ID: 947837707

View in Genome Browser
Species Human (GRCh38)
Location 2:233187697-233187719
Sequence CAGCTCTTCTGGGGCTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 9, 3: 70, 4: 345}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947837707_947837720 26 Left 947837707 2:233187697-233187719 CCACTGAAGCCCCAGAAGAGCTG 0: 1
1: 0
2: 9
3: 70
4: 345
Right 947837720 2:233187746-233187768 TTCAGGCCCCTGAGTCGTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 106
947837707_947837718 24 Left 947837707 2:233187697-233187719 CCACTGAAGCCCCAGAAGAGCTG 0: 1
1: 0
2: 9
3: 70
4: 345
Right 947837718 2:233187744-233187766 TCTTCAGGCCCCTGAGTCGTGGG 0: 1
1: 0
2: 0
3: 41
4: 879
947837707_947837719 25 Left 947837707 2:233187697-233187719 CCACTGAAGCCCCAGAAGAGCTG 0: 1
1: 0
2: 9
3: 70
4: 345
Right 947837719 2:233187745-233187767 CTTCAGGCCCCTGAGTCGTGGGG 0: 1
1: 0
2: 3
3: 37
4: 859
947837707_947837717 23 Left 947837707 2:233187697-233187719 CCACTGAAGCCCCAGAAGAGCTG 0: 1
1: 0
2: 9
3: 70
4: 345
Right 947837717 2:233187743-233187765 GTCTTCAGGCCCCTGAGTCGTGG 0: 1
1: 0
2: 0
3: 12
4: 113
947837707_947837712 -3 Left 947837707 2:233187697-233187719 CCACTGAAGCCCCAGAAGAGCTG 0: 1
1: 0
2: 9
3: 70
4: 345
Right 947837712 2:233187717-233187739 CTGTCAGAAGTCCCTGTTCTGGG 0: 1
1: 0
2: 1
3: 24
4: 167
947837707_947837716 9 Left 947837707 2:233187697-233187719 CCACTGAAGCCCCAGAAGAGCTG 0: 1
1: 0
2: 9
3: 70
4: 345
Right 947837716 2:233187729-233187751 CCTGTTCTGGGGCTGTCTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 233
947837707_947837713 -2 Left 947837707 2:233187697-233187719 CCACTGAAGCCCCAGAAGAGCTG 0: 1
1: 0
2: 9
3: 70
4: 345
Right 947837713 2:233187718-233187740 TGTCAGAAGTCCCTGTTCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 208
947837707_947837711 -4 Left 947837707 2:233187697-233187719 CCACTGAAGCCCCAGAAGAGCTG 0: 1
1: 0
2: 9
3: 70
4: 345
Right 947837711 2:233187716-233187738 GCTGTCAGAAGTCCCTGTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947837707 Original CRISPR CAGCTCTTCTGGGGCTTCAG TGG (reversed) Intronic
900159224 1:1215652-1215674 CTGCTCTCCTGGGGCCTAAGTGG + Intergenic
900400945 1:2472649-2472671 CAGCCCTGTGGGGGCTTCAGAGG + Intronic
900568044 1:3344801-3344823 CAGCCCTTCTGGGACTTTAGTGG + Intronic
900764148 1:4492787-4492809 CAGCTCCCCTGGGGCTTCCCTGG + Intergenic
900881854 1:5388037-5388059 GAGCTCTTCCGGGGATCCAGGGG - Intergenic
900923721 1:5690257-5690279 AAACTCTTCTGAGGCTGCAGGGG + Intergenic
901550124 1:9989853-9989875 CACCCCTTCTGGGGCTTCAGGGG + Intergenic
901635013 1:10666470-10666492 CAGGCCTTCCGGGGCTGCAGAGG - Intronic
901775851 1:11560106-11560128 TAGCTCTTCTGGTGCCACAGAGG - Intergenic
904131991 1:28282025-28282047 CCCCTCTCCTGGGGCTTAAGTGG + Exonic
908896575 1:68907759-68907781 CAACTATTCTGGGCCATCAGTGG - Intergenic
912276045 1:108260122-108260144 CAGCTCATCTGCTGCTTCAAAGG + Intergenic
912292183 1:108434236-108434258 CAGCTCATCTGCTGCTTCAAAGG - Intronic
912554821 1:110508343-110508365 CAGCTCTTCTGGACATTCAATGG - Intergenic
912582129 1:110730210-110730232 TACACCTTCTGGGGCTTCAGGGG + Intergenic
913539082 1:119801732-119801754 CAGCTCTTGTTGGGTTTGAGGGG + Intronic
914706017 1:150170505-150170527 TAGCTCTTCCGGGGTTTCAATGG - Intergenic
914984985 1:152448692-152448714 CAGCCTTTCTGGGGCTACTGTGG + Intergenic
916275773 1:162991648-162991670 CAGCTCTGCTGGGCCTTTTGTGG - Intergenic
917654567 1:177113291-177113313 CAGCTGTTCTGGGGGTTGGGGGG - Intronic
918374464 1:183895292-183895314 ATGCTGTTCTTGGGCTTCAGAGG - Intronic
919314598 1:195955087-195955109 CATTTCCTCTGGGGCTTCAAAGG + Intergenic
921014994 1:211181526-211181548 CAGATCTGCTGTGGTTTCAGAGG - Intergenic
921664815 1:217855971-217855993 CAGCACTTTGGGGGGTTCAGGGG - Intronic
921674881 1:217966069-217966091 CACTTCCTCTGGGGCTTCAGGGG - Intergenic
922076914 1:222254035-222254057 CACTTCCTCTGGGGCTTCAGGGG + Intergenic
922424698 1:225481990-225482012 CAGGTGTTCTTGGGCATCAGAGG - Intergenic
