAGGCTGG + Exonic
919773621 1:201179028-201179050 GTGGGTGGGTGGAGACATTGGGG - Intergenic
920398282 1:205661828-205661850 GCCAGTGGGTGGAGTCAGGGTGG - Intronic
920439575 1:205970440-205970462 GGGGGTGGTAGGAGAAACGGGGG - Intergenic
920696381 1:208184199-208184221 TGGGGTGGGTTGAGACAGGGAGG + Intronic
922223651 1:223627359-223627381 GGGGGTGGCTGGAGAGAGGTTGG - Intronic
924565880 1:245198051-245198073 GTGGGTGGTAGGAGGAAGGGAGG - Intronic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1063495019 10:6499033-6499055 GCAGGTTGTTGGAGACATGCTGG + Intronic
1064089004 10:12367596-12367618 GGGGGTGATGGGAGACAGTGAGG + Intronic
1064097946 10:12437822-12437844 GCCAGGGGTTGGAGACAGGGAGG - Intronic
1064254138 10:13729656-13729678 GCGGCTGCTTAGGGACAGGGGGG + Intronic
1064386826 10:14901739-14901761 GAGGATGGCTTGAGACAGGGAGG + Intronic
1065695298 10:28374261-28374283 GAGGGTGGATGGAGAAAGGGAGG - Intergenic
1066315441 10:34241402-34241424 GAGGGTGGTGGGAGACCCGGTGG + Intronic
1067543570 10:47175649-47175671 GAAGGTGTTTGGAGACAGGCAGG - Intergenic
1068627506 10:59265046-59265068 GCAGGTTGTTGGTGAGAGGGAGG + Intronic
1069575693 10:69526698-69526720 GAGGATTGTTGGAGACTGGGAGG + Intergenic
1069948891 10:72006023-72006045 TGGGGTGGGTGGGGACAGGGAGG + Intronic
1070533070 10:77354297-77354319 CTGAGTGGTTGGAGACAGGCAGG - Intronic
1070566067 10:77604868-77604890 GGGGGAGGGTGGAGGCAGGGAGG - Intronic
1071621834 10:87127537-87127559 GCGGGGGGTGGCAGACGGGGTGG - Intronic
1072791097 10:98318463-98318485 GTGGGTTGTTGAAGACAGAGAGG + Intergenic
1072916492 10:99540348-99540370 GGGGGTCGTGGGAAACAGGGCGG + Intergenic
1074088768 10:110227461-110227483 GAGGGAAGTTGGAGAGAGGGCGG + Intronic
1075087717 10:119424544-119424566 GTGGGTGGTTGGGGGAAGGGTGG - Intronic
1075206415 10:120453186-120453208 GCGGGTGGTGGGGGGTAGGGGGG + Intergenic
1075331779 10:121579268-121579290 GCGGGCGGTTGGAGGTAGTGGGG + Intronic
1075372962 10:121953460-121953482 GAGGGTGGTAGGAATCAGGGTGG - Intergenic
1075716397 10:124558280-124558302 GTGGCTGGCTGGGGACAGGGAGG - Intronic
1076948032 10:133665130-133665152 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076949022 10:133668440-133668462 TCGGGTGGTTCGGGGCAGGGCGG + Intronic
1076950006 10:133671739-133671761 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076950990 10:133675038-133675060 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076951980 10:133678348-133678370 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076952969 10:133681658-133681680 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076953953 10:133684957-133684979 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076954937 10:133741309-133741331 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076955926 10:133744619-133744641 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076956916 10:133747929-133747951 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076957903 10:133751238-133751260 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076958888 10:133754537-133754559 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076959877 10:133757847-133757869 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1076960861 10:133761146-133761168 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
1077090767 11:777318-777340 GCGGGAGGTTCGGGACACGGTGG - Intronic
1077177252 11:1196517-1196539 GCGGGAGGCTGGGGACTGGGTGG - Intronic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1078855091 11:15200699-15200721 GGGGGTTGCTGGAGGCAGGGAGG + Intronic
1081207349 11:40291673-40291695 GTGGGTGGAGGGAGAAAGGGTGG - Intronic
1081504115 11:43697010-43697032 GCGGGGGGTGGGAGGCAAGGGGG + Intronic
1081666215 11:44918541-44918563 GCGGGGGGTTGGAGAAAGATGGG + Intronic
1081777467 11:45685342-45685364 GGGGTGGGCTGGAGACAGGGTGG - Intergenic
