ID: 947827054

View in Genome Browser
Species Human (GRCh38)
Location 2:233113651-233113673
Sequence TTACTGCAGCCAGAGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947827046_947827054 28 Left 947827046 2:233113600-233113622 CCACACTGCCCACCTTTCCTATC 0: 1
1: 0
2: 2
3: 49
4: 450
Right 947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 138
947827048_947827054 19 Left 947827048 2:233113609-233113631 CCACCTTTCCTATCTCATTAAAT 0: 1
1: 1
2: 2
3: 44
4: 415
Right 947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 138
947827051_947827054 -8 Left 947827051 2:233113636-233113658 CCAACATCAACCAAGTTACTGCA 0: 1
1: 0
2: 1
3: 21
4: 350
Right 947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 138
947827049_947827054 16 Left 947827049 2:233113612-233113634 CCTTTCCTATCTCATTAAATATC 0: 1
1: 0
2: 0
3: 33
4: 344
Right 947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 138
947827047_947827054 20 Left 947827047 2:233113608-233113630 CCCACCTTTCCTATCTCATTAAA 0: 1
1: 0
2: 4
3: 40
4: 392
Right 947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 138
947827050_947827054 11 Left 947827050 2:233113617-233113639 CCTATCTCATTAAATATCACCAA 0: 1
1: 1
2: 3
3: 32
4: 336
Right 947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947827054 Original CRISPR TTACTGCAGCCAGAGATCTA GGG Intronic
900084700 1:886375-886397 CAACTCCAGCCAGAGTTCTATGG - Intergenic
902722763 1:18315071-18315093 TCACTCCAGCCACAGATCTCTGG - Intronic
906584683 1:46965885-46965907 TCACTCCAGCCAGGGTTCTATGG - Intergenic
906746829 1:48228109-48228131 TTACTGGAGCCAGACAGCCAGGG + Intronic
907235979 1:53048176-53048198 TCAGTGCAGCCAGAGATCCAAGG + Intronic
908179504 1:61589795-61589817 TTACTGCCGCCATCCATCTAGGG + Intergenic
909824086 1:80103972-80103994 ATTCTGCAGCCATAGATCAAGGG - Intergenic
911360425 1:96869305-96869327 TGACTCCAGTCAGAAATCTAGGG - Intergenic
912376690 1:109214919-109214941 TTAATACAGGCAGAGATTTATGG - Intronic
916718655 1:167465831-167465853 TAACTGTAGCCAGAGAAATATGG - Intronic
917261242 1:173172409-173172431 TTAATGCAGCCATAAATCTGGGG + Intergenic
920316051 1:205076253-205076275 TTCCTGCAGCCTGAGATTTCAGG + Exonic
923200400 1:231705371-231705393 TGACTTCTGCCAGAGATCTTGGG + Intronic
1062761814 10:28244-28266 CAACTCCAGCCAGAGTTCTATGG + Intergenic
1062832391 10:614472-614494 TGGCTGCAGCCAGAGGCCTAAGG + Intronic
1063027395 10:2193873-2193895 TTACTGCAGCCTGACCTCTCAGG + Intergenic
1063119499 10:3094920-3094942 TTACTGCATCCAGAGATGTAGGG - Intronic
1063791177 10:9449799-9449821 TGCCTGCAGCCAAAGCTCTAGGG - Intergenic
1065045581 10:21745407-21745429 TTGATGCAGCCAGGGATCTGAGG - Intergenic
1065352943 10:24811794-24811816 TTTCTGGACCCAGAGAGCTAAGG - Intergenic
1069407013 10:68112290-68112312 ACACTGCAGCCAGAGCTCAAAGG - Intronic
1070041475 10:72784751-72784773 TTACTTCAGCCAGAGAGGCAGGG - Intronic
1071971750 10:90915116-90915138 TCAGTGCAGCCAGTGAACTAAGG - Intronic
1072567637 10:96630765-96630787 TCACTGCAGCCAGATCTCTTGGG - Intronic