922555613 1:226529977-226529999 CAGTACCTCTGAGGCTTCAGGGG - Intergenic
923701152 1:236301620-236301642 CACTCCTTCTGGGGCTTCAGGGG + Intergenic
923944228 1:238864707-238864729 CACTCCCTCTGGGGCTTCAGGGG - Intergenic
924223179 1:241899000-241899022 CAGCTCCTCTGGGCTATCAGGGG - Intergenic
924560072 1:245150948-245150970 CAGCCCTTCTGCAGCTTCAATGG - Intergenic
1063839447 10:10053243-10053265 CAGCACTGCTGTGGCTACAGTGG + Intergenic
1065237831 10:23672046-23672068 CAGGCCTTCTGGAGCTGCAGTGG + Intergenic
1065248605 10:23786160-23786182 AAGTTCTTATGGGACTTCAGAGG + Intronic
1067564519 10:47326988-47327010 CAGCTCTTCCGAGGCTGGAGAGG - Intergenic
1067833566 10:49624082-49624104 CAGGTCCTGTGGGGCTCCAGTGG - Intronic
1069125652 10:64629157-64629179 CACTTCTTCTGGGGCTTCAGGGG + Intergenic
1070766300 10:79058360-79058382 CAGCTCTCCTGGGCCTGCACTGG + Intergenic
1071029985 10:81166140-81166162 CAGCTACTCTGGGGCTGTAGTGG - Intergenic
1073514373 10:104063886-104063908 CATTTCTTCTGGTGCTTCTGTGG - Intronic
1074061694 10:109972213-109972235 CAGCCCTGCTGGGACCTCAGGGG + Intergenic
1074645696 10:115449573-115449595 CATGCCCTCTGGGGCTTCAGGGG + Intronic
1075083997 10:119401949-119401971 CAGCTCTTCTGGGTCCTCCCTGG + Intronic
1075273870 10:121076372-121076394 CTGATCTTATGGGGCCTCAGAGG + Intergenic
1075351869 10:121731452-121731474 CAGCACTACTGGGGATTCAGAGG - Intergenic
1075618589 10:123909269-123909291 CAGGTCTTCAGGGCCTGCAGGGG + Intronic
1075968331 10:126631963-126631985 CAGCTCTACTGGGGCATCTGCGG - Intronic
1076988564 11:257146-257168 CTGCCCTTTTTGGGCTTCAGTGG + Intergenic
1077233248 11:1468112-1468134 CAGCTCCACTGGGGCTGAAGGGG - Intergenic
1078915707 11:15776649-15776671 CAGCTATGCTGCAGCTTCAGTGG + Intergenic
1080931757 11:36818566-36818588 CAGCAGTCCTGGTGCTTCAGGGG + Intergenic
1081001798 11:37682640-37682662 CACTTACTCTGGGGCTTCAGGGG - Intergenic
1083304609 11:61755907-61755929 CAGCCCTGGTGGGGCTCCAGAGG - Intronic
1083722820 11:64611816-64611838 CAGCTCCTCTGGGGCTTCCCTGG + Intronic
1083750227 11:64756911-64756933 CAGCTACTCTGAGGCTTCAGTGG - Intronic
1085126882 11:74007953-74007975 TAGCTCTGCTGGGGCTCCTGAGG + Intronic
1085270666 11:75267919-75267941 CTGTTCTTCTGGGGCTGCAGTGG - Intronic
1086925141 11:92631935-92631957 CAGCTTTTCTGGCCCTTCACTGG + Intronic
1089652074 11:119920940-119920962 CGGCCCTGCTTGGGCTTCAGGGG + Intergenic
1089656216 11:119948720-119948742 CAGCCCTAATGGGGCTTGAGAGG - Intergenic
1089723487 11:120451663-120451685 CATGTCTTCTGTAGCTTCAGGGG + Exonic
1090358729 11:126158182-126158204 CAGCTGTTCTGTGGCCTCTGTGG - Intergenic
1091133374 11:133165472-133165494 CAGCTCCTCTGGGTTTGCAGAGG + Intronic
1091540506 12:1456821-1456843 CAGTTCTTCTGGTGATTCTGAGG - Intronic
1091754083 12:3040558-3040580 CAGCTCTCTTGGCACTTCAGGGG - Exonic
1092102098 12:5892314-5892336 CTGACCTTCTGGAGCTTCAGTGG - Intronic
1093852814 12:24061347-24061369 TAGCTTCTCTGGGCCTTCAGAGG + Intergenic
1095122635 12:38437376-38437398 CAGCTTGGCTGTGGCTTCAGGGG - Intergenic
1097271967 12:57781146-57781168 AAGATCATCTGGGCCTTCAGAGG - Exonic
1098702324 12:73645185-73645207 CATCTGTTCTGGGACTTCTGGGG + Intergenic
1099195477 12:79609901-79609923 CACTTCTTCTGGGACTTCAGGGG + Intronic
1100338515 12:93655788-93655810 CAGCTCTTCTGACACTTCTGAGG + Intergenic
1101216654 12:102592712-102592734 CACTCTTTCTGGGGCTTCAGGGG - Intergenic
1101432864 12:104641356-104641378 CACTTCTTCCGGGGCTTCAGGGG + Intronic
1102647550 12:114413766-114413788 GCTCTCTTCTGGGGCCTCAGTGG - Intergenic
1102811808 12:115830893-115830915 CTGCACTTCTGGGGCTGCACAGG - Intergenic
1104026748 12:125033024-125033046 CAGCTGCTCTGGGGCTGCAGCGG - Intergenic
1104554836 12:129790212-129790234 CACTCCTACTGGGGCTTCAGGGG - Intronic
1104704420 12:130932701-130932723 CAGCTCCTCTGGAGTTTCTGTGG + Intergenic
1105639766 13:22250196-22250218 CACTTTTTCTGGGGCTTCAAGGG + Intergenic
1106942332 13:34792531-34792553 TACATCTTCTGGGGCTCCAGGGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107875037 13:44782917-44782939 CATTCTTTCTGGGGCTTCAGGGG - Intergenic