1083363524 11:62127901-62127923 GCGGGGGGGTGGGGACAGGGAGG + Intronic
1085079551 11:73622815-73622837 GAAGGTGGTTTGAGACAGGTGGG + Intergenic
1085269646 11:75262738-75262760 CCAGGTGGTTGGTGACAGGCAGG + Intergenic
1086681807 11:89681868-89681890 GGGGGTGGTGGGGGGCAGGGAGG + Intergenic
1087095033 11:94309821-94309843 GGGAGTGGTGGGAGAGAGGGAGG + Intergenic
1088875870 11:113935808-113935830 GCGGGAGGTTGGGGACGGGTAGG + Intronic
1089666653 11:120024875-120024897 GCCAGTGGCTGGAGACAGCGAGG - Intergenic
1089973096 11:122710334-122710356 GCTGGTGGTTGGAGAGATGGTGG + Intronic
1090261948 11:125327619-125327641 GAGGAGGGTTGGAGACTGGGAGG + Intronic
1090450503 11:126801991-126802013 GGGGGTGTTTGGAGACAGTGAGG - Intronic
1090562647 11:127949168-127949190 GTGGGAGGTTGGAGGGAGGGAGG - Intergenic
1091215505 11:133898972-133898994 GCTGCTGGTTGGTGACAGTGGGG + Intergenic
1091248240 11:134118570-134118592 GGGGTTGGTGGGAGACAGGCAGG - Intronic
1091802387 12:3332878-3332900 GCCTGTATTTGGAGACAGGGAGG - Intergenic
1091837477 12:3595862-3595884 GCGGGTGGCTGGTAACAGAGTGG + Intergenic
1092257738 12:6936518-6936540 GGGGCTGATTGGAGACAGAGAGG - Exonic
1092829942 12:12433956-12433978 GTTGGTGGTTGGGGACAGTGAGG + Intronic
1093209639 12:16292844-16292866 GTGGGTGGTAGGAGATTGGGTGG + Intergenic
1093435401 12:19129939-19129961 GCGGGCGGCTGGCGACACGGGGG + Intronic
1093816066 12:23548985-23549007 GGGGATGGCTGGAGACAGGTGGG - Intronic
1097190612 12:57217673-57217695 GAGTGGGGTTGGAGGCAGGGAGG - Intronic
1097296093 12:57964605-57964627 GCAGGTTGTGGGAGCCAGGGTGG + Intergenic
1100569787 12:95837089-95837111 GGGGGAGGGTGGAGAGAGGGAGG + Intergenic
1100728063 12:97430928-97430950 GAGAGTGGGTGGAGAGAGGGTGG - Intergenic
1101345578 12:103883109-103883131 GCAGGTTGTGGGAGACAGGATGG + Intergenic
1101443681 12:104722076-104722098 GCGGATGGTTTGAGCCTGGGAGG - Intronic
1101839928 12:108320746-108320768 GAGGGTGGGTGGAGCCAGTGTGG - Intronic
1102546123 12:113657041-113657063 GCGGGGGGTGGGGGGCAGGGAGG + Intergenic
1103073070 12:117960887-117960909 GAGGATGGTTGGAGACTGGAAGG - Intronic
1103105386 12:118219947-118219969 GGGGAGGGTTGGAGAGAGGGAGG - Intronic
1103162803 12:118744129-118744151 GTGGGTGATTGGAGAAAGAGGGG + Intergenic
1103563181 12:121803308-121803330 GCGGGTGGCTGGAGGAAGGGGGG + Intronic
1104134091 12:125921213-125921235 GCAGGTGGATGGAGTCGGGGAGG - Intergenic
1104365531 12:128173212-128173234 GTGGGTGGTTGGAGGGTGGGAGG + Intergenic
1104475403 12:129066842-129066864 GCGGGTGGTGGGCGTGAGGGTGG + Intergenic
1105281095 13:18963020-18963042 CCGGGTGGCTGGACACAGGCTGG - Intergenic
1106384150 13:29267831-29267853 AAGGGTGGTGGGAGACAGGAAGG + Intronic
1107907296 13:45072878-45072900 AGGGTTGGTTGGAGACAGAGGGG + Intergenic
1109284687 13:60397079-60397101 GCTGGTGGCTGGAGTCAGGACGG - Intronic
1110971309 13:81765457-81765479 GCTGGTGGTGGGAGATGGGGAGG - Intergenic
1112679837 13:101751030-101751052 GGGGGAGGGTGGAGAGAGGGAGG + Intronic
1113375880 13:109765433-109765455 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113375891 13:109765482-109765504 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113375902 13:109765531-109765553 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113375924 13:109765629-109765651 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113375969 13:109765825-109765847 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113376027 13:109766070-109766092 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113376060 13:109766217-109766239 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113376083 13:109766315-109766337 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113376162 13:109766658-109766680 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113376185 13:109766756-109766778 GTGGGGAGTTGGAGTCAGGGTGG - Intronic