1076912345 10:133397374-133397396 TTAGTGCAGCCAGACATTTGGGG + Intronic
1077640403 11:3876443-3876465 TTACTCCAGCTAGAGTGCTATGG + Intronic
1082894169 11:58172589-58172611 TTTCTGGAGCCAGGGATCTTGGG - Intronic
1086469124 11:87087425-87087447 TAGCTGCAGCCAGAGATCACTGG + Intronic
1092082844 12:5732350-5732372 GTCCTGCAGCCAGAGATCATGGG - Intronic
1095107315 12:38250038-38250060 CTCCTGCAGCCAGAAATCTGGGG - Intergenic
1101584043 12:106068673-106068695 TTTCTGCTGCCAGAGAATTAGGG + Intronic
1101660095 12:106758091-106758113 TTATTCCAGACAGAGATCTCTGG + Intronic
1103060936 12:117858067-117858089 TAAGTGAAGCCAGAGATCTCTGG + Intronic
1106370290 13:29126229-29126251 TTACTGCAGTCATAGAGGTAAGG - Intronic
1110006501 13:70277799-70277821 ATACTGCAGCCTGATATCTGAGG - Intergenic
1110275249 13:73635147-73635169 CAACTGCATCCAGAGTTCTATGG + Intergenic
1110643892 13:77858273-77858295 TTACTTCAGCGAAAGATGTATGG - Intergenic
1113463400 13:110497137-110497159 TAACCTCAGCCAGGGATCTAGGG + Intronic
1113922626 13:113922431-113922453 GCCCTGCACCCAGAGATCTAGGG + Intergenic
1115102233 14:29716329-29716351 GTATTGCTGACAGAGATCTATGG + Intronic
1122137588 14:99643882-99643904 TTACTGGAGCCAAGGAGCTATGG - Intergenic
1122282129 14:100629628-100629650 TTTCTGCAGCCAAAGGTGTAGGG + Intergenic
1124915087 15:33962403-33962425 TTACTCAAGCCAGAGTTCTCAGG + Intronic
1126207589 15:46062770-46062792 TTAGTACAGCCAAAAATCTAAGG - Intergenic
1126552979 15:49953392-49953414 TAACTCCAGCCAGAGACTTAGGG - Intronic
1126634261 15:50765951-50765973 TGCATGCAGCCAGAAATCTAAGG + Intergenic
1127124548 15:55799464-55799486 TAGCTGCTGCCAGAGATCTGAGG + Intergenic
1127243095 15:57140540-57140562 TTCCTGCATTCATAGATCTAAGG + Intronic
1131689934 15:94815745-94815767 CTACGGCAGTCAGAGAGCTAAGG - Intergenic
1134687237 16:16167392-16167414 TACCTGAAGCCAGAAATCTAGGG + Intronic
1136124555 16:28168406-28168428 TTACTGCAGCCTCAGATTTTGGG - Intronic
1138263831 16:55645154-55645176 TTAAGGGAGCCAGAGATCAAGGG + Intergenic
1138490270 16:57372469-57372491 TTGCCGCCGCCAGAGATCTGTGG - Exonic
1138732534 16:59210872-59210894 TTGCTGCAGCCAGAAGTCTATGG + Intergenic
1143996612 17:11011886-11011908 TTACTGAGGCCAGAAACCTAAGG - Intergenic
1145227990 17:21147186-21147208 TTGCTGTAGCCAGTGATCTCAGG + Intronic
1145353580 17:22113676-22113698 TAACTGCAGTCAGTTATCTATGG - Intergenic
1152954721 18:28574-28596 CAACTCCAGCCAGAGTTCTATGG + Intergenic
1153608706 18:6860110-6860132 TCACTGCAGCCAGAAATCAAAGG + Intronic
1153934091 18:9905227-9905249 TTACTTTAGCCAGGGCTCTAAGG - Intergenic
1157221440 18:45831029-45831051 CTACTGACGCCAGAGAGCTATGG + Intronic
1157882993 18:51340019-51340041 TTACTGTGGGCAGAGAACTATGG - Intergenic
1158112194 18:53952545-53952567 TTACTGAAGCCATAGATGGAAGG + Intergenic
1158672824 18:59492180-59492202 TTGGTGTAGCCAGAGGTCTATGG + Intronic
1163269467 19:16242421-16242443 TTTCTGCAGCCAGAGATGCTAGG - Intronic
1165306051 19:35003587-35003609 TTCCCGCAGCCACAGATCTAGGG - Intronic
