ID: 947845708

View in Genome Browser
Species Human (GRCh38)
Location 2:233242057-233242079
Sequence ATCTCTTAAGCCTGAAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947845699_947845708 21 Left 947845699 2:233242013-233242035 CCTGAATCTCCACCTCAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 175
Right 947845708 2:233242057-233242079 ATCTCTTAAGCCTGAAGCAAAGG 0: 1
1: 0
2: 1
3: 25
4: 156
947845698_947845708 26 Left 947845698 2:233242008-233242030 CCACTCCTGAATCTCCACCTCAA 0: 1
1: 0
2: 2
3: 28
4: 290
Right 947845708 2:233242057-233242079 ATCTCTTAAGCCTGAAGCAAAGG 0: 1
1: 0
2: 1
3: 25
4: 156
947845701_947845708 12 Left 947845701 2:233242022-233242044 CCACCTCAATGTGGACTCTGTAA 0: 1
1: 0
2: 0
3: 11
4: 137
Right 947845708 2:233242057-233242079 ATCTCTTAAGCCTGAAGCAAAGG 0: 1
1: 0
2: 1
3: 25
4: 156
947845703_947845708 9 Left 947845703 2:233242025-233242047 CCTCAATGTGGACTCTGTAAGGG 0: 1
1: 0
2: 6
3: 131
4: 1090
Right 947845708 2:233242057-233242079 ATCTCTTAAGCCTGAAGCAAAGG 0: 1
1: 0
2: 1
3: 25
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947845708 Original CRISPR ATCTCTTAAGCCTGAAGCAA AGG Intronic
902041434 1:13495425-13495447 AGCCCTTAAGCCTGCAGCAGAGG - Intronic
906400578 1:45501350-45501372 GTCTCTTAAGCATCAGGCAAAGG - Intronic
912766426 1:112416145-112416167 ATCTTGAAAGCCTGAAACAAAGG - Exonic
913546412 1:119873002-119873024 ATGTCTAAAGGCAGAAGCAAGGG + Intergenic
917339976 1:173966054-173966076 ATCACTTGAGCCTGAGGCAGAGG + Intronic
918884672 1:190176692-190176714 TTCTCTTAAACCTGAAGGGACGG + Intronic
923834387 1:237593923-237593945 ATCTCTCAACCCTAAAACAAAGG - Intronic
1064746446 10:18483054-18483076 GTCTCTCAACACTGAAGCAAGGG + Intronic
1065917762 10:30366849-30366871 GTCACTTAGGCCTGGAGCAAGGG - Intronic
1068316899 10:55356496-55356518 ATCTCATCAGCCTGAATCAGAGG + Intronic
1069010493 10:63366508-63366530 ATCCCTCAAGCTTGCAGCAATGG + Intronic
1071703754 10:87973836-87973858 AACTCTTAAGCCAAAATCAAGGG - Intergenic
1073608033 10:104915356-104915378 CTCCATTGAGCCTGAAGCAAGGG - Intronic
1076092154 10:127695916-127695938 AGCTCTTAAGTCTGAAACAAGGG + Intergenic
1080775189 11:35379538-35379560 TGTTCTCAAGCCTGAAGCAAAGG - Intronic
1082066328 11:47903659-47903681 ATCTCTTAAGACTGTAGCATTGG - Intergenic
1085995535 11:81908243-81908265 ATTTCTTAAGCTTGATGCACAGG + Intergenic
1089665640 11:120016699-120016721 ATGACCTAAGGCTGAAGCAAAGG - Intergenic
1090521005 11:127479294-127479316 ATCTCTTGAACCTCAGGCAAGGG + Intergenic
1091255126 11:134177160-134177182 TTCCCTTAAACCAGAAGCAATGG + Intronic
1092830515 12:12440115-12440137 ATCACTTAAGTCTGGATCAAAGG + Intronic
1093390869 12:18619438-18619460 ATTTCTTAAGACGGAAGCTAAGG + Intronic
1094191230 12:27700398-27700420 TTCTCTTCAGCCTCAAGAAATGG + Intergenic