1113643947 13:111979034-111979056 GAGGGTGGGTGGAGATGGGGTGG - Intergenic
1113963551 13:114139202-114139224 GGAGGTGGATGTAGACAGGGTGG + Intergenic
1113963583 13:114139343-114139365 GGAGGTGGATGTAGACAGGGTGG + Intergenic
1113963657 13:114139682-114139704 GGAGGTGGGTGTAGACAGGGTGG + Intergenic
1113963710 13:114139916-114139938 GGAGGTGGGTGTAGACAGGGTGG + Intergenic
1117007241 14:51433665-51433687 GAGGGTAGATGGAAACAGGGTGG + Intergenic
1117875814 14:60249343-60249365 ACGGGTGGTTGGGGAGGGGGGGG + Intronic
1117964262 14:61190634-61190656 CAGGGTGGTGGGAGACAGGCTGG - Intronic
1119182124 14:72612331-72612353 GCAGGTGGCTGGAGAGAGGCGGG - Intergenic
1119402366 14:74371946-74371968 GAGAGTGGTTGGAGACTGTGGGG - Intergenic
1119529279 14:75348284-75348306 GGAGGTGGTTGGAGATGGGGAGG + Intergenic
1120865781 14:89294184-89294206 GAGAGAGGCTGGAGACAGGGAGG - Intronic
1121488334 14:94338764-94338786 GTGGGTGGTGGGAGCCAGGTTGG - Intergenic
1121690444 14:95874604-95874626 ATGGGTAGTTGCAGACAGGGAGG - Intergenic
1122133828 14:99621186-99621208 GAGGTTGGTTTGAGCCAGGGAGG - Intergenic
1122922797 14:104886888-104886910 GCGGGTGGCTGGAGATGTGGGGG - Exonic
1202929280 14_KI270725v1_random:23916-23938 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1123423018 15:20147301-20147323 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1123532244 15:21153841-21153863 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1124967656 15:34448443-34448465 CCGGGTGGAGGGAGGCAGGGCGG + Intergenic
1125620503 15:41057360-41057382 GAGGATCGTTTGAGACAGGGAGG + Intronic
1125687265 15:41570848-41570870 AATGGTGGCTGGAGACAGGGAGG + Intronic
1129750313 15:78058398-78058420 TGGGGTGGTTGGAGATATGGAGG - Intronic
1130258175 15:82335412-82335434 GCGGGAGGCTGGAGAAGGGGCGG + Intergenic
1130596754 15:85254548-85254570 GCGGGAGGCTGGAGAAGGGGCGG - Intergenic
1131578271 15:93614042-93614064 GAGGGAGGTGGGAGAGAGGGCGG + Intergenic
1131768830 15:95712287-95712309 AGGGGTTGTTGGAGACATGGAGG + Intergenic
1132563415 16:609330-609352 GGGGATGGTGGGGGACAGGGTGG + Intronic
1132772688 16:1573114-1573136 ACGGATGGCTGGAGTCAGGGTGG + Intronic
1133047592 16:3097497-3097519 GGAGGTGGATGGGGACAGGGTGG + Intronic
1133207029 16:4239990-4240012 ACGGGTGGTTGGTAACAGAGGGG + Intronic
1133467006 16:6037001-6037023 GGAGGTGGGGGGAGACAGGGAGG + Intronic
1133742784 16:8663950-8663972 GTCGGGGGTGGGAGACAGGGAGG - Intergenic
1134610775 16:15606335-15606357 GCAGGTGGTTGGATTCAAGGTGG - Intronic
1135389336 16:22076437-22076459 GCTGGTGGGTAGAGGCAGGGAGG + Intronic
1136170723 16:28487631-28487653 GAGGGTAGTGGGAGGCAGGGTGG - Intronic
1136276760 16:29183385-29183407 GCGGTTGCACGGAGACAGGGCGG - Intergenic
1137238561 16:46635317-46635339 GGGGGTGGTTGGGAACAGGAAGG + Intergenic
1137524383 16:49221499-49221521 TTGGGTTGTTGGTGACAGGGAGG - Intergenic
1137584466 16:49655998-49656020 GGGGGTGGGAGGAGAGAGGGAGG - Intronic
1138358253 16:56402989-56403011 ACGTGTGGTTGGAAACATGGAGG - Exonic
1139950415 16:70665558-70665580 GCAGGCGGTTGCAGACAGAGGGG + Intronic
1141582673 16:85011169-85011191 GCGGCGGGGTGGAGACAGAGCGG + Intronic
1141830099 16:86505671-86505693 GCGGGGGGTTGGAGGGAGCGGGG + Intergenic
1141896672 16:86962916-86962938 GTCAGTGGTTGGAGACATGGAGG - Intergenic
1142202927 16:88769766-88769788 GAGCGTGGTGGGAAACAGGGAGG + Intronic
1142228682 16:88889333-88889355 GGGGGTGGTGGGAGGGAGGGAGG + Intronic
1142261215 16:89043310-89043332 GAGGGTGGTGGCAGACAGAGAGG - Intergenic
1143011251 17:3867377-3867399 GCGGGTGGTGGGGCACAGGCTGG + Intronic
1143480999 17:7227364-7227386 GCAGGTGGCTGGAGAAGGGGAGG - Intronic
1143712601 17:8744760-8744782 GAAGGTGGCTGGAGACAGGTTGG + Exonic
1144922122 17:18772744-18772766 GGGGGTGGTGGGAGACGGGGAGG + Intronic
1147990023 17:44326832-44326854 GCGGGCGGGTGGAGGCGGGGGGG + Intergenic
