ID: 947838714

View in Genome Browser
Species Human (GRCh38)
Location 2:233193763-233193785
Sequence GTGAAGACCCTGCCTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947838714_947838717 4 Left 947838714 2:233193763-233193785 CCATGAAAAGGCAGGGTCTTCAC 0: 1
1: 0
2: 1
3: 14
4: 180
Right 947838717 2:233193790-233193812 CTGTCTCCCACTTTCCCTGCAGG 0: 1
1: 0
2: 4
3: 41
4: 355
947838714_947838720 10 Left 947838714 2:233193763-233193785 CCATGAAAAGGCAGGGTCTTCAC 0: 1
1: 0
2: 1
3: 14
4: 180
Right 947838720 2:233193796-233193818 CCCACTTTCCCTGCAGGCGAGGG 0: 1
1: 0
2: 1
3: 14
4: 206
947838714_947838724 26 Left 947838714 2:233193763-233193785 CCATGAAAAGGCAGGGTCTTCAC 0: 1
1: 0
2: 1
3: 14
4: 180
Right 947838724 2:233193812-233193834 GCGAGGGCTGCATTGCCCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 81
947838714_947838718 9 Left 947838714 2:233193763-233193785 CCATGAAAAGGCAGGGTCTTCAC 0: 1
1: 0
2: 1
3: 14
4: 180
Right 947838718 2:233193795-233193817 TCCCACTTTCCCTGCAGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947838714 Original CRISPR GTGAAGACCCTGCCTTTTCA TGG (reversed) Intronic
901523944 1:9807651-9807673 CTGCAGGCCCTGCCTCTTCACGG - Intronic
901636310 1:10671874-10671896 AGAAACACCCTGCCTTTTCACGG + Intronic
901939745 1:12652874-12652896 GTCCACACCCTGGCTTTTCAGGG + Intronic
901940464 1:12657879-12657901 GCCAACACCCTGGCTTTTCAGGG + Intronic
902227592 1:15006456-15006478 AGAAAGACCCTGCCTTTTCCCGG - Intronic
904710992 1:32430036-32430058 GTGAATTCTGTGCCTTTTCAAGG + Intergenic
905249001 1:36636111-36636133 ATGAGGCCTCTGCCTTTTCACGG + Intergenic
907164412 1:52397787-52397809 GTGAAGTCCCTGCCTGTAAACGG - Exonic
907498637 1:54862044-54862066 GTGGAGAGGCTGCCTTTTGATGG - Intronic
907596505 1:55725301-55725323 AAGAAGTCCCTGCCTTTTCTGGG + Intergenic
909677450 1:78253891-78253913 GAGAAGACTCTGCCTTTAAAAGG + Intergenic
909726154 1:78838294-78838316 GCTAAGAGACTGCCTTTTCAAGG + Intergenic
910501643 1:87898832-87898854 GAGAAGACCTTGCATTTTCAGGG + Intergenic
911741516 1:101391256-101391278 TTGGAGACCCTGCCTTTCCCGGG + Intergenic
913262276 1:117010262-117010284 GTGGAGACTCTGGCTTCTCAGGG - Intronic
915826542 1:159084271-159084293 GGGAAGGCCCTGCCTCTCCAGGG - Intronic
915899314 1:159835019-159835041 TTGAAGAGCCTCCCTTTCCAGGG + Exonic
915963231 1:160284338-160284360 GTGAGGACACAGGCTTTTCAGGG - Intronic
916189749 1:162167421-162167443 GGGAGGACCCTGCCTTATCCTGG - Intronic
916529911 1:165647072-165647094 GTGAATTCACTGCCTTTCCAAGG + Intronic
917024229 1:170624657-170624679 CTGGAGACCCAGCCTTTTCCTGG - Intergenic
917609848 1:176677270-176677292 GTAAAGGCCCTACATTTTCAGGG + Intronic
917728271 1:177848412-177848434 GAGTAGACTCTGCCTTTTGATGG - Intergenic
920331710 1:205212846-205212868 GTGAAGGCCTTACCTTTCCAGGG + Intergenic
921356583 1:214289976-214289998 CTGAAGTACCTGCCTTTTCAGGG + Intronic
921546728 1:216482560-216482582 GTGATGACCATGCCTTTTATGGG - Intergenic
924590557 1:245400055-245400077 GAGAAGACACTGCTTTTTAAAGG + Intronic