1098917585 12:76273694-76273716 CTATCTAAGGCCTGAAGCAAAGG + Intergenic
1100382184 12:94072308-94072330 ATCACTTAAGCCAGGAGCAGTGG - Intergenic
1102185240 12:110942500-110942522 ATTTGTTAAGCTTAAAGCAAAGG + Intergenic
1103848119 12:123913718-123913740 ATCACTTAAGACTGAAGCCCAGG - Intronic
1106900896 13:34354025-34354047 ATCTCAGAAGCCTGTAGAAAAGG - Intergenic
1107067674 13:36232811-36232833 ATCACTTGAGCCTGAGGCAGAGG + Intronic
1108044463 13:46370305-46370327 ATTTCTTAAGGCTGTAGGAAGGG - Intronic
1108226575 13:48295606-48295628 ATCTCTTAATACAGAAGCAAGGG - Intergenic
1112729342 13:102342518-102342540 TACTTTTAAGCCTGCAGCAATGG + Intronic
1114666117 14:24378051-24378073 AGCTCTGGAGCCTGAAGCACTGG - Exonic
1116373586 14:44168656-44168678 TTATCTTTAGCCTGAAGAAAAGG + Intergenic
1120805374 14:88742133-88742155 ATCTCTGAAGCATGAAGCCCAGG + Intronic
1121043606 14:90771507-90771529 ATCTCTTGAGCCTGGTGCAGGGG + Intronic
1123751718 15:23362701-23362723 GTCACTTAGGCCTGAAGTAAGGG + Intronic
1124284090 15:28386625-28386647 GTCACTTAGGCCTGAAGTAAGGG + Intronic
1124298607 15:28524989-28525011 GTCACTTAGGCCTGAAGTAAGGG - Intronic
1124939300 15:34203209-34203231 ATTTCTCAAGCCTGAAATAAAGG + Intronic
1125061336 15:35428757-35428779 ATATATTTAGCCTGAAGTAAAGG - Intronic
1125532781 15:40424416-40424438 ATCTCTAAAGCCTCAGGCCAGGG + Intronic
1127321857 15:57854872-57854894 AACACTTAATCCTGAATCAAAGG - Intergenic
1127772939 15:62245101-62245123 GTCACTTAGGCCTGGAGCAAGGG - Intergenic
1128146221 15:65333862-65333884 ATCTGTCAAGCCGGAAGGAATGG - Intronic
1129038235 15:72663991-72664013 GCCTCTTAGGCCTGGAGCAAGGG + Intronic
1129211653 15:74073240-74073262 GCCTCTTAGGCCTGGAGCAAGGG - Intronic
1129398750 15:75267844-75267866 GCCTCTTAGGCCTGGAGCAAGGG + Intronic
1129402358 15:75292120-75292142 GCCTCTTAGGCCTGGAGCAAGGG + Intronic
1129475900 15:75784555-75784577 GTCTCTTAAGCCTGGAGCAAGGG + Intergenic
1129728776 15:77917515-77917537 GCCTCTTAGGCCTGAAGCAAGGG - Intergenic
1129736903 15:77971657-77971679 AGCTCTTAAGCCTCAAAAAATGG + Intergenic
1129839743 15:78736356-78736378 GCCTCTTAGGCCTGGAGCAAGGG + Intergenic
1129849166 15:78781964-78781986 AGCTCTTAAGCCTCAAAAAATGG - Intronic
1130259334 15:82343334-82343356 GTCTCTTAGGCCTGGAGCAAGGG - Intronic
1130269343 15:82435831-82435853 GTCTCTTAGGCCTGGAGCAAGGG + Intronic
1130281931 15:82525848-82525870 GTCTCTTAGGCCTGGAGCAAGGG + Intergenic
1130473299 15:84242011-84242033 GTCTCTTAGGCCTGGAGCAAGGG + Intronic
1130480713 15:84356075-84356097 GTCTCTTAGGCCTGGAGCAAGGG + Intergenic
1130490999 15:84431684-84431706 GTCTCTTAGGCCTGGAGCAAGGG - Intergenic
1130502583 15:84510483-84510505 GTCTCTTAGGCCTGGAGCAAGGG - Intergenic
1130595584 15:85246606-85246628 GTCTCTTAGGCCTGGAGCAAGGG + Intergenic
1131188221 15:90293365-90293387 GTCTCTTAGGCCTGGAGCAAGGG + Intronic