1147995025 17:44355551-44355573 GCTGGTGGTTGAAGACAGCGGGG - Intronic
1149332758 17:55603741-55603763 GTGGGTGGTGGGAGGGAGGGGGG + Intergenic
1149580275 17:57745136-57745158 GCGGGTGGTGGGAGGCAGGAGGG + Exonic
1149867648 17:60159584-60159606 GTGGGTGGAGGGGGACAGGGTGG - Intronic
1150223085 17:63508115-63508137 GAGGGTGGTTGGGGGCTGGGAGG - Intronic
1151223646 17:72632359-72632381 GTGGGAGGGTGGAGGCAGGGAGG - Intergenic
1151811079 17:76442367-76442389 ACGGGGGGTGGGAGACAGAGTGG + Intronic
1152481690 17:80558209-80558231 GGGGATGGTTTGAGTCAGGGAGG + Intronic
1152539675 17:80968653-80968675 GGAGGTGGGTGGACACAGGGCGG + Intergenic
1152965811 18:112389-112411 TCGGGTGGTTCGGGGCAGGGCGG - Intergenic
1157032038 18:43922940-43922962 GTGGTTGTCTGGAGACAGGGTGG + Intergenic
1158422165 18:57304752-57304774 GCCTGTGGTGGGAGTCAGGGTGG + Intergenic
1159071705 18:63630037-63630059 TCGGGTGGGGGGAGGCAGGGAGG + Intergenic
1159444591 18:68525801-68525823 GGTGGTGTTGGGAGACAGGGTGG - Intergenic
1159529873 18:69641894-69641916 GAGGGTGGCTGGAGAGAGAGGGG - Intronic
1160241154 18:77124153-77124175 GCAGGAGGCTGGAGAAAGGGAGG - Intronic
1160319242 18:77875051-77875073 GCGGGTGGATGGAGGAGGGGCGG - Intergenic
1160541781 18:79627913-79627935 CCAGGCTGTTGGAGACAGGGTGG - Intergenic
1160786702 19:903438-903460 GCGGGTGGTTGGACAGGGTGGGG + Intronic
1161623173 19:5309955-5309977 GAGGGAGGTGGGAGCCAGGGAGG - Intronic
1161847481 19:6720048-6720070 GGGGGTGTTTGGAGACTCGGAGG - Intronic
1162077003 19:8194615-8194637 GAGGGTGGCTGGAGATAGGCTGG - Intronic
1162182083 19:8876717-8876739 GGGGGTGGTGTGGGACAGGGTGG + Intronic
1162625224 19:11879797-11879819 CTGGCTGGTTGGAGAGAGGGTGG - Intronic
1163003776 19:14384636-14384658 GAGGGTGGATGGAAACAGAGGGG - Intronic
1163123722 19:15233048-15233070 GCGGGTGGGCGGGGAGAGGGTGG + Intronic
1163628017 19:18402054-18402076 GCAGGTGGTGGGGGACAGGCAGG + Intergenic
1165493153 19:36136946-36136968 CAGGTTGGGTGGAGACAGGGAGG + Intergenic
1165833080 19:38738703-38738725 GCAGGAGGTTGGGGGCAGGGAGG - Intronic
1166038907 19:40190931-40190953 GCGGGTGGTTGGAGCAAGTTAGG - Intergenic
1166731849 19:45063873-45063895 GCGGGTGGATGGAGCCTGGAGGG - Intronic
1167173385 19:47848804-47848826 GAGGGTGTTTGGAGACCAGGAGG - Intergenic
1167494055 19:49807720-49807742 GCGGGTGGAGGGAAACAGGCAGG + Intronic
1168508780 19:56958070-56958092 GAGGGTGGTTGGTAACAGGGTGG - Intergenic
1202692856 1_KI270712v1_random:104070-104092 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
925017695 2:543944-543966 GTGGGAGGCTGGAGGCAGGGAGG + Intergenic
925137481 2:1531195-1531217 TGGGGTGGTTGCAGACAGTGTGG - Intronic
925285273 2:2711732-2711754 GTGTGTGGTGGGGGACAGGGTGG + Intergenic
925969215 2:9095446-9095468 TCTGGTGGATGGAGACAGGTGGG + Intergenic
926245821 2:11121905-11121927 GAGGTTGGTTGGGGTCAGGGTGG - Intergenic
926280130 2:11439326-11439348 GTGGGTGTTTGGAGAAAGGAGGG + Intergenic
926347118 2:11957574-11957596 GAGGGAGGCTGGAGACAGGTAGG + Intergenic
926542841 2:14202901-14202923 GGGGGGGGTGGGAGAGAGGGAGG + Intergenic
928517712 2:32059767-32059789 GAGGGTGGTTTGAGCCAGGGAGG + Intergenic
929529434 2:42738170-42738192 GAGGGTGGATTGAGACTGGGAGG + Intronic
932084760 2:68748105-68748127 ACAGGTGGGTGGAGACAGAGGGG - Intronic
933663323 2:84945151-84945173 GAGGGTGGGTGGTGAGAGGGTGG - Intergenic
933953545 2:87349897-87349919 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
933973175 2:87486607-87486629 GAGGATGGTTTGAGCCAGGGAGG + Intergenic
934237750 2:90246145-90246167 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
934275451 2:91570586-91570608 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
934460180 2:94209477-94209499 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
934770999 2:96907570-96907592 GTGGGTGGAGGGGGACAGGGCGG - Intronic