1064256928 10:13750332-13750354 ATGAAGCCCCTGCCATTACATGG + Intronic
1065435699 10:25702048-25702070 CTCAAGTCCCTGCCATTTCATGG - Intergenic
1068688603 10:59893831-59893853 GTAAAGACCCTACCATTTGAAGG - Intronic
1068803281 10:61165614-61165636 GTGAAGACTTTGCCTTCACAGGG + Intergenic
1069101164 10:64322678-64322700 ATGAATACCATGCCTTTTCAGGG + Intergenic
1074914876 10:117945954-117945976 GTGAATGCCCTCCCTTGTCAGGG + Intergenic
1075088398 10:119429218-119429240 GAGAGTACCCTGGCTTTTCAGGG + Intronic
1075223850 10:120607611-120607633 GAGAAGACACTGCCAGTTCATGG + Intergenic
1076157520 10:128215158-128215180 ATGAAGGCCCTGCCTTTCCCAGG - Intergenic
1078181703 11:9017074-9017096 GTGCAGCCACTGCCTTTTCCAGG + Intergenic
1078292551 11:10027519-10027541 GTCCATACCCTGCCTCTTCATGG - Intronic
1080038801 11:27737282-27737304 ATGAAGTCCCTGCCTTCACAGGG - Intergenic
1081484477 11:43516832-43516854 GTGAGTACCCCTCCTTTTCAGGG - Intergenic
1088699025 11:112395456-112395478 GTCAAGTCCCTTCCATTTCAGGG + Intergenic
1089362874 11:117902552-117902574 GTTGAGACCCTGCCTTCTCTGGG - Intronic
1091787678 12:3252784-3252806 CTGAGGACCCTTCCTTTGCAGGG + Intronic
1094412219 12:30178745-30178767 GTGGAGAGACTGCCTTGTCACGG - Intergenic
1096106813 12:49000841-49000863 GTCCAGACCCTTCCTTTTAAGGG + Intergenic
1104365381 12:128171804-128171826 GGGAAGACACTGCCTTTTTAGGG - Intergenic
1105147235 13:17207813-17207835 GAGAAGAACCTTCCTTTTGACGG + Intergenic
1105153069 13:17303361-17303383 GAGAAGAACCTTCCTTTTGACGG + Intergenic
1107967599 13:45611705-45611727 GTGATGACCTTGGCTTTCCAAGG + Intronic
1109454738 13:62570189-62570211 GTTAAGCTCCTGCCTTTTGATGG + Intergenic
1110633374 13:77736337-77736359 GTGAGAACCCTCCCTTTCCAAGG + Intronic
1112170007 13:96961689-96961711 GTGAAGATCCAGCCCTCTCAAGG + Intergenic
1114447488 14:22800372-22800394 GTACAGACCCTGCCTCTTGATGG - Intronic
1117981644 14:61347859-61347881 GAGAAGACCCAGAGTTTTCAGGG + Intronic
1119196909 14:72723836-72723858 GTGAAGACGCTGCCTTTGCTTGG + Intronic
1120327639 14:83050623-83050645 TTGAAGACCCTGACTTGCCATGG - Intergenic
1121771300 14:96543993-96544015 GTGAGGACTTTGCGTTTTCATGG + Intronic
1122079091 14:99254501-99254523 GTGAGGGTCCTGCCTTTTCCAGG - Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122477349 14:102019986-102020008 CTGGAGACCCTGCCTGTTGAAGG + Exonic
1124377353 15:29136500-29136522 GTGATGATTCTGTCTTTTCAGGG - Exonic
1124690123 15:31814934-31814956 GTAAATACCCTGCCTTGCCATGG + Intronic
1124839506 15:33228737-33228759 GAGAAGGACCTGCCTGTTCATGG + Intergenic
1126403393 15:48297673-48297695 GTGAATATCTTGCCTTTCCAAGG + Intronic
1130022583 15:80243472-80243494 GTGAAGACTCTACCATTGCAAGG - Intergenic
1131997129 15:98143735-98143757 GTGTACACCCTTCCTTTTCTGGG + Intergenic
1132099841 15:99015309-99015331 GGGAAGTCCCTGCCTTCCCAGGG + Intergenic
1133610183 16:7426142-7426164 GTGTAGACCCTGCCTAGGCAAGG - Intronic
1133616245 16:7479530-7479552 CTCAAGAGCCTGCCTTTTCCCGG + Intronic
