ID: 947847780

View in Genome Browser
Species Human (GRCh38)
Location 2:233259380-233259402
Sequence CAGGCCCAGTTGAAGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 457}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947847771_947847780 14 Left 947847771 2:233259343-233259365 CCTCTGATGTCAAAAGATCACCT 0: 1
1: 2
2: 7
3: 22
4: 181
Right 947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG 0: 1
1: 0
2: 1
3: 48
4: 457
947847775_947847780 -6 Left 947847775 2:233259363-233259385 CCTCTTGGGCATTCACACAGGCC 0: 1
1: 0
2: 5
3: 22
4: 163
Right 947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG 0: 1
1: 0
2: 1
3: 48
4: 457
947847770_947847780 15 Left 947847770 2:233259342-233259364 CCCTCTGATGTCAAAAGATCACC 0: 1
1: 4
2: 7
3: 25
4: 193
Right 947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG 0: 1
1: 0
2: 1
3: 48
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947847780 Original CRISPR CAGGCCCAGTTGAAGGGTTG GGG Intronic
900323190 1:2095054-2095076 CAGGCCCCGTAGCAGGGTGGTGG + Intronic
900367477 1:2317105-2317127 GAGGCCCTGCTGAAGGGGTGAGG + Intergenic
900919038 1:5659144-5659166 TGGGCCCAAGTGAAGGGTTGTGG - Intergenic
901753423 1:11426264-11426286 CAGTCCCACTGGAAGGGTGGGGG - Intergenic
901766338 1:11502295-11502317 CAGACCCAGGTGAAGGATGGTGG + Intronic
902083813 1:13840794-13840816 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
905504077 1:38463092-38463114 TAGGCAATGTTGAAGGGTTGTGG + Intergenic
906081934 1:43096904-43096926 CGGGACCTGTTGAGGGGTTGGGG + Intergenic
906690404 1:47789026-47789048 CAGGCCCAATTGTGGGGGTGGGG - Intronic
906900398 1:49829771-49829793 CAGGGCCTGTTGAGGGGGTGTGG - Intronic
907531406 1:55101661-55101683 CAGGTCCAGTTCAGGGTTTGTGG - Exonic
908020949 1:59898190-59898212 CAGCCCCAGTTTAAGGGGAGGGG - Intronic
908435793 1:64104614-64104636 CAGGGCCTATTGAAGGGTGGGGG - Intronic
910111137 1:83684666-83684688 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
910223160 1:84909446-84909468 CAGGGCCTGTCGAGGGGTTGGGG + Intergenic
911364159 1:96916404-96916426 CAGGGCCTGTTGGGGGGTTGGGG + Intergenic
911682600 1:100734678-100734700 AAGGCCCAGTTGAAGGATGCGGG + Exonic
911824268 1:102461532-102461554 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
911878177 1:103196464-103196486 CAGGCAAGGTTGAAGGGTTGAGG + Intergenic
912747298 1:112255659-112255681 CAGCCTCAGTTCAAGGGTTGGGG - Intergenic
915622287 1:157092998-157093020 CAGGTCCAGTTGGAGGGCAGAGG + Exonic
916620679 1:166493130-166493152 CAGGTCCTGTTGGAGGGTAGAGG + Intergenic
918530672 1:185517664-185517686 CAGGGCCTGTTGTGGGGTTGAGG + Intergenic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
920052557 1:203172545-203172567 CAGGCCCTATTGAAAGGTTTAGG + Intronic
921031603 1:211339526-211339548 CAGGCTCAGTTGTGGGGTGGGGG + Intronic
922147625 1:222963752-222963774 CAGGGCCTGTTGGGGGGTTGGGG + Intronic
922393705 1:225174099-225174121 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
922536529 1:226385201-226385223 CAGGCACAGTTCTAGGCTTGAGG - Intronic
922620780 1:226986723-226986745 CAGGCCCAGCAGTAGGGCTGCGG + Exonic
923857365 1:237859403-237859425 CAGGGCCTGTTGCAGGATTGGGG + Intergenic
924160271 1:241224249-241224271 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
924836579 1:247654269-247654291 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
924911674 1:248520262-248520284 CAGGGCCTGTTGGTGGGTTGGGG + Intergenic
1064553192 10:16522206-16522228 CAGCCCCAGTTGGAGGGTGGAGG + Intergenic
1066685690 10:37979343-37979365 CAGGACAACTTGAAGGGTGGGGG - Intergenic
1066992949 10:42533895-42533917 CAGGGCCTGTTGGAGGGTGGTGG - Intergenic
1068003313 10:51362781-51362803 CAGGGCCTGTTGAGGGGTTGGGG - Intronic
1069272192 10:66542726-66542748 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1069623978 10:69855762-69855784 CATGCCCAGTAGAAGGGGGGAGG + Intronic
1070803925 10:79259399-79259421 GAAGCCCTGTTGAAGGGTTCTGG - Intronic
1071082103 10:81824844-81824866 CAGGCCCACTTGTTGGGATGTGG - Intergenic
1071364068 10:84881002-84881024 CAGGGCCTGTTAAGGGGTTGGGG - Intergenic
1072372556 10:94779101-94779123 CAGGGCCTGTTGAGGGGTTGGGG + Intronic
1072487733 10:95872551-95872573 GAGGCTCAGTTAAAGGGTTGTGG - Exonic
1072617970 10:97062396-97062418 CAGGCCCAGTCCACGGGTTTGGG + Intronic
1072849529 10:98873360-98873382 CAGGGCCTGTTGCAGGGTGGAGG - Intronic
1073022796 10:100460396-100460418 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1073064045 10:100748138-100748160 CAGCCCCAGTCTAAGGGGTGGGG - Intronic
1073448793 10:103597200-103597222 CAGGCCCTGCTGCAGGCTTGTGG + Exonic
1074694324 10:116035033-116035055 CAGGGCCTGTTGTAGGGTGGGGG - Intergenic
1074923438 10:118043489-118043511 CAGGCCCACTCAAAGGGTTCTGG + Intronic
1074984608 10:118646481-118646503 CAGGGCCTGTTGTAGGGTGGGGG - Intergenic
1075169673 10:120101758-120101780 CAGATCCAGTTTAAGGGCTGGGG + Intergenic
1075909523 10:126112211-126112233 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1076393355 10:130120390-130120412 CAGGTGTAGTTGAGGGGTTGAGG - Intergenic
1076639910 10:131908194-131908216 CAGGCCCAGTGGAAGGGATCTGG - Intronic
1077111615 11:864530-864552 CAGGCCCAACTGCAGGGCTGGGG + Intronic
1077134198 11:990676-990698 CATGCCCAGCTGAAAGGATGGGG - Intronic
1077134209 11:990710-990732 CATGCCCAGCTGAAAGGATGGGG - Intronic
1077134245 11:990815-990837 CATGCCCAGCTGAAAGGATGGGG - Intronic
1077134257 11:990850-990872 CATGCCCAGCTGAAAGGATGGGG - Intronic
1077134269 11:990885-990907 CATGCCCAGCTGAAAGGATGGGG - Intronic
1077300476 11:1844296-1844318 CAGGCCCAGGGCAGGGGTTGTGG + Intergenic
1077338957 11:2017593-2017615 CTGGACCAGGTGAAGGGCTGAGG + Intergenic
1077709375 11:4520612-4520634 CAGGGCCAGTTGGAGGGTGTGGG - Intergenic
1077757875 11:5054723-5054745 CAGGGCCTGTTGGGGGGTTGGGG - Intergenic
1077861216 11:6181789-6181811 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1078669558 11:13352905-13352927 CAAGCCCAGTTGAAGAGGTTGGG - Intronic
1078990154 11:16638058-16638080 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
1079424168 11:20324597-20324619 CAGGGCCTGTTGGGGGGTTGGGG - Intergenic
1079999105 11:27327429-27327451 CAGGGCCTGTTGTAGGGTTGGGG + Intergenic
1080176464 11:29368952-29368974 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1080220666 11:29899422-29899444 CAGGGCCTGTTGTAGGGTGGGGG + Intergenic
1080305052 11:30826859-30826881 CAGGCCCCTTTGAAGGGGGGGGG - Intergenic
1080597621 11:33788465-33788487 CAGGGCCTGTTGCAGGGTCGGGG + Intergenic
1080622273 11:33996737-33996759 CCTTCTCAGTTGAAGGGTTGGGG + Intergenic
1082248163 11:49949066-49949088 CAGGGCCTGTTGTAGGGTGGGGG + Intergenic
1082250283 11:49971442-49971464 CAGGGCCTGTTGGGGGGTTGGGG - Intergenic
1083173590 11:60936503-60936525 CAGACCCAGTTGTGGGGCTGGGG - Exonic
1083725345 11:64625170-64625192 CAGGCCCTGTTGGGGGGTGGGGG - Intronic
1083750551 11:64758507-64758529 CAGGCCCAGCTGGAGGAGTGAGG + Exonic
1083877594 11:65532521-65532543 CAGGCCCAGGTGGAGGAGTGAGG - Intronic
1086234860 11:84617137-84617159 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
1086860422 11:91918831-91918853 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1086907044 11:92430663-92430685 CAGGGCCTGTTGTAGGGTGGGGG - Intronic
1087736818 11:101843289-101843311 CAGGGCCTGTTGTGGGGTTGCGG + Intronic
1088070563 11:105778938-105778960 CAGGGCCTGTTGTAGGGTGGGGG - Intronic
1088083902 11:105955274-105955296 CAGGGCCTGTTGGAGGGTTGGGG - Intronic
1088617265 11:111643295-111643317 CAGGGCCTGTTGGAAGGTTGGGG + Intronic
1090065289 11:123498173-123498195 CAGGTCCAGTTCAAGGCTCGTGG - Intergenic
1090432476 11:126657588-126657610 CAGGGCCTGTAGATGGGTTGGGG + Intronic
1090609579 11:128458276-128458298 CAGCCCCAGTGAAAGAGTTGGGG + Intergenic
1202821941 11_KI270721v1_random:72775-72797 CTGGACCAGGTGAAGGGCTGAGG + Intergenic
1091575774 12:1733760-1733782 CAGGGCCTGTTGTGGGGTTGAGG - Intronic
1093081555 12:14817483-14817505 CAGGGCCAGTTGAGGAGTGGGGG - Intronic
1094056472 12:26273989-26274011 GAGGCCCAGTTAGAGGGTTGTGG + Intronic
1094083409 12:26562754-26562776 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1095531286 12:43189804-43189826 AGGGCCCAGTGGAAGGGTTCAGG + Intergenic
1096150723 12:49310150-49310172 CGGGGCCTGTTGAAGGGTGGGGG - Intergenic
1096957376 12:55540280-55540302 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1097141471 12:56905735-56905757 CAGGGCCAGTGGGGGGGTTGCGG + Intergenic
1097520