934943720 2:98520983-98521005 ACAGGTGGCTGGGGACAGGGAGG + Intronic
935084439 2:99830928-99830950 GTGGGTGGCTGGAGAAAGGCAGG + Intronic
935121357 2:100186194-100186216 GAGGGAGGATGGAGACAAGGGGG - Intergenic
935125961 2:100223159-100223181 GAGGATGGTTGGAGGCAAGGAGG - Intergenic
935471545 2:103466083-103466105 GCGGGTGGATCGAGATCGGGTGG + Intergenic
936050934 2:109223110-109223132 GCAGGTGGTTGGAGAGAGGTGGG + Intronic
937406309 2:121632152-121632174 GAGGATGGTTGGAGCCTGGGAGG + Intronic
938072683 2:128316951-128316973 GCTGGTGGTAGGAGGCTGGGCGG - Intronic
938228003 2:129634356-129634378 GAGGGTGGCTGGAGCCTGGGAGG + Intergenic
940658701 2:156520093-156520115 CTGGACGGTTGGAGACAGGGAGG - Intronic
940927086 2:159376340-159376362 GTGTGTGGTTGGTGACAGTGTGG - Intronic
941384749 2:164840692-164840714 GCGGGTGGAGGGCGACAGGAGGG - Intronic
947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG + Intronic
948837136 2:240631283-240631305 TCGTGTGGTGGGAGGCAGGGAGG + Intergenic
948884733 2:240877017-240877039 GCTGGTGGCTGGAGGCCGGGAGG + Intronic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
1169066715 20:2698050-2698072 GTGGGTGGGTGGCGAGAGGGTGG + Intronic
1170369677 20:15635585-15635607 GAGGGTGGGTGGAGGGAGGGAGG + Intronic
1171212338 20:23326725-23326747 CAGGGAGGTTGGAGACACGGAGG - Intergenic
1171786054 20:29465627-29465649 GCCTGTCGTTGGGGACAGGGAGG - Intergenic
1172045511 20:32077329-32077351 GTGGCTGGTTGGGGACAGGGTGG - Intronic
1172935261 20:38615647-38615669 TCTGGGGGTTGGAGATAGGGTGG + Intronic
1173403322 20:42743957-42743979 GTGGGTGGGTGGAGAAAAGGAGG - Intronic
1173956284 20:47035474-47035496 GCGGGTGGTGGCAGACAGAAGGG - Intronic
1173976519 20:47190860-47190882 GTGGATGGTTGGTGACTGGGTGG - Intergenic
1174247094 20:49189315-49189337 ATGGGAGGTTGGAGAGAGGGTGG + Intergenic
1174392168 20:50224381-50224403 GGGGGTGGTGGGGGACAGGAGGG + Intergenic
1175598810 20:60256337-60256359 GCGGGTGGCTGGAGATTAGGTGG + Intergenic
1175890370 20:62313289-62313311 TGGGGTGGGTGGAGACGGGGAGG + Intronic
1176032404 20:63019195-63019217 GCGGGTGGGTGGCGAGCGGGTGG - Intergenic
1176301229 21:5100054-5100076 GCGGGGGGCTGGACACACGGTGG - Intergenic
1177488010 21:21783655-21783677 GCTGGTGGGTGGGGAAAGGGTGG + Intergenic
1178727012 21:35062120-35062142 GAGGGTGAAGGGAGACAGGGAGG - Intronic
1179104047 21:38382702-38382724 GCGTGTGATTGTAGACAGAGGGG - Exonic
1179630467 21:42674689-42674711 GCTGGTGGTAGGAGAGAGGAAGG - Intronic
1179855801 21:44161845-44161867 GCGGGGGGCTGGACACACGGTGG + Intergenic
1179907951 21:44433929-44433951 GGGGCTGGGTGGAGGCAGGGAGG + Intronic
1179956062 21:44739407-44739429 GCAGGTGGATGGACAGAGGGAGG - Intergenic
1180059139 21:45375656-45375678 GCTGGGGGATGGAGGCAGGGAGG + Intergenic
1180274150 22:10629627-10629649 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1181084604 22:20433751-20433773 CTGGGTGGGTGGAGACAGTGGGG - Intronic
1181148920 22:20869046-20869068 GCGGGTGGTTCGAGACCAGCCGG + Intronic
1181356078 22:22297275-22297297 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1181522501 22:23457700-23457722 GGGGGTGGACGGAGACAGGCAGG - Intergenic
1181603557 22:23966628-23966650 GAGGGTCGGGGGAGACAGGGTGG + Intergenic
1181604956 22:23974679-23974701 GAGGGTCGGGGGAGACAGGGTGG - Intronic
1181675663 22:24450030-24450052 GTGGGTGGTCAGAGACAGGCTGG - Intergenic
1181738615 22:24901954-24901976 GCAGGTGGCTGGGGACAGCGAGG + Exonic
1181930084 22:26394023-26394045 GCTGGAGGCTGGAGAGAGGGGGG + Intergenic
1182000937 22:26919289-26919311 GCCAGTCCTTGGAGACAGGGTGG - Intergenic
1183219732 22:36504853-36504875 GCCGGCGGTTGGAGCCAGGCAGG - Intronic
1183432473 22:37774177-37774199 GAGGGTGGCTGGAGACAGAGGGG - Exonic
1183543285 22:38442094-38442116 GCAGGTGGCTGGGGACAGGGTGG + Intronic
1184278096 22:43421739-43421761 GTGGATGGATGGAGGCAGGGAGG - Intronic