1134045097 16:11095203-11095225 GTGGAAAGCCTGCCTTTTCTAGG + Intronic
1135942887 16:26838121-26838143 GTAAGGACCCTGCCTTTACTAGG + Intergenic
1137302398 16:47164840-47164862 GTGAAGCCGCTGGCTTTCCATGG + Intronic
1137601814 16:49761361-49761383 GTGAAGGCCCTGCCGTGGCATGG - Intronic
1138495906 16:57409320-57409342 GTAAAGGCCCGGCATTTTCAAGG + Intronic
1139737428 16:69003498-69003520 GTGAAGAACATACCTTTTCAAGG + Intronic
1141919056 16:87122670-87122692 GTGAGGACCATGCCTTTTCCAGG - Intronic
1145811978 17:27769795-27769817 GTGTAGGCCCTGCCTCTTAATGG + Intronic
1147800508 17:43083118-43083140 GTGAGGACTCTTCCTTTTCTGGG + Intronic
1150559236 17:66280755-66280777 GTGATGACCATGCCTTTTGTGGG + Intergenic
1152366410 17:79859169-79859191 GTGGTGCCCCTGCCCTTTCAGGG + Intergenic
1155057107 18:22194536-22194558 GTGAAGTGCCTGCTTTTGCAGGG + Intronic
1156783188 18:40877179-40877201 CTGAAGACATTGCCTTTTAAGGG + Intergenic
1157446540 18:47750791-47750813 GTGGAGACCCTGCCTCCTCCAGG - Intergenic
1157801501 18:50625226-50625248 ATGCAGACCCTGCATTTTCCAGG - Intronic
1158843062 18:61409313-61409335 TTTAAGACCCTGACTTTTAAGGG + Intronic
1159158220 18:64610105-64610127 TTGAAGACCCTTCATATTCAAGG + Intergenic
1161153151 19:2720159-2720181 CTGCAGACCCTGCCCTTTCCTGG + Intronic
1164889943 19:31814729-31814751 GTTAAAGCCCTGCCTTTTCTTGG + Intergenic
1167954711 19:53055446-53055468 GTGAGGAGCCTGCCTTTCCCTGG - Intergenic
926653682 2:15374607-15374629 GTAAAGATCCTGCCTTTGCAAGG - Exonic
927845010 2:26466937-26466959 GTGAAGGCCCTGCCACATCAGGG - Intronic
930578536 2:53182095-53182117 GAGAATACCCTGCCTTTTGGTGG - Intergenic
932527467 2:72486576-72486598 CTGAAGACCCTGCATTTGCTGGG + Intronic
939648670 2:144734873-144734895 ATGAAGACCAAGGCTTTTCATGG - Intergenic
941384557 2:164838113-164838135 GTGAAGTCCCTGCCTTAAAAGGG - Intronic
941793847 2:169579037-169579059 GTGAAGACAGTGCCTTTTAGTGG - Intergenic
942480735 2:176385821-176385843 GTGAAGACCATGCCTTTTTAGGG + Intergenic
944089010 2:195883656-195883678 GATAATACCCTGCATTTTCAGGG - Intronic
944888100 2:204085714-204085736 GTGAAGGTCCTGCTTTTTGAGGG - Intergenic
944952941 2:204773933-204773955 GTGTCGACCCTGCCTGTTCCTGG + Intronic
945020432 2:205565526-205565548 GTGAAGACTCTGCCTTCTGTGGG + Intronic
947838714 2:233193763-233193785 GTGAAGACCCTGCCTTTTCATGG - Intronic
948300200 2:236900348-236900370 CTGTGGACCCTGCCTTGTCATGG + Intergenic
948787755 2:240361810-240361832 GTGTACACCCTGCCTGTGCAGGG - Intergenic
1169001725 20:2172832-2172854 CTGAAGACCCTGCCTGGGCAGGG - Intronic
1170870804 20:20204391-20204413 GTGATGGCCCTGCTTTTTCCTGG + Intronic
1170872023 20:20214617-20214639 GTCAAGACCATGCATCTTCAGGG - Intronic
1173072728 20:39785111-39785133 CAGAAGAACCTGCCTTTTTAGGG + Intergenic
1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG + Intergenic
1180197603 21:46207033-46207055 GTGGAGACCCTGCCCTTTTCTGG - Intronic
1180501678 22:15935409-15935431 CTGAGGGCCCTCCCTTTTCAGGG - Intergenic
1180930632 22:19588354-19588376 GGGAACACCCTGCGTTTTGATGG - Intergenic
1183199010 22:36373156-36373178 CTGAGGCCCCTGCCTTTTCCAGG - Intronic
1183617721 22:38955390-38955412 TTGAAGACCCTGCCTTGCCCTGG + Intronic
1184636553 22:45836641-45836663 GTGAGGAGGTTGCCTTTTCAGGG + Intronic
1184744821 22:46450164-46450186 GTCAGGACCCTGCCTCTTCCCGG + Intronic
1184826545 22:46956549-46956571 GAGAAGCCACTTCCTTTTCAGGG + Intronic
951343723 3:21520754-21520776 GTGATGACTCTGCATTTTAAGGG + Intronic
953667138 3:44933509-44933531 GTCAGCACCCTGGCTTTTCAAGG - Intronic
955281262 3:57597022-57597044 GTGGAGACCCTGCCTTTCCCAGG + Intronic
955365073 3:58303903-58303925 GGGAAGACACTTCATTTTCAGGG + Intergenic
958457805 3:94354675-94354697 ATGAAGCCCCTGGCATTTCAAGG - Intergenic
959074044 3:101731834-101731856 TTCAAGACCCTGCTTTTACATGG + Exonic
959786717 3:110307825-110307847 CTGAGGACACTGACTTTTCAGGG - Intergenic
959887421 3:111518791-111518813 GTGGAGGCCCAGCATTTTCATGG + Intronic
961129535 3:124453203-124453225 GTTATTACTCTGCCTTTTCATGG + Intronic
961472344 3:127123820-127123842 GACAACACCCTGCCTTTGCAGGG - Intergenic
962017044 3:131452448-131452470 TGGAAGTCCCTGCCTTTTCCAGG - Intergenic
962233997 3:133692592-133692614 GAGAACACCATCCCTTTTCAAGG - Intergenic
964849561 3:161080841-161080863 GTGGAGACCCTGGCTCTTGATGG - Intergenic
966555332 3:181252720-181252742 GTGCAGCCACTGCCTTTTAATGG - Intergenic
969530038 4:7725499-7725521 GACTAGACCCTGCCTTTTCCCGG + Intronic
971846366 4:31923957-31923979 TTGAACTTCCTGCCTTTTCATGG - Intergenic
972356744 4:38286526-38286548 TTGAAAACTCTGCCATTTCAGGG - Intergenic
981258526 4:142691860-142691882 GTGAAGAACCTGCCTGAACATGG - Intronic
987314378 5:16710707-16710729 GTGAAGTCCTTGACTTGTCAGGG - Intronic
989813638 5:45709161-45709183 GTGAGGACCGTGGCTTTTAATGG - Intergenic
991002543 5:61796899-61796921 GTTAAGTCCCTGACATTTCAGGG - Intergenic
991550795 5:67833773-67833795 ATGAAGAACCTGCATCTTCAAGG - Intergenic
993796090 5:92268952-92268974 GTGAAGCTCCTGTCCTTTCATGG - Intergenic
994355045 5:98785331-98785353 GTGTAAACCCAGCATTTTCAGGG + Intronic
996483764 5:124006103-124006125 GTGAAAACAGTGACTTTTCAGGG - Intergenic
998477307 5:142432671-142432693 GTGAGGCCCCTGCCTGTTCCTGG + Intergenic
999796742 5:154995861-154995883 AGGAAGCCCCTGCCTTGTCATGG - Intergenic
1003433034 6:6057967-6057989 TTGAAGACTCTGGCTTTTAAGGG + Intergenic
1003735476 6:8873333-8873355 GTTCTGACCCTGCCGTTTCATGG - Intergenic
1004511527 6:16287757-16287779 CTTAAGACCCTCCCCTTTCAGGG - Intronic
1006677335 6:35773886-35773908 GAGAAGTCCCTGCCTTCTCTGGG + Intergenic
1008168608 6:48172926-48172948 GTGATAAGCCTGCCATTTCAAGG + Intergenic
1008320417 6:50105331-50105353 GTGAGTAGCCTGGCTTTTCATGG - Intergenic
1008692452 6:53995105-53995127 ATTAAGACCTTTCCTTTTCAAGG + Intronic
1011963225 6:93117858-93117880 TTGAAGACACTGCATTTTTAAGG + Intergenic
1013088006 6:106873118-106873140 GTTAAGACTCTGCCACTTCAAGG + Intergenic
1013541768 6:111117535-111117557 GTTAAGATGCTGCCATTTCAGGG - Intronic
1016433481 6:144011616-144011638 CTGAATACGCTGCTTTTTCAGGG + Intronic
1016852745 6:148638094-148638116 GTGAAGCCCCTGACTTTTGTGGG + Intergenic
1019254069 7:37449-37471 GTGAAGACCTTGACTTTTTCTGG + Intergenic
1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG + Intronic
1023340332 7:39212738-39212760 GGGAAGACACTGACTTTTCAAGG - Intronic
1024005489 7:45222415-45222437 GGGCAGACCCTGCCTGTTCAAGG - Intergenic
1025006779 7:55361805-55361827 GTGGAGCCCCTCCCTTTGCAGGG - Intergenic
1026155722 7:67823980-67824002 GAGGAGACCCTGCCTTTACCTGG - Intergenic
1027774377 7:82444874-82444896 TCGCAGACCCTGTCTTTTCAAGG - Intergenic
1031030241 7:116726635-116726657 GTCAAGACCCTCCCATTTCTTGG - Intronic
1033627541 7:143125260-143125282 TTGGAGACACTGCCTATTCAAGG + Intergenic
1035014498 7:155753381-155753403 GTGGAGGCTCTGCCTTTGCATGG - Intronic
1035767583 8:2119547-2119569 GTAGAGACCCTGCCTTGCCAGGG - Intronic
1038503685 8:28065913-28065935 TTCAAGCCCCTGCCTTTTCCTGG - Intronic
1039588215 8:38724904-38724926 ATGAAAACCCAGGCTTTTCAAGG - Intergenic
1043107570 8:76134345-76134367 GTGAGGACCCTGATTTTTCCTGG - Intergenic
1043945220 8:86243542-86243564 GTGAGATCCCTGCCTTCTCAGGG + Intronic
1043950581 8:86304691-86304713 GTAAAGACACTCCGTTTTCATGG - Intronic
1044846875 8:96390504-96390526 CTGTAGGCCCTGCCTCTTCAAGG - Intergenic
1046563556 8:115869375-115869397 TTGAATTCCCTTCCTTTTCAAGG - Intergenic
1046901537 8:119528848-119528870 GTGACCCCCCTGCCTTTTGAAGG - Intergenic
1048428244 8:134342570-134342592 CTGAAGACAGTGTCTTTTCAGGG + Intergenic
1048956960 8:139545141-139545163 GAGAAAACCCAGCCATTTCAAGG + Intergenic
1049466280 8:142752580-142752602 GTGAAGACCCCGCCCCTCCAGGG + Intergenic
1051717643 9:20001507-20001529 GTCAAGGCCCTGCCTTTTTTGGG + Intergenic
1055208327 9:73760838-73760860 ATGAGGACTCTGCCTTTTAAAGG + Intergenic
1056932060 9:90887235-90887257 GTGAATTCCCTTCCTTTTGAAGG + Intronic
1059839700 9:118200079-118200101 GTGAATGACCTGCTTTTTCATGG - Intergenic
1059866350 9:118518764-118518786 GTGAATAGCCTGCCTTATAATGG - Intergenic
1060052383 9:120386611-120386633 GTGAAGGCCCTCCCTCTTCTGGG - Intergenic
1061302368 9:129712863-129712885 GTCAGGTCCCTGCCTTTTCACGG - Intronic
1061434984 9:130555450-130555472 GTGTAGACTCTACCTCTTCATGG + Intergenic
1186211986 X:7259465-7259487 GTGAAGACACTGCCCTCTCCGGG - Exonic
1187718940 X:22131877-22131899 GAGGAGGCCCTGCCTGTTCATGG - Intronic
1189360074 X:40343529-40343551 GTGCAGAGCCTGCCTGTTCCCGG - Intergenic
1192252554 X:69424809-69424831 GTGAACACATTCCCTTTTCAAGG + Intergenic
1195752688 X:108174213-108174235 GAGAAGGCTCTGCCATTTCAGGG + Intronic
1199505075 X:148552386-148552408 GTGAAGACCCTGCCTACTAGAGG - Intronic
1202270354 Y:23066216-23066238 GAAAAGACCTTCCCTTTTCAAGG - Intergenic
1202295673 Y:23354466-23354488 GAAAAGACCTTCCCTTTTCAAGG + Intergenic
1202423348 Y:24699961-24699983 GAAAAGACCTTCCCTTTTCAAGG - Intergenic
1202447441 Y:24970125-24970147 GAAAAGACCTTCCCTTTTCAAGG + Intergenic