1131282605 15:91033430-91033452 GTCACTTAGGCCTGGAGCAAGGG - Intergenic
1131800913 15:96068723-96068745 ATGTCTTATGCCAGAAGCCAGGG - Intergenic
1132432737 15:101774062-101774084 GTCACTTAGGCCTGGAGCAAGGG - Intergenic
1133721798 16:8501390-8501412 TTTTCTAAAGCCTGAAGAAAGGG - Intergenic
1134586793 16:15418433-15418455 GTCTCTGAACCCTGTAGCAAGGG - Intronic
1135553593 16:23417261-23417283 TTCTCTAGAGCCTGAATCAAGGG + Intronic
1140250748 16:73292318-73292340 ATGTCTCAGGCCTGAAGTAAAGG + Intergenic
1153920244 18:9782424-9782446 CTCTTTTAATGCTGAAGCAATGG - Intronic
1156111665 18:33734995-33735017 CTCTGTTAAACCTGAGGCAAAGG - Intronic
1156602573 18:38626689-38626711 AACTCAGAAGACTGAAGCAAAGG - Intergenic
1156881672 18:42087634-42087656 ATCACTTAAGCAGAAAGCAAGGG - Exonic
1158384638 18:56975396-56975418 TTTTGTTATGCCTGAAGCAAAGG + Intronic
1159791548 18:72786549-72786571 CTCTCATAAGGCTGTAGCAATGG - Intronic
1161134473 19:2611547-2611569 ATCTCTTAGGCCGGGTGCAATGG + Intronic
1163972672 19:20814010-20814032 ATCTCTTAAGAATTAAGAAATGG - Intronic
1164156545 19:22600928-22600950 GTCTCTCAGGCCTGGAGCAAGGG + Intergenic
1164745792 19:30611910-30611932 ATCTCTTAAGCGTGGATCAGTGG + Intronic
1167540428 19:50083331-50083353 ATTTCTTAAACCAGAAACAAAGG - Intergenic
1167629279 19:50614467-50614489 ATTTCTTAAACCAGAAACAAAGG + Intergenic
1167751561 19:51383607-51383629 ATCTCTTCATCCTTTAGCAACGG + Intronic
1168123407 19:54267896-54267918 ATTTCTTAAGGCTGAGGGAAGGG - Intronic
925981019 2:9177542-9177564 ATGTTTTTATCCTGAAGCAATGG + Intergenic
927818053 2:26237864-26237886 ATATCTTAAGCTTGAATCATTGG + Intronic
929176002 2:38976922-38976944 ATCTCGCAAGCCTGTAGAAAGGG - Intergenic
929313973 2:40455411-40455433 ATTTCAGAAGCCCGAAGCAATGG - Intronic
930744414 2:54866945-54866967 ATCCCTTAAGCCTGGTGCTAAGG - Intronic
931849660 2:66239577-66239599 ATCTCTTAAGAAATAAGCAAGGG + Intergenic
932753273 2:74386281-74386303 ATCTCTTACGTCTGCAGAAATGG - Intronic
933236727 2:79872604-79872626 ATCTTTTAATGCTTAAGCAAAGG + Intronic
933424191 2:82088904-82088926 TTCTTTGAAGCCTGAAGAAAAGG - Intergenic
937254223 2:120543430-120543452 ATCACTTAAGCCTGGAGCCACGG - Intergenic
942543378 2:177037788-177037810 ATTTCTTAAGCCTGAAAAACAGG + Intergenic
943008446 2:182416285-182416307 ATCTCTTCAGGATGAAGCAAGGG + Intronic
943402129 2:187427016-187427038 ATCTCTTAGGCCACAAACAAGGG - Intronic
944386439 2:199169954-199169976 ATCTCTTACGACTGAGGGAAAGG + Intergenic
944492768 2:200274907-200274929 ATCTGCTGAGCATGAAGCAAAGG + Intergenic
944945224 2:204676596-204676618 ATCTTTCAAGAGTGAAGCAAAGG - Intronic
946069069 2:217015477-217015499 ATGTCTTAGGCCTCAAGCAAGGG + Intergenic
947845708 2:233242057-233242079 ATCTCTTAAGCCTGAAGCAAAGG + Intronic
1171033165 20:21694745-21694767 TTCTCTTTAGCCTAAGGCAATGG + Intergenic