926937529 2:18101350-18101372 TTTCTGCAGCCACAGTTCTGGGG + Intronic
931193596 2:60028766-60028788 CAACTGCAGCCTGAGATCTGAGG + Intergenic
931906746 2:66850735-66850757 TTGCTGCAGCCCGAGGTCTCAGG - Intergenic
932411090 2:71548324-71548346 TGACTGCAGTCACAGAGCTAGGG + Intronic
934150901 2:89146689-89146711 TTCCTGGAGCCAGAGAGCTAGGG - Intergenic
934216373 2:90035336-90035358 TTCCTGGAGCCAGAGAGCTAGGG + Intergenic
935593219 2:104859835-104859857 TTACAGCAGCAAGAGAAATAGGG - Exonic
936452688 2:112645646-112645668 TGATTACAGCCAGAGATCGAGGG - Intergenic
942097315 2:172546418-172546440 GAACTGCAGCCAGAGATCACTGG - Intergenic
946062610 2:216957111-216957133 TTACTACAGACAGAGATCAACGG - Intergenic
946650654 2:221890039-221890061 TTACTACACTCAGAGATCTTTGG + Intergenic
947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG + Intronic
948869189 2:240789799-240789821 CTACTCCAGACAGAGCTCTATGG + Intronic
1169187947 20:3634686-3634708 TGACTGAGGCCAGAGATCCAAGG + Intronic
1169252203 20:4069323-4069345 TCACTGCAGCCTCAGCTCTAGGG + Intergenic
1170572873 20:17642253-17642275 ATACTGCAGCCAGAGGCCTACGG - Intronic
1171174639 20:23042340-23042362 TTCCTTCAGGCAGAGATCCAAGG + Intergenic
1172197570 20:33102516-33102538 TTACTGCAGCCACAGAGCCAGGG - Intronic
1176774581 21:13120077-13120099 TTACTGCAGCCCGTGGCCTAGGG - Intergenic
1181735672 22:24879642-24879664 TCACTGAAACCAGACATCTAGGG - Intronic
1182219138 22:28743957-28743979 TTTCTTCAGCCAGAGGTCTCAGG + Exonic
949848770 3:8399653-8399675 TGACTGCAGGCACAGATCTGTGG + Intergenic
950372365 3:12541926-12541948 TTACTGCAGCCCAACATGTATGG - Exonic
955936384 3:64106830-64106852 GTGCTGCAGCCAGAGTTCTCTGG - Intronic
956386469 3:68725024-68725046 CAACTGCAGCCAGGGTTCTAGGG - Intergenic
961628222 3:128278367-128278389 TCACTGAAGCCAGAGATCTGGGG - Intronic
962448091 3:135486649-135486671 GTCCTGCAGCCAGACATTTATGG + Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
968359001 3:198133565-198133587 GAACTCCAGCCAGAGTTCTATGG - Intergenic
968407087 4:350258-350280 TCAGTGGAGCCAGAGATCGAGGG - Intronic
969857007 4:10008094-10008116 TTGCTGCAGCCAGAGAGCTGGGG - Intronic
970359198 4:15291135-15291157 TTAGATCAGCCAGAAATCTAGGG - Intergenic
971372646 4:26030563-26030585 CCCCTGCAGCCAGATATCTAGGG + Intergenic
974295665 4:59995364-59995386 GAACTGCAGCCAGAGATCACTGG + Intergenic
976756098 4:88499134-88499156 TATGTGCAGCCAGAGAACTATGG - Intronic
977141831 4:93383165-93383187 TTACTTCAGCCAGAGGGGTAGGG + Intronic
987342736 5:16953008-16953030 TTACTGCAGCCAGAACTCCTGGG - Intergenic
989352542 5:40502602-40502624 TTAATCCAGCCAGACACCTAAGG + Intergenic
990293123 5:54375102-54375124 TCACTTCAGCCAGAGATGGAGGG + Intergenic
990567950 5:57048866-57048888 AGACTGCAGCCAGAGAACAAAGG + Intergenic
993003234 5:82403797-82403819 TTACTACAGCCAGAAAGTTAAGG - Intergenic
995003028 5:107158201-107158223 TAACTGCAGCCAGAGGTTCAGGG + Intergenic
996310168 5:122095572-122095594 TTACTGGAGCCATAGTTCCAGGG + Intergenic