1184636498 22:45836409-45836431 GCAGGAGGCAGGAGACAGGGAGG - Intronic
1184878109 22:47288346-47288368 GTGGGTGGATGGAGGGAGGGAGG - Intergenic
1184958636 22:47912177-47912199 TCTGGGGGTTGGAGAGAGGGAGG - Intergenic
950474198 3:13205516-13205538 GTGGGTGGATGGATAGAGGGAGG - Intergenic
952858775 3:37794991-37795013 GAGGGAGGAGGGAGACAGGGTGG - Intronic
953061134 3:39429489-39429511 GAGGGCGGTTGGAGAGAGGCTGG - Intergenic
954433776 3:50485177-50485199 GCTGGTGTTTAGGGACAGGGTGG - Intronic
955799084 3:62667794-62667816 GGGGGTGGGGGGAGACAGGGAGG + Intronic
956747945 3:72324257-72324279 GTGGGAGTGTGGAGACAGGGTGG - Intergenic
958475723 3:94578817-94578839 GAGGTTGGGTGGAGATAGGGAGG + Intergenic
960155026 3:114290866-114290888 GGGGGTGATGGGACACAGGGCGG + Intronic
961319207 3:126061358-126061380 GAGGCTGCTTGGAGACAGTGTGG - Intronic
961331883 3:126147357-126147379 GCAGCAGGCTGGAGACAGGGTGG + Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961658908 3:128458023-128458045 GCTGGAGGTGGGAGGCAGGGTGG + Intergenic
962302488 3:134254369-134254391 GTGGGTGGTTGGAGAAGGGGTGG + Intergenic
962383435 3:134914576-134914598 GAGGGTTGTTGGAGACATGGGGG + Intronic
965769487 3:172166826-172166848 GCGGGTGGGTGGGGGGAGGGGGG + Intronic
966596406 3:181727693-181727715 CAGGGTGGTTGGGGGCAGGGAGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968832276 4:2939058-2939080 GCTGGGGGTTGGAGCCAGGCAGG - Intronic
968985237 4:3871418-3871440 GCGGGCCATTGGAGCCAGGGTGG - Intergenic
969422885 4:7107573-7107595 GTGGGTGCCTGGAGACAAGGGGG + Intergenic
969952561 4:10853543-10853565 GGGGGTGGTTGGAGACCCAGTGG + Intergenic
970150137 4:13081028-13081050 GCTGGTGGTTGGGTACAGGTAGG - Intergenic
972511081 4:39769663-39769685 GGGGGTGGGTGGGAACAGGGAGG - Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
973710854 4:53629260-53629282 AGGGGTGGCTGGAGACAGGGAGG - Intronic
976892855 4:90071600-90071622 GAGAGTGGATGGAGAAAGGGAGG - Intergenic
978102326 4:104857521-104857543 GGGGGTGGGGGGAGAGAGGGAGG + Intergenic
978438339 4:108709414-108709436 GCGAGTGGGTGGAGTCATGGAGG - Intergenic
982240352 4:153293900-153293922 GCAGGGGGTTGGGGAGAGGGAGG + Intronic
984438652 4:179736888-179736910 ACGTGTGCTTGGACACAGGGAGG - Intergenic
984710431 4:182879912-182879934 GGGGGTGCTGGTAGACAGGGTGG + Intergenic
985451488 4:190065937-190065959 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
985452478 4:190069230-190069252 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
985453463 4:190072527-190072549 TCGGGTGGTTCGGGGCAGGGCGG + Intronic
985454453 4:190075820-190075842 TCGGGTGGTTCGGGGCAGGGCGG + Intronic
985455441 4:190079113-190079135 TCGGGTGGTTCGGGGCAGGGCGG + Intronic
985456426 4:190082407-190082429 TCGGGTGGTTCGGGGCAGGGCGG + Intronic
985457413 4:190085707-190085729 TCGGGTGGTTCGGGGCAGGGCGG + Intergenic
985458400 4:190089000-190089022 TCGGGTGGTTCGGGGCAGGGCGG + Intronic
985459389 4:190092300-190092322 TCGGGTGGTTCGGGGCAGGGCGG + Intronic
985463641 4:190175069-190175091 TCGGGTGGTTCGGGGCAGGGCGG + Exonic
986195766 5:5535390-5535412 TGGGGTGGTGGGAGGCAGGGAGG + Intergenic
986813555 5:11384750-11384772 GCGCTTGGTGGGCGACAGGGTGG + Exonic
987096610 5:14556098-14556120 GCGGGGGGGTGGGGAGAGGGTGG + Intergenic
987159222 5:15123511-15123533 GAGGCTGGTTGGAGCCAGAGTGG - Intergenic
988484605 5:31658240-31658262 GAGGGAGGGAGGAGACAGGGAGG - Intronic
990510391 5:56484242-56484264 ACAGGGGGTTGGAGCCAGGGAGG - Intergenic
990599441 5:57342725-57342747 CCTGGTGGTTGGCAACAGGGTGG - Intergenic
990756221 5:59073515-59073537 GCGGGTGGTTGGAGATGAGGAGG + Intronic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
993962774 5:94320457-94320479 GGGGGTGGATGAAGACAGGTTGG - Intronic
994215081 5:97128879-97128901 GAGGCTGGTTGGAGTCAGGAGGG - Intronic
995907697 5:117145593-117145615 GTGGGTGGGTAGAGACGGGGAGG - Intergenic