1177934283 21:27323112-27323134 ATATCTGAAGCTTGAAGTAAAGG - Intergenic
1183094938 22:35546283-35546305 ATTTCTTAAGCCTGGGGCAGGGG - Intronic
956362126 3:68459984-68460006 ATCTCTCAAGCCTCAATAAACGG - Intronic
956701249 3:71960863-71960885 ATCTCTTGAGCCTGTATCAAAGG - Intergenic
958706412 3:97662188-97662210 ATTACCTAAGCCTAAAGCAAAGG - Intronic
959602845 3:108208242-108208264 ATATCTTAAAACTGAAGCAGAGG + Intronic
960566864 3:119142539-119142561 AATTCTTCAGCCTGAAGAAAAGG + Intronic
960617549 3:119609593-119609615 ATCTCTAAAGCCTGGAGGATGGG - Intronic
960877107 3:122308002-122308024 AACTCTGAGGCCTGGAGCAAAGG - Intergenic
963147932 3:142014057-142014079 ATCTCTTAAATTAGAAGCAATGG + Intronic
963688833 3:148472795-148472817 ATCTCTTAAGCCTTACTCAAAGG + Intergenic
964709846 3:159660117-159660139 ATCTCCAAATCCTGAAGGAATGG + Intronic
966515452 3:180815900-180815922 TTCTCTTAGGCCTGGTGCAATGG + Intronic
966797502 3:183729771-183729793 ATCGCTTGAACCTGAAGCAGAGG - Intronic
967415037 3:189207364-189207386 ATTTCTTCAGCCTAAACCAAGGG - Exonic
970538697 4:17055912-17055934 ATCACATAAGACTGCAGCAAGGG - Intergenic
974199009 4:58614624-58614646 ATATAATAAGTCTGAAGCAAAGG + Intergenic
976821756 4:89214676-89214698 TTGTCTTAAGCCTAAAGAAAGGG - Intergenic
977647457 4:99429800-99429822 ATTTCTCATGCCTTAAGCAAAGG - Intronic
977777130 4:100934376-100934398 CTCTCTTAAGCCTAAAGCTAAGG + Intergenic
978323447 4:107523937-107523959 ATCACCTAAGCCAGAAGCATGGG - Intergenic
980192478 4:129542642-129542664 ATCTTTTAAGTTTGAAGAAAAGG - Intergenic
982390217 4:154855767-154855789 CTCTCTAGAGCCTGAAACAATGG + Intergenic
982536247 4:156609676-156609698 GTCTCATAAGGCTGAAACAAAGG - Intergenic
983278391 4:165648155-165648177 ATCTGTTGATCATGAAGCAACGG + Intergenic
983697742 4:170553588-170553610 TTCTCTTATGCTTGAAGAAAGGG - Intergenic
984982305 4:185294250-185294272 ATCTCACCAGCCTGCAGCAATGG - Intronic
985502335 5:256616-256638 ATCTCACAAGAATGAAGCAAGGG - Exonic
985734686 5:1572001-1572023 ATCTCACAAGAATGAAGCAAGGG + Intergenic
987566682 5:19597270-19597292 ATCTCATAAGCATGAACCAAAGG + Intronic
991334799 5:65535146-65535168 ATCCCTTAAGCCTGAGGTCAAGG + Intronic
992541356 5:77767893-77767915 ATCTCTTAATACTGTAGCATTGG - Intronic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
999426369 5:151490780-151490802 AGCTCTTAGGCATCAAGCAAAGG + Exonic
999509217 5:152230475-152230497 TTCTCTTAAGGCTGAACCATAGG - Intergenic
1000109033 5:158089672-158089694 ATCACTTAACCCAGAAGCAGAGG - Intergenic
1002905877 6:1448717-1448739 GTCTCTTCAGAATGAAGCAAAGG - Intergenic
1003654033 6:7988917-7988939 ATTTCTTAAGGCTGAAGGAATGG + Intronic
1005179036 6:23082577-23082599 AGCTGGTAAGCCTGAAACAAAGG + Intergenic
1006618612 6:35346617-35346639 ATGTCTGAAACCTGATGCAAGGG - Intronic
1008118475 6:47582043-47582065 TTCTTTAAAGCCTGAAGAAAAGG + Exonic
1008750059 6:54722121-54722143 ATCTCTTAAGTATGAAGGTATGG + Intergenic
1009643188 6:66363166-66363188 CACTTTTAAGCCTGCAGCAAGGG + Intergenic
1012146311 6:95687452-95687474 ATATCTTAAGACTGAAATAAAGG + Intergenic
1012880945 6:104788796-104788818 ATCTCTTAATGCTGAAAGAATGG + Intronic
1014038010 6:116790471-116790493 AACTCTTAAGTCTGATGCAAAGG - Intergenic
1017329177 6:153175553-153175575 ATCTCTGGAGCCTGCAGCACAGG - Intergenic
1017558302 6:155598417-155598439 ATCAATAAAGCCTGAATCAATGG - Intergenic
1021653875 7:22855685-22855707 ATCTCTAACACCTAAAGCAATGG - Intergenic
1021909063 7:25365997-25366019 ATCTATTCAGCCTGCAGCATGGG + Intergenic
1024347252 7:48325735-48325757 ATCTCTAAAGAATGCAGCAATGG + Intronic
1027172686 7:75883976-75883998 ATCACTTGAACCTGAAGCAGAGG - Intronic
1031069414 7:117145119-117145141 ATCTCTTGGGCCTGAAGTTAAGG + Intronic
1032199441 7:129809012-129809034 ATCTGTTAAGGGTGAAGCAGGGG + Intergenic
1032224940 7:130023713-130023735 CTCTTTTCAGCCTGAAGGAAAGG + Exonic
1033244430 7:139706309-139706331 ATCTCTGAACCCTGAATCACAGG - Intronic
1041006506 8:53501510-53501532 GTCTTTTAAACCTGAAGCACTGG + Intergenic
1042754671 8:72197341-72197363 ATCTCATAAGGCTGAAGTCAAGG + Intergenic
1043761156 8:84069886-84069908 ATCTCTTAAACCTGTTGCACTGG + Intergenic
1045722888 8:105134528-105134550 ATCTCTTAAGGCTGTTTCAAGGG - Intronic
1046037777 8:108864700-108864722 ATGACTTTAGCCTGAAGCACTGG + Intergenic
1047134532 8:122061369-122061391 ATCACATCAGCCTGAAGTAATGG + Intergenic
1050830289 9:10001570-10001592 ATCACTGAAGCCAGAGGCAATGG + Intronic
1052273665 9:26654205-26654227 ACCTCTTCAGCCTTAAGGAAGGG - Intergenic
1055524158 9:77113225-77113247 ATATCTTAAGCCTGAAAGGAAGG + Intergenic
1059878660 9:118665181-118665203 ATGTCTTACGTCTCAAGCAATGG - Intergenic
1060167829 9:121434101-121434123 ATCTCTTTAGTCTGAGGCAAAGG - Intergenic
1061062893 9:128259495-128259517 GTCACTTAGGCCTGGAGCAAGGG - Intronic
1185702268 X:2239941-2239963 ATCTCTAATTCCTCAAGCAAAGG - Intronic
1185702318 X:2240329-2240351 ATCTCTCATTCCTCAAGCAAAGG - Intronic
1186693680 X:12006436-12006458 ATTTATTTAGCCTGAAGCAATGG - Intergenic
1191169277 X:57424324-57424346 ATCTCCTGTGCCTCAAGCAATGG - Intronic
1192810030 X:74539059-74539081 AGCTATTCAGCCTGAAGGAAAGG - Intergenic
1198537852 X:137603700-137603722 ATCCTTTAAGCATGAAGAAATGG + Intergenic
1200767074 Y:7089182-7089204 CTCTTTTAAACCAGAAGCAAAGG + Intronic
1201475152 Y:14373670-14373692 AACTCTTAAGTGTGGAGCAAAGG - Intergenic
1202367244 Y:24173903-24173925 GTCTCTTAGGGCTGGAGCAAGGG + Intergenic
1202373194 Y:24211783-24211805 GTCTCGTAGGCCTGGAGCAAGGG - Intergenic
1202497588 Y:25458337-25458359 GTCTCGTAGGCCTGGAGCAAGGG + Intergenic
1202503537 Y:25496220-25496242 GTCTCTTAGGGCTGGAGCAAGGG - Intergenic