997848307 5:137308365-137308387 TTGCTGCAGCCAGAGGTCAAAGG - Intronic
1005066326 6:21821344-21821366 TTACTGCAGACTGACATATAGGG + Intergenic
1005958195 6:30679208-30679230 CTGCTGCAGCCAGAGCTCCAGGG - Exonic
1006879667 6:37327943-37327965 TTAGTGCTGGTAGAGATCTAGGG + Intronic
1007769069 6:44178958-44178980 CTACTGCAGCCTGAGCTCTCCGG + Intronic
1009650089 6:66464796-66464818 TCTCTTCAGTCAGAGATCTATGG - Intergenic
1009887618 6:69642422-69642444 TTACTTTAGCCAGACATGTAAGG - Intergenic
1015447596 6:133325751-133325773 TAACTGCAGCCATGGCTCTATGG - Intronic
1018540488 6:164874498-164874520 TTACTACAGTCAGAAATCCAAGG + Intergenic
1020105976 7:5422515-5422537 CTGCTGCAGACAGAGATCGAGGG - Intronic
1021219315 7:17957272-17957294 CTACTGCAGCCTTAGAACTAAGG - Intergenic
1024163821 7:46709389-46709411 TTTCTGTAGCCACACATCTATGG - Intronic
1024316031 7:48017613-48017635 CTACAGCAGCCAGATAACTAAGG + Intronic
1026247601 7:68635032-68635054 TTGCTGCCACCAGAGACCTAAGG + Intergenic
1028422024 7:90643785-90643807 TTACTGCTGCCACAGACCTGTGG - Intronic
1032905518 7:136360139-136360161 TAAATGAAGACAGAGATCTATGG - Intergenic
1038651656 8:29409380-29409402 TATCTGTAGCCACAGATCTAGGG + Intergenic
1039875211 8:41578680-41578702 TTACGGCAGCCAGAGAACACAGG - Intronic
1040891689 8:52323898-52323920 TAACTGCAGCCAGTTGTCTAAGG + Intronic
1042369253 8:67972202-67972224 TTACTGCAATCAGAAATCAAGGG - Intronic
1046939483 8:119917094-119917116 TGACTCCGGCAAGAGATCTACGG + Intronic
1048448680 8:134512298-134512320 TTTCTGGAGGCAGAGATCTCTGG + Intronic
1049653670 8:143788467-143788489 GTCCTGCAGGCAGAGATCTGTGG + Intergenic
1049882399 8:145075307-145075329 CAACTCCAGCCAGAGTTCTATGG - Intergenic
1051198465 9:14589398-14589420 TGACTGCAAACAGAAATCTAAGG - Intergenic
1053479006 9:38402255-38402277 TTACTGCAGCCAGAAACATGAGG - Intergenic
1055273096 9:74583689-74583711 TCACTACAGCCTGAGTTCTAAGG - Intronic
1056258986 9:84828961-84828983 TTAAAGAAGCCAGAAATCTATGG + Intronic
1061377663 9:130235731-130235753 TCACTGCAGCCAGAGGCCTGGGG - Exonic
1062743133 9:138192698-138192720 CAACTCCAGCCAGAGTTCTATGG - Intergenic
1062743382 9:138194699-138194721 CAACTCCAGCCAGAGTTCTATGG - Intergenic
1062743631 9:138196700-138196722 CAACTCCAGCCAGAGTTCTATGG - Intergenic
1185500220 X:591224-591246 TTTCTGCAGCCAGGGGTCTCGGG - Intergenic
1190099265 X:47508542-47508564 ATGGTGCAGACAGAGATCTAGGG - Intergenic
1190806654 X:53844288-53844310 TTTCTGGAGCCAGAAATATATGG + Intergenic
1192277461 X:69648373-69648395 CCACTGCAGCCAGGGTTCTACGG - Intronic
1195907306 X:109857260-109857282 TTTCAGCAGCCAGAGTTGTAAGG - Intergenic
1200731839 Y:6751316-6751338 TAACTGCAGCCAGAGAGAAAGGG - Intergenic
1201255237 Y:12101037-12101059 TTAAAGAAGCCAGACATCTAAGG - Intergenic
1202174611 Y:22085824-22085846 TCACTGAAACCAGAGATCTCAGG - Intronic
1202216751 Y:22500558-22500580 TCACTGAAACCAGAGATCTCAGG + Intronic
1202326436 Y:23695512-23695534 TCACTGAAACCAGAGATCTCAGG - Intergenic
1202544334 Y:25974542-25974564 TCACTGAAACCAGAGATCTCAGG + Intergenic