997459603 5:134042958-134042980 GTGGGTCGTGGGAGACAGGCTGG + Intergenic
999021918 5:148175440-148175462 GAGGGAGATTGGAGACATGGAGG - Intergenic
999213574 5:149912660-149912682 GGGTGTGGTTGGAGATATGGTGG - Intronic
999400454 5:151259925-151259947 GGGGGTGGGTGGAGAAGGGGAGG + Intronic
1000052576 5:157575566-157575588 GCGGGGGGATGGAGGCTGGGTGG - Intronic
1001056272 5:168452805-168452827 GCGGGTGGTTGAGGAAAAGGAGG - Intronic
1001403056 5:171457641-171457663 GCTGGTGGCTGGTGGCAGGGCGG + Intergenic
1001558078 5:172649791-172649813 GAGGCTGGGTGGACACAGGGAGG - Intronic
1002194455 5:177494674-177494696 GCGGGTGGCTGGAGAGAGGCAGG + Intronic
1002792240 6:445132-445154 GCGAGTGGATGGTGCCAGGGAGG + Intergenic
1002794690 6:463122-463144 AAGGGTGGTGGGAGGCAGGGAGG + Intergenic
1003977611 6:11358628-11358650 GCGGGTGGTGGTTGACAGGGTGG + Intronic
1005440994 6:25868522-25868544 CCATCTGGTTGGAGACAGGGAGG + Intronic
1005574097 6:27176074-27176096 GTGCGTGGTGGGAGACAGGAGGG - Intergenic
1006098874 6:31673330-31673352 GGGGGTTGGTGGAGACAGTGAGG - Exonic
1006136522 6:31899519-31899541 GGGGGTGGGTGGGAACAGGGAGG - Intronic
1007696228 6:43735947-43735969 GCAGGTGGGTGGAGGTAGGGAGG + Intergenic
1007765072 6:44155215-44155237 GCCGGTGGCTGGAGACCTGGGGG + Exonic
1007914651 6:45549901-45549923 TGGGGTGGTTGGAGTGAGGGTGG - Exonic
1011014773 6:82742845-82742867 GGGGCTGGTTGGAGTCAGGAGGG - Intergenic
1011194737 6:84769216-84769238 GCGGGGGGGTGGAGAGAGAGAGG - Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1012500342 6:99881314-99881336 GCAGGTGACTGGAGGCAGGGAGG - Intergenic
1013792623 6:113854813-113854835 GGGGGAGGTTGGGGAAAGGGTGG + Intergenic
1015327599 6:131941090-131941112 GCGGGTGGTGGGGGAAGGGGAGG + Intergenic
1015823182 6:137284330-137284352 GGGTGTGGGAGGAGACAGGGAGG + Intergenic
1016326074 6:142902928-142902950 ACAGGATGTTGGAGACAGGGGGG + Intronic
1018063558 6:160109296-160109318 GTGGGTTGCTAGAGACAGGGTGG + Intronic
1018263087 6:161989826-161989848 CCTGGTGGTAGCAGACAGGGAGG - Intronic
1019188525 6:170236053-170236075 GGTGGTGGCAGGAGACAGGGAGG - Intergenic
1019588832 7:1818867-1818889 GGGGGTGGACGGAGACAGGCAGG + Intronic
1019887269 7:3916142-3916164 GCGGGGGGTGGGAAAGAGGGAGG + Intronic
1020757895 7:12226608-12226630 GGTGGTGGTTGGAAAGAGGGAGG + Intronic
1022477607 7:30722055-30722077 GAGGCTGTTTTGAGACAGGGTGG - Intronic
1023925569 7:44667034-44667056 GAGGATGGTTTGAGACTGGGAGG - Intronic
1024233780 7:47382663-47382685 GGGGGTGGTGGGGGACTGGGGGG - Intronic
1024987870 7:55211767-55211789 GAGGCTGGTTAGCGACAGGGGGG - Intronic
1025562408 7:62383657-62383679 TTGGGTGGTTGGAGAGAGGCTGG + Intergenic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1025959457 7:66206933-66206955 GCGAGTGTTTGGAGAGGGGGAGG - Intronic
1026445727 7:70483038-70483060 GTGGGGGGTTGGAGATGGGGAGG + Intronic
1026931041 7:74223127-74223149 CCGGGTGGCTGGAGAGAGGGAGG - Intronic
1030872477 7:114774381-114774403 GCTGGGGGATGGAGACAGGCAGG + Intergenic
1030980669 7:116182074-116182096 GGGGGTGGGGGGAGGCAGGGAGG + Intergenic
1034373947 7:150627182-150627204 GGGGAGGGTTGGAGACTGGGTGG - Exonic
1035074436 7:156168955-156168977 GGGGGTGGTTGGGGGCAGTGGGG + Intergenic
1036799805 8:11781972-11781994 GAGGGTAGTTTGAGCCAGGGAGG + Intronic
1037826933 8:22165241-22165263 GCGGGGGGCGGGAGACAGGAAGG + Exonic
1038447325 8:27612952-27612974 GCGGGGGGTGGGGGGCAGGGGGG + Intronic
1038682416 8:29681303-29681325 CCAGGTGGTTGGGGGCAGGGTGG - Intergenic
1039472300 8:37821063-37821085 GAGGGTGGTGGGAGAGAGAGAGG - Intronic
1039984228 8:42434612-42434634 GAGGGATGTTAGAGACAGGGTGG + Intronic
1043377715 8:79668955-79668977 GTGGGTGGTGGGGGACAGTGAGG - Intergenic
1043979136 8:86618019-86618041 GGGGGTGATGGGAGACAGTGAGG + Intronic
1044113827 8:88309432-88309454 GAGGGTGGTAGGAGGGAGGGGGG + Intronic
