ID: 947839458

View in Genome Browser
Species Human (GRCh38)
Location 2:233198299-233198321
Sequence TCTTGGGTGATATGGGCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947839458_947839471 25 Left 947839458 2:233198299-233198321 CCAGCCGCCCATATCACCCAAGA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 947839471 2:233198347-233198369 GGGTCTCCCTCCCAGGACACAGG 0: 1
1: 1
2: 1
3: 29
4: 343
947839458_947839466 5 Left 947839458 2:233198299-233198321 CCAGCCGCCCATATCACCCAAGA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 947839466 2:233198327-233198349 TTACCCTCAACAGCAAACCGGGG 0: 1
1: 0
2: 0
3: 4
4: 60
947839458_947839464 3 Left 947839458 2:233198299-233198321 CCAGCCGCCCATATCACCCAAGA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 947839464 2:233198325-233198347 TTTTACCCTCAACAGCAAACCGG 0: 1
1: 0
2: 0
3: 11
4: 147
947839458_947839465 4 Left 947839458 2:233198299-233198321 CCAGCCGCCCATATCACCCAAGA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 947839465 2:233198326-233198348 TTTACCCTCAACAGCAAACCGGG 0: 1
1: 0
2: 0
3: 12
4: 114
947839458_947839469 18 Left 947839458 2:233198299-233198321 CCAGCCGCCCATATCACCCAAGA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 947839469 2:233198340-233198362 CAAACCGGGGTCTCCCTCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947839458 Original CRISPR TCTTGGGTGATATGGGCGGC TGG (reversed) Exonic