1108316598 13:49242964-49242986 CACTCCCTCTGGGGCTTCAGGGG + Intergenic
1108473981 13:50795244-50795266 CAGATCCTCTTGGGCTCCAGTGG + Intronic
1108727533 13:53199673-53199695 CAGCTCTTCAGGCCCTTCTGTGG + Intergenic
1108958519 13:56190054-56190076 CACTTCCTCTGGGTCTTCAGGGG + Intergenic
1109693733 13:65927002-65927024 CATATCCTCTGGGGCTTCAGAGG - Intergenic
1109793455 13:67279330-67279352 TACTCCTTCTGGGGCTTCAGGGG + Intergenic
1110175750 13:72553727-72553749 CATGTCCTCTGGGGCTTCAGGGG - Intergenic
1111482056 13:88842514-88842536 CAGATTTTCTAGGGGTTCAGGGG + Intergenic
1114029790 14:18567787-18567809 CAGGTCTTCTTGAGCTGCAGTGG - Intergenic
1116396406 14:44452479-44452501 CACTCCTTCTGGGGCTTCAGGGG - Intergenic
1117365877 14:55027047-55027069 CAGCTCTTGTGGATCCTCAGTGG - Exonic
1118600100 14:67465978-67466000 CATCTCCTCTGAGGCTTTAGGGG - Intronic
1118846996 14:69554986-69555008 CAGCTCTCCTGAGGGCTCAGTGG + Intergenic
1119044626 14:71307787-71307809 CAGCTCTCTTGGGCCATCAGGGG + Intergenic
1119128741 14:72152727-72152749 AAGCTCCTCTGGCACTTCAGGGG + Intronic
1121525640 14:94617155-94617177 CAGCCATTCAGGGGCTTCTGTGG - Intronic
1121729089 14:96173902-96173924 CAGCTCCCCTGGGCCTGCAGCGG - Intergenic
1122037570 14:98960053-98960075 CAGTTCTTCTGGGGGCTCAGTGG + Intergenic
1122791826 14:104187296-104187318 CCTCACTTCTGCGGCTTCAGAGG - Intergenic
1123023356 14:105412309-105412331 GTGCCCTTCTGGGTCTTCAGAGG - Exonic
1123765116 15:23470614-23470636 CACTTCTTCTGGGGCTTCAGGGG - Intergenic
1125273365 15:37964932-37964954 TGGCTATTCTGGGTCTTCAGTGG - Intronic
1125967159 15:43883724-43883746 CAGCTCTTCTGCGGGTCCTGGGG + Exonic
1126212142 15:46111752-46111774 CACTCCCTCTGGGGCTTCAGGGG + Intergenic
1126370919 15:47946276-47946298 CTGGTCTTCTGGGGTTTCACTGG - Intergenic
1126495209 15:49282549-49282571 CAACATTTTTGGGGCTTCAGTGG + Intronic
1127715280 15:61643618-61643640 CTGCACTTCTGGAACTTCAGGGG + Intergenic
1128082339 15:64864139-64864161 CAGCCCTGCTGGGGCCTCTGAGG + Intronic
1128448014 15:67782055-67782077 CTGCTCCACTGGGGATTCAGAGG - Intronic
1129147586 15:73662912-73662934 CTCTCCTTCTGGGGCTTCAGAGG - Intergenic
1129339159 15:74873498-74873520 TCGCTCTGCTGGGGATTCAGGGG + Intergenic
1129674084 15:77622953-77622975 CAGCTCTGCTGGCACTTCTGCGG + Intronic
1130420839 15:83745461-83745483 CAGTCCTTCTGGGGCTTCAGGGG + Intronic
1131068267 15:89448132-89448154 CACCTCTTATGGGGCTATAGAGG - Intergenic
1131079905 15:89526124-89526146 AAACTCTTCAGGGGGTTCAGAGG + Intergenic
1131428094 15:92363654-92363676 CAACTCTACAGGGGCTTTAGTGG + Intergenic
1131985821 15:98042122-98042144 CATCCCTCCTGGGGGTTCAGGGG + Intergenic
1132374348 15:101318930-101318952 CAGGCCTGCTGGGGCTCCAGAGG - Intronic
1132930654 16:2457441-2457463 CTGCTGGTTTGGGGCTTCAGTGG + Exonic
1135540984 16:23330328-23330350 CAGCTGTTCTGAGGCTATAGCGG + Intronic
1135663679 16:24317847-24317869 AAGCACTTCTGAAGCTTCAGGGG - Intronic
1138120421 16:54396793-54396815 CAACTCAACTGGCGCTTCAGTGG + Intergenic
1138300952 16:55929366-55929388 CCCCTCTTCTGGGGATTCTGAGG - Intronic
1138567059 16:57841320-57841342 CAGCTCTTCTGGGTGTTTTGTGG - Intronic
1140227907 16:73093443-73093465 CAGCTCTTTTGGGGGTTCCAGGG + Intergenic
1141239833 16:82255359-82255381 GAGCTCTTGTGAGTCTTCAGAGG + Intergenic
1141290310 16:82712685-82712707 CATCTCAGCTGCGGCTTCAGGGG - Intronic
1141501600 16:84448620-84448642 GACCTCTGCTGGGGCGTCAGCGG - Exonic
1141775427 16:86119745-86119767 AAGGGCTTCAGGGGCTTCAGGGG + Intergenic
1141906407 16:87029534-87029556 CAGGTGTACTGGGGGTTCAGTGG - Intergenic
1142047059 16:87932285-87932307 CACCTCCTCTGTGGCATCAGTGG - Intronic
1145982541 17:29021790-29021812 CAGGTCTTCAGCAGCTTCAGGGG + Intronic
1146650171 17:34601708-34601730 CAGCCCCTCTGGGGCTTCAGAGG + Intronic
1146885684 17:36469307-36469329 CACGCCCTCTGGGGCTTCAGGGG - Intergenic
1146886715 17:36475699-36475721 CACGCCCTCTGGGGCTTCAGGGG - Intergenic
1147245815 17:39119909-39119931 CAGCTTTTCTGGGGTCTCATTGG - Intronic
1148056276 17:44798170-44798192 AAGCTCTTCTGGGACTACTGTGG - Intergenic
1148586291 17:48783293-48783315 CAGCCCTTGGTGGGCTTCAGTGG + Intronic
1148772061 17:50073002-50073024 CACCTATTTTGGGTCTTCAGAGG - Intronic
1149026704 17:52035627-52035649 CACATCATCTGGGGCTTCAGGGG + Intronic
1149421801 17:56518860-56518882 CAGGTTTTCTGGGTATTCAGTGG - Intergenic
1149657018 17:58315500-58315522 CAGCTCCTGTGGGGAGTCAGAGG - Intronic
1150649696 17:67001718-67001740 CTGCTCTTCCAGGACTTCAGGGG + Intronic
1151625399 17:75272503-75272525 CGGCCCTTCTGGGGCTACAGGGG + Intergenic
1151877584 17:76875994-76876016 CAGCTCTCCTGGGTTCTCAGCGG - Intronic
1152359792 17:79826554-79826576 CAGCTCCTCTGGAGGCTCAGAGG + Intergenic
1153843710 18:9030095-9030117 TACTCCTTCTGGGGCTTCAGGGG - Intergenic
1154997774 18:21657450-21657472 CAGCTACTCTGGGGCTGAAGTGG - Intronic
1155240783 18:23861822-23861844 CTGTTCTTCTGGGCCCTCAGTGG + Intronic
1156536261 18:37867427-37867449 CATCTCTGCTGGGGCTTAAAGGG + Intergenic
1160033777 18:75283212-75283234 CAGCTCCTCTGTGGATTCAGAGG - Intronic
1160181148 18:76637922-76637944 AAGCTCTGCTGCGTCTTCAGAGG + Intergenic
1160602666 18:80025828-80025850 TGGCTCTACTGGGCCTTCAGGGG - Intronic
1162101543 19:8342353-8342375 CACCACCTCTGCGGCTTCAGGGG + Intronic
1162799878 19:13104515-13104537 CAGCTCTCCAGGGGCCACAGTGG - Intergenic
1164512776 19:28911307-28911329 CAGCCGTTCTGGGCCCTCAGTGG + Intergenic
1165300890 19:34968073-34968095 CACTTCGTCAGGGGCTTCAGGGG + Intergenic
1165538274 19:36468663-36468685 CAGCCCTTCTGGAGCCTGAGTGG + Intronic
1166387292 19:42389365-42389387 CAGCATTTCTGGGGCCTCTGGGG + Intronic
1166977692 19:46614317-46614339 CAGCTCTTCAGGGTCTTCCGTGG - Intergenic
925887065 2:8402169-8402191 CAGCTGTGCTGCAGCTTCAGAGG - Intergenic
926543050 2:14204857-14204879 CACTCTTTCTGGGGCTTCAGGGG + Intergenic
926562669 2:14434857-14434879 CATGCCCTCTGGGGCTTCAGGGG - Intergenic
928723728 2:34148059-34148081 AGGCACTTCTGGGCCTTCAGAGG + Intergenic
931458700 2:62432408-62432430 CACTCCTTCTGGGGCTTTAGGGG + Intergenic
932073887 2:68645410-68645432 CAACACTTCTGAGTCTTCAGTGG + Intronic
932556577 2:72829999-72830021 CACTTCCTCTGGGGCTTCAGGGG + Intergenic
932816596 2:74866715-74866737 CAGCTTTTCTGTTGCTTCAGTGG + Intronic
933165499 2:79070452-79070474 CACTCCCTCTGGGGCTTCAGGGG + Intergenic
935269352 2:101420168-101420190 GAGTTCTTCTGGGGCATCCGAGG + Intronic
935532994 2:104258325-104258347 AAGCTCTTCTGGGCCTTTTGTGG - Intergenic
937891165 2:126940054-126940076 ACACTCCTCTGGGGCTTCAGGGG - Intergenic
938150659 2:128879689-128879711 CACTCCTTCTGGGGCTTCAGGGG - Intergenic
938787742 2:134647924-134647946 CACACTTTCTGGGGCTTCAGGGG - Intronic
938942434 2:136180902-136180924 CACTCCTTCTGGGGCTTCAGGGG - Intergenic
939740695 2:145902247-145902269 CAGCTCAGCTGTGGTTTCAGAGG + Intergenic
940480990 2:154230739-154230761 TAATTCTTCTGGGGTTTCAGTGG - Intronic
943382556 2:187170250-187170272 TAACACTTCTGGGGCTTCAGGGG - Intergenic
943969621 2:194386601-194386623 TATGCCTTCTGGGGCTTCAGGGG + Intergenic
944067367 2:195633409-195633431 CCACTCTTCTGGGGCTTCAGGGG - Intronic
944454386 2:199878276-199878298 TAACACTCCTGGGGCTTCAGGGG - Intergenic
945047945 2:205798473-205798495 CAGGCCCTCTGGGGCTCCAGGGG - Intergenic
945415241 2:209562729-209562751 CAGTTTTTCTGGTGCTTCACTGG - Intronic
945708495 2:213266228-213266250 CAGGTTTTCTGGGACTTCAGCGG - Intergenic
946215918 2:218183563-218183585 CACTTCCTCTGGGGCTTCAGGGG - Intergenic
946563692 2:220940641-220940663 CACTCCCTCTGGGGCTTCAGGGG + Intergenic
947773512 2:232689632-232689654 CAGCCCTGCTGGTGCTTCTGGGG - Intergenic
947837707 2:233187697-233187719 CAGCTCTTCTGGGGCTTCAGTGG - Intronic
948227014 2:236319066-236319088 CAGCTTTTTTGGGGCCCCAGGGG + Intergenic
948515637 2:238501729-238501751 CAGCTCTGTGGGGGCTTTAGAGG + Intergenic
1168833464 20:860409-860431 CAGCACTGCTGGGGGTTAAGGGG + Intergenic
1170283660 20:14680393-14680415 TAGCCCTTCTGGAGTTTCAGCGG - Intronic
1171364381 20:24613720-24613742 CAGCTCTTCTCCTGCTACAGTGG + Intronic
1174340402 20:49891619-49891641 CTGCTCTGCGGGGGCTTCACTGG + Exonic
1175462268 20:59160419-59160441 GAGCACCTCTGGGGCCTCAGAGG - Intergenic
1175854326 20:62112282-62112304 CACCTATTATGGGGCTGCAGAGG - Intergenic
1175918426 20:62438424-62438446 CAGCACTTCTGGGGCAGCAGTGG + Intergenic
1177125325 21:17186324-17186346 CAGTCATTCTGGGGCTTCAGGGG + Intergenic
1177326985 21:19603139-19603161 CAGCTGTCCTGGTTCTTCAGTGG + Intergenic
1177801626 21:25833973-25833995 CATGTCCTCTTGGGCTTCAGGGG + Intergenic
1178367940 21:32003038-32003060 CAGCTCATCTGGGGACTCTGGGG - Exonic
1179149395 21:38797007-38797029 ATCCTCTACTGGGGCTTCAGAGG - Intergenic
1179305148 21:40146789-40146811 CAGCACATCTGTGGATTCAGAGG - Intronic
1180003129 21:45004127-45004149 CAGCCCTTCTGTGGCTTTGGAGG - Intergenic
1180170838 21:46057326-46057348 CAGCACTTCTGTGGCTTCGGCGG + Intergenic
1180453906 22:15494837-15494859 CAGGTCTTCTTGAGCTGCAGTGG - Intergenic
1180612716 22:17108339-17108361 CAGACCTTCCTGGGCTTCAGCGG - Exonic
1180761032 22:18207732-18207754 AAGGTCTTCAGGGTCTTCAGTGG - Intergenic
1180774635 22:18416887-18416909 AAGGTCTTCAGGGTCTTCAGTGG + Intergenic
1180807790 22:18727708-18727730 AAGGTCTTCAGGGTCTTCAGTGG + Intergenic
1181070747 22:20335896-20335918 AAGGTCTTCAGGGTCTTCAGTGG + Intergenic
1181193732 22:21163841-21163863 AAGGTCTTCAGGGTCTTCAGTGG + Intergenic
1181306063 22:21917983-21918005 GTGCTATCCTGGGGCTTCAGGGG + Intergenic
1183566637 22:38620131-38620153 CGGTTCTTCTGGAGCATCAGTGG - Intronic
949956621 3:9274516-9274538 CGCTCCTTCTGGGGCTTCAGGGG - Intronic
950161940 3:10766809-10766831 CAGCTTTACTGTGGCTGCAGAGG - Intergenic
950570215 3:13795205-13795227 CAGCTCCTCTGAGGCTCCAAGGG - Intergenic
950677791 3:14565076-14565098 CAGCATTTCTGGGGGTTGAGAGG + Intergenic
950883150 3:16339364-16339386 CAGCTCTGATAGGGCTTCTGAGG + Intronic
950980819 3:17302688-17302710 CATGTCTTCTAGGGATTCAGTGG - Intronic
951028511 3:17855268-17855290 TGGCTATTCTGGGTCTTCAGTGG + Intronic
951585881 3:24214191-24214213 TAGCTCTTCTGTGGCATTAGGGG + Intronic
952080451 3:29751924-29751946 CACATCCTCTGGGGCTCCAGGGG - Intronic
952161116 3:30694358-30694380 GAGGTCTTCTGGGCATTCAGAGG - Intergenic
952847362 3:37699686-37699708 CAGATCTTCTAGGGCCTTAGAGG - Intronic
953135623 3:40179269-40179291 CAGCTCTGCTGGGCCTTTTGTGG + Intronic
953353026 3:42230277-42230299 CGTCCCTTCTGGAGCTTCAGTGG + Intergenic
953450248 3:42999474-42999496 CTTGTCTACTGGGGCTTCAGTGG + Intronic
954563485 3:51578752-51578774 CACTTCCTCTAGGGCTTCAGGGG - Intronic
955250675 3:57279189-57279211 TATCTCTTCGGTGGCTTCAGAGG + Intronic
957388857 3:79535178-79535200 CAAATCTTCTGGGGATACAGCGG + Intronic
957717100 3:83942352-83942374 CACTCCTTCTGGGGCTTCAAGGG - Intergenic
958632937 3:96704163-96704185 CACCCCCACTGGGGCTTCAGGGG + Intergenic
959589570 3:108063006-108063028 CAGCTCTTCTAAGCCTTAAGAGG - Intronic
960149090 3:114232588-114232610 CACCTCTTCTTGGACTTCAGGGG - Intergenic
960934646 3:122890663-122890685 CAGCTCTTCCCAGGCTGCAGTGG - Intergenic
961257775 3:125571635-125571657 GAGCTCGTCTGTGGCCTCAGAGG + Intronic
961680346 3:128595841-128595863 TTGCACTTCTGGGGCCTCAGTGG + Intergenic
962252541 3:133845088-133845110 CAGCCTTTCTGGTGTTTCAGTGG - Intronic
962273164 3:133993031-133993053 CATTCCTTCTGGGGCTTCAGGGG + Intronic
962463948 3:135639527-135639549 CAGTTCTTCTGGAGCTTCCCTGG + Intergenic
962987372 3:140547892-140547914 CATAGCTTCTGGGGCTTCATGGG - Intronic
963858473 3:150280931-150280953 CACTCCTTCTGGGGCTTCAGGGG + Intergenic
964646997 3:158969115-158969137 CATCACTTCTCAGGCTTCAGGGG + Intronic
964669508 3:159209586-159209608 CACGTCCTCTGGGGCTCCAGAGG + Intronic
966033341 3:175378100-175378122 CACTCCCTCTGGGGCTTCAGGGG + Intronic
966113725 3:176434876-176434898 AGGCTCTTGTGGGCCTTCAGTGG + Intergenic
966272699 3:178127412-178127434 CACTCCTTCTGGGGCTTCAGAGG + Intergenic
968518228 4:1023678-1023700 CAGCTCCTCTGGGGGTCAAGAGG + Exonic
968689918 4:1985089-1985111 CAACTCTGCTGGGGCGCCAGGGG - Intronic
968698591 4:2044225-2044247 CAGCTGCTCTGGGGGCTCAGGGG - Intergenic
968736002 4:2296898-2296920 GAGCTCTTCTGGGGGCTCAGAGG - Intronic
969443087 4:7228740-7228762 CAGCTGCTCTGGGGCTGCTGTGG + Intronic
969524284 4:7696232-7696254 AAGCTGTTCTGGGGCCCCAGAGG - Intronic
971005511 4:22370229-22370251 CACTTCCTCTGGGGTTTCAGGGG + Intronic
971670263 4:29546801-29546823 CAGCTCTATTGTTGCTTCAGAGG - Intergenic
971733241 4:30413201-30413223 CAGCACAACTGAGGCTTCAGTGG + Intergenic
972066574 4:34953355-34953377 CACTCCCTCTGGGGCTTCAGGGG + Intergenic
975387177 4:73770905-73770927 CATGTCCTCTGGGACTTCAGGGG + Intergenic
976031318 4:80758027-80758049 ACCTTCTTCTGGGGCTTCAGGGG - Intronic
976041999 4:80898051-80898073 CACTTCCTCTGGAGCTTCAGGGG - Intronic
976473452 4:85455703-85455725 CATGCCCTCTGGGGCTTCAGGGG + Intergenic
977019388 4:91740944-91740966 CACCACCTCTGGGGCTTCAGGGG + Intergenic
977644555 4:99398243-99398265 TGGCTATTCTGGGGCTTCTGTGG - Intergenic
977781533 4:100986579-100986601 CACCCCATCTGAGGCTTCAGGGG + Intergenic
978593921 4:110356327-110356349 CACTCCTTCTGGGGCTTCAGGGG + Intergenic
979184395 4:117770709-117770731 CACTCCCTCTGGGGCTTCAGGGG + Intergenic
979596662 4:122542060-122542082 CACTTCTTCTGGGGCTTCAGGGG + Intergenic
981297341 4:143147165-143147187 CACTTCTTCTGGGGCTTCAGGGG + Intergenic
981422807 4:144570765-144570787 CAGGTCTTGTGGAGCCTCAGGGG + Intergenic
982861954 4:160463578-160463600 CACTTCTTCTGGGGCCTCAGGGG - Intergenic
983987139 4:174073310-174073332 CACTCCTTCTGGGGCTTCAGGGG - Intergenic
984229278 4:177074969-177074991 CATGCCTTCTGGGACTTCAGGGG - Intergenic
984292038 4:177807989-177808011 CTCTCCTTCTGGGGCTTCAGGGG - Intronic
985048858 4:185970087-185970109 CACTCCCTCTGGGGCTTCAGGGG - Intergenic
985752895 5:1692492-1692514 CACTTCCTCTGGGGCTTCAGGGG - Intergenic
986163152 5:5249660-5249682 CAGGCCCTCTGGGGCTCCAGGGG - Intronic
986202781 5:5593056-5593078 TAGCTATTCTGGGTCTTTAGTGG + Intergenic
986401193 5:7383397-7383419 TACCTCTTCTGGGGTTACAGTGG - Intergenic
986406678 5:7432402-7432424 CACTCCTTCTGGGGCTTCAGGGG + Intronic
986457672 5:7936362-7936384 CAGCTCTTCTGGCACTACGGTGG - Intergenic
986539494 5:8828866-8828888 CAGCTCTTATGGGGTGACAGGGG - Intergenic
987390191 5:17368237-17368259 CAGCTCTCCTGAAGCTTCAGGGG + Intergenic
988231335 5:28483619-28483641 CACACCCTCTGGGGCTTCAGGGG - Intergenic
988350947 5:30106617-30106639 CAGTTCCTCTGGGGCTTCGGGGG + Intergenic
989144459 5:38235031-38235053 CAGCTCAGCTGTTGCTTCAGAGG + Intergenic
991764279 5:69958072-69958094 CAGCTCATCTGTTGATTCAGAGG + Intergenic
991783048 5:70160075-70160097 CAGCTCATCTGTTGATTCAGAGG - Intergenic
991843511 5:70833144-70833166 CAGCTCATCTGTTGATTCAGAGG + Intergenic
991875490 5:71160402-71160424 CAGCTCATCTGTTGATTCAGAGG - Intergenic
992057480 5:73005336-73005358 CAGCTTTCCTTGGACTTCAGTGG + Intronic
992118554 5:73565980-73566002 ATGCTCTTCTGGGGCTTCCCAGG + Intronic
992759021 5:79935167-79935189 CAGCCATTCCGGGGATTCAGTGG + Intergenic
993598337 5:89888088-89888110 CAGTTATTATGGGGCTTCATAGG + Intergenic
994590781 5:101769229-101769251 CAGCTCAGCTGTGGCCTCAGAGG - Intergenic
995456358 5:112356819-112356841 CAGCATTTCTGGGGATGCAGTGG + Intronic
996052154 5:118947215-118947237 CATGCCCTCTGGGGCTTCAGGGG - Intronic
996101477 5:119449786-119449808 CACACCCTCTGGGGCTTCAGGGG - Intergenic
996502298 5:124230500-124230522 CACTCTTTCTGGGGCTTCAGGGG + Intergenic
996650732 5:125873155-125873177 CACTTCCTCTGGGGCTCCAGGGG - Intergenic
998643940 5:144041906-144041928 CACTACCTCTGGGGCTTCAGGGG - Intergenic
1000030504 5:157397313-157397335 GAGCTCGGCTGTGGCTTCAGAGG - Intronic
1000866242 5:166518412-166518434 CACTCCCTCTGGGGCTTCAGGGG - Intergenic
1001237492 5:170042504-170042526 CAGCTCATGTGGGGCCTCATGGG - Intronic
1002048239 5:176553992-176554014 CAGCACTGCTGGGGGTTCTGAGG + Intronic
1004977478 6:20984427-20984449 CATTCCTTCTGGGGCTTCAGGGG - Intronic
1005363342 6:25053447-25053469 CACTCCTTCTGGGCCTTCAGAGG - Intergenic
1005932801 6:30496448-30496470 CAGCTCTTGTGTGGCCTCATGGG - Intergenic
1006809961 6:36813602-36813624 CAGATCCTGTAGGGCTTCAGAGG - Intronic
1007791153 6:44309278-44309300 CAGCTCCTCTGGGGCTTGGCTGG - Intronic
1009524578 6:64728206-64728228 CACATCCTCTGGGGCTTCAGGGG - Intronic
1009627024 6:66147032-66147054 CACTCCCTCTGGGGCTTCAGGGG - Intergenic
1010475258 6:76278868-76278890 CAACTATTCTGGGTCTTCAGGGG + Intergenic
1010736646 6:79450957-79450979 CACACCCTCTGGGGCTTCAGGGG + Intergenic
1011779506 6:90771058-90771080 CAGCCCCTCTGTAGCTTCAGGGG - Intergenic
1012829355 6:104186375-104186397 CATGCCCTCTGGGGCTTCAGGGG + Intergenic
1012942551 6:105430725-105430747 TAGCTCCTCTGAGGCCTCAGTGG - Intergenic
1014345004 6:120258243-120258265 CAGCTCTTCTGTGACTTCAAAGG - Intergenic
1014625486 6:123719671-123719693 CACTTCTTCTGTGGCTTCAGAGG + Intergenic
1016730533 6:147423068-147423090 CCCCCCTTCTGGGGCTTCAAGGG + Intergenic
1018628593 6:165803934-165803956 CAGCTCATCTGGGCCTTCTCAGG + Intronic
1021073624 7:16273773-16273795 CACGTCCTCTGGGGCTTCAGGGG + Intronic
1022390450 7:29939324-29939346 CAGCTCTTCAGGGGCTGAGGTGG - Intronic
1022575477 7:31493074-31493096 CAGCTCTTTCTGGGCTCCAGTGG - Intergenic
1022591849 7:31671230-31671252 CACTCCTTCTGGGACTTCAGGGG + Intergenic
1022791370 7:33692500-33692522 CAGCTCTTCTTGGCCTAAAGTGG - Intergenic
1022841303 7:34166512-34166534 CAGCTGTACTTGGGCATCAGGGG + Intergenic
1023506427 7:40903841-40903863 CAGCCCTACTGGGGATACAGAGG - Intergenic
1023873646 7:44275783-44275805 CAGGCCTTCTGGGGGCTCAGTGG - Intronic
1024881571 7:54091479-54091501 CAGCTCTGCGGTGGCATCAGAGG + Intergenic
1026169985 7:67945447-67945469 CAGCTCTTCCAGGGTTGCAGAGG + Intergenic
1026350169 7:69508668-69508690 CAGCTCTCCTAGGGCTTCATAGG + Intergenic
1028192694 7:87870993-87871015 CATTTCCTCTGGGGCTTCAGGGG + Intronic
1028963612 7:96777016-96777038 CAGCTCTCCTAGTGCCTCAGTGG + Intergenic
1029254921 7:99263136-99263158 CAACTCAGATGGGGCTTCAGGGG + Intergenic
1030385845 7:108867204-108867226 CAGCTCTTCTGGAGTTACATAGG + Intergenic
1030386119 7:108870356-108870378 CACTTCTTCTGGGGTATCAGTGG - Intergenic
1030546851 7:110907085-110907107 CACTCCTTCTGGGGCTTCAGGGG - Intronic
1030864899 7:114688944-114688966 CAGGTCTTCTCTTGCTTCAGGGG + Intronic
1031696207 7:124857902-124857924 CACTTCCTCTGGGGCTTCAGGGG + Intronic
1031782432 7:125985454-125985476 CAAGCCCTCTGGGGCTTCAGGGG + Intergenic
1031949247 7:127874759-127874781 CAGGCCTTCTGGGGATTCAGAGG - Intronic
1032248336 7:130231842-130231864 CACACCTTCTGGGTCTTCAGGGG - Intergenic
1032434888 7:131892209-131892231 AAGAACTTCTGGGACTTCAGAGG - Intergenic
1032463017 7:132125838-132125860 CAGCTCTTCAAGGCCTTCAAGGG - Exonic
1033875860 7:145817849-145817871 CACTTTTTCTGGGGCTTCGGTGG + Intergenic
1034092956 7:148381157-148381179 CATGCCCTCTGGGGCTTCAGGGG - Intronic
1035183983 7:157111577-157111599 CACTTCCTCTGGGGCTTCAGGGG - Intergenic
1036791985 8:11727025-11727047 CAGCTCTCCTGGTGCCTCAAGGG - Intronic
1037427353 8:18770682-18770704 CACTTCCTCTGGGACTTCAGGGG - Intronic
1038646838 8:29369087-29369109 CAGATCACCTGGGGCTTCATTGG + Intergenic
1039039734 8:33395730-33395752 CATGCCCTCTGGGGCTTCAGAGG + Intronic
1039569407 8:38575192-38575214 CAGATCTCCAGTGGCTTCAGTGG - Intergenic
1039661403 8:39471091-39471113 CATGTCCTCTGGAGCTTCAGGGG + Intergenic
1040941726 8:52841117-52841139 CAGCTGTGCTGGGGCTTCAGAGG + Intergenic
1041600751 8:59714720-59714742 CAACTCTTCTGGGGCCTCCCTGG - Intergenic
1042794468 8:72645609-72645631 GTGTTCTTCTGGAGCTTCAGAGG + Intronic
1042819691 8:72916510-72916532 CACTCCTTCTGGGGCTTCAGGGG - Intronic
1042844742 8:73158656-73158678 CTGCCCTTCTGAGGCTCCAGAGG - Intergenic
1043011520 8:74887338-74887360 CGGCTCCTCGGGGGTTTCAGTGG + Intergenic
1043220488 8:77656042-77656064 CTTGCCTTCTGGGGCTTCAGAGG + Intergenic
1044274628 8:90285461-90285483 CACTCCTTCTGGGGCTTCAGGGG - Intergenic
1044286791 8:90419593-90419615 CACTTCCTCTGGGGCTTCAGGGG - Intergenic
1044325470 8:90853041-90853063 CACACATTCTGGGGCTTCAGGGG + Intronic
1045442562 8:102228595-102228617 CATTCCTTCTGGGGCTTCAAGGG + Intronic
1045509353 8:102802313-102802335 TAGCTCTTCTGGGTCTTTTGTGG - Intergenic
1045840376 8:106572931-106572953 CAGCTCTCCTGGGTCTCCATTGG - Intronic
1047498789 8:125427173-125427195 CACCTCCTCTGGGGCTCCAGAGG - Intergenic
1047878852 8:129170469-129170491 CACTCCTTCTGGGGCTTCAGCGG + Intergenic
1048364108 8:133723313-133723335 TTTCTCTTCTGGGGCTGCAGAGG + Intergenic
1048439644 8:134450530-134450552 CACTCCATCTGGGGCTTCAGGGG + Intergenic
1049361801 8:142215577-142215599 CAGCTCTCCTGGGGGTTCTCAGG - Intronic
1049608495 8:143541146-143541168 CGGCCCTGCTGGGGCTGCAGAGG - Intronic
1049692025 8:143965655-143965677 CAGCTCCTCTTGGGCCTCACTGG + Intronic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1052372529 9:27681699-27681721 CAGCTATTCTGGAGCTTAGGTGG - Intergenic
1053177922 9:35942705-35942727 CAGCTCTTCTGGGGTTGGGGAGG + Intergenic
1053583852 9:39435974-39435996 CACTCCTTCTGGGGCATCAGGGG - Intergenic
1054105433 9:60994718-60994740 CACTCCTTCTGGGGCATCAGGGG - Intergenic
1054924987 9:70580000-70580022 CAGCTATTTTGGGGGTTGAGAGG + Intronic
1054979722 9:71191220-71191242 CATCTCTTCTGTATCTTCAGTGG + Intronic
1056427163 9:86488810-86488832 CACTCCCTCTGGGGCTTCAGGGG + Intergenic
1057006796 9:91567979-91568001 CACTCCCTCTGGGGCTTCAGGGG - Intronic
1057136053 9:92688684-92688706 CAGCTCCCCTGGTGCTTCAGTGG - Intergenic
1059985107 9:119813808-119813830 CACACCCTCTGGGGCTTCAGGGG + Intergenic
1060674163 9:125497097-125497119 CTCCTCTCCTGGGGCCTCAGGGG + Intronic
1060897782 9:127229375-127229397 AAGCTCTGCAGGTGCTTCAGAGG + Intronic
1061311482 9:129766094-129766116 CAGCTCTCCTGGGTCTCCAGCGG - Intergenic
1061446447 9:130640849-130640871 CACTCCGTCTGGGGCTTCAGAGG + Intergenic
1061446746 9:130643010-130643032 CCACTCTGCTGGGGTTTCAGTGG + Intergenic
1061926572 9:133808829-133808851 CGGGACTTCAGGGGCTTCAGAGG + Intronic
1062460126 9:136659507-136659529 GCCCTCTCCTGGGGCTTCAGAGG + Exonic
1186087255 X:6003829-6003851 CACTTCCTCTGGGTCTTCAGGGG + Intronic
1186128589 X:6442548-6442570 CATTCCTTCTGGGGCTTCAGGGG - Intergenic
1186705503 X:12136292-12136314 CAGCCCTTGTGGAGCTCCAGTGG + Intergenic
1187324511 X:18274170-18274192 CACTCCCTCTGGGGCTTCAGGGG + Intronic
1187594453 X:20756071-20756093 CAGCATTTCTGGGGCTTCCCTGG - Intergenic
1188182446 X:27072820-27072842 CACTTCCTCTGGGGCTTCAGGGG + Intergenic
1188188407 X:27144833-27144855 CACTCCTTCTGGGGCTTCAGGGG + Intergenic
1188324003 X:28777123-28777145 TAGGTCTTCTAGGGCTTCAGGGG + Intronic
1188587233 X:31792763-31792785 CACACCCTCTGGGGCTTCAGGGG - Intronic
1189950645 X:46226721-46226743 CTGCCCTAATGGGGCTTCAGGGG - Intergenic
1189954415 X:46263020-46263042 CAAGCCTCCTGGGGCTTCAGGGG - Intergenic
1190687319 X:52886987-52887009 CAGCTCTTCAGAGGCTGAAGTGG - Intergenic
1190698663 X:52968805-52968827 CAGCTCTTCAGAGGCTGAAGTGG + Intronic
1191052926 X:56213727-56213749 CACTCCTTCTGGGGCTTCTGGGG - Intergenic
1191057215 X:56254425-56254447 CACTCCTTCTGGGGCTTCAAGGG - Intronic
1193144615 X:78064158-78064180 CACATCTTCTGGGGCTCCAGAGG + Intergenic
1193532612 X:82674568-82674590 CACTCCTTCTGGGGCTTTAGGGG - Intergenic
1194690616 X:96980038-96980060 CACTCCTTCTGGGGCTTCGGGGG - Intronic
1194878992 X:99226238-99226260 CACGCCTTCTGGGACTTCAGGGG + Intergenic
1195380133 X:104262641-104262663 CAGCTCTTCTGGCAGTTCAAAGG + Intergenic
1195722415 X:107879123-107879145 CACTCTTTCTGGGGCTTCAGGGG - Intronic
1196248877 X:113434431-113434453 TAGCTATTCTGGGACTTCTGTGG - Intergenic
1197580145 X:128272186-128272208 CAGATTCTCTGGGACTTCAGGGG + Intergenic
1197725288 X:129772276-129772298 CAGGTCTCCTTGGGCCTCAGTGG - Intergenic
1197750574 X:129961120-129961142 CCTCTCCTCTGGGGCTTCAGCGG + Intergenic
1198613309 X:138425720-138425742 CACTTCCTCTGGGGCTTCAGGGG + Intergenic
1199337081 X:146630724-146630746 CACTCCTTCTGGGGCTTCAGGGG + Intergenic
1199854995 X:151752737-151752759 CAGCCCTCCTGGGGAGTCAGAGG + Intergenic
1199978444 X:152907753-152907775 CACATCTTGTGGGGCTTCGGGGG + Intergenic