1046698327 8:117369893-117369915 GGGGTTGGATGGAGAAAGGGTGG - Intergenic
1047041997 8:121006816-121006838 GCAGGTGGTAGGAGCCAGGCTGG + Intergenic
1047927636 8:129696992-129697014 GAGGGAGGTGGGAGAGAGGGAGG + Intergenic
1049033676 8:140057941-140057963 GCAGGTGGTCGGAGACTGGCAGG - Intronic
1049216584 8:141411099-141411121 GAGGGTGGTTTGTGGCAGGGAGG - Intronic
1049616048 8:143576166-143576188 CCGCGTGGGTGGAGAAAGGGTGG + Intronic
1049738417 8:144222226-144222248 GCTGGGGGTTGGGGGCAGGGTGG + Intronic
1050927195 9:11279255-11279277 GAGGGTGGCTGGAGTCTGGGAGG - Intergenic
1051080194 9:13285215-13285237 GATGGTGGTAGGAGACAGGAGGG - Intergenic
1052416802 9:28188407-28188429 GCAGGTGGTTGAAGAGAGGATGG - Intronic
1052879734 9:33594109-33594131 GGGGGTGGAAGGAGAAAGGGTGG + Intergenic
1053072924 9:35111602-35111624 GCGGGTGGTGGGGCACTGGGCGG - Intronic
1053496247 9:38550120-38550142 GGGGGTGGAAGGAGAAAGGGTGG - Intronic
1053690677 9:40585163-40585185 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1053807846 9:41821607-41821629 GTAGGGGGTGGGAGACAGGGAGG - Intergenic
1054274128 9:63052328-63052350 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1054301935 9:63386134-63386156 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054400712 9:64712640-64712662 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054434320 9:65196957-65196979 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054496070 9:65824724-65824746 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1054622746 9:67365821-67365843 GTAGGGGGTGGGAGACAGGGAGG + Intergenic
1055152965 9:73025205-73025227 ACAGTTGGCTGGAGACAGGGTGG - Intronic
1056759384 9:89404589-89404611 GCGGGTGGCTGGGGACGGGATGG - Intronic
1056759533 9:89405069-89405091 GCGGGTGGCTGGGGACAGGATGG - Intronic
1056902385 9:90611930-90611952 GATGGTGGCTGGAGACAGGCAGG - Exonic
1057596452 9:96418883-96418905 GCGGGTGGTGGGACCGAGGGCGG - Intergenic
1057819841 9:98322330-98322352 GCTGGATGTTGGAGCCAGGGTGG - Intronic
1058431676 9:104926515-104926537 ACCGGTGGTTGCAGACGGGGAGG - Intronic
1059465730 9:114467618-114467640 GCAGGTGCTGGGGGACAGGGTGG + Intronic
1060144697 9:121241877-121241899 GTGTGGGGTTGGAGACAGAGGGG - Intronic
1060183912 9:121552365-121552387 GCTGGTGGCTGGAGAGATGGTGG - Intergenic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1062026059 9:134341351-134341373 GCGTGTGGTTGGAGTCCTGGGGG + Intronic
1062539230 9:137034319-137034341 GAGGGGGGCTGGAGAGAGGGGGG + Intronic
1062547127 9:137068941-137068963 GCTGGTGTTTGGAGCCACGGCGG - Intronic
1203446868 Un_GL000219v1:64855-64877 GCCTGTCGTTGGGGACAGGGAGG - Intergenic
1203621330 Un_KI270749v1:131279-131301 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1185485909 X:481735-481757 GAGGGAGGAAGGAGACAGGGAGG + Intergenic
1187461415 X:19490657-19490679 GTGGATGGCTGGAGACTGGGAGG + Intronic
1188370583 X:29365298-29365320 GGAAGTGGTAGGAGACAGGGAGG + Intronic
1190054990 X:47176124-47176146 GGGGGTGAGGGGAGACAGGGAGG - Intronic
1190339899 X:49287742-49287764 GGTGGTGGTGGGAGCCAGGGAGG + Exonic
1190430632 X:50374942-50374964 GCAGGGGGTTGGAGTCTGGGAGG - Intronic
1191016243 X:55813321-55813343 GCAGGGGGCTGGAAACAGGGGGG + Intergenic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1195255036 X:103082017-103082039 GAGGCTGGGTGGAGACAGGTGGG + Intronic
1195304793 X:103570960-103570982 GATAGTGGTTGGTGACAGGGTGG + Intergenic
1195649553 X:107271044-107271066 GAGGATGGTTTGAGACAGGGAGG - Intergenic
1196119075 X:112029122-112029144 ACGGGGGGTTGGAGGGAGGGTGG - Intronic
1197970892 X:132113922-132113944 GTGGGGGGTTGGAGACTTGGGGG - Intronic
1198264094 X:134993338-134993360 GAGGATGGTTTGAGCCAGGGAGG + Intergenic
1200145234 X:153922942-153922964 AGGGGTGGGTGGGGACAGGGAGG + Intronic
1202584329 Y:26408426-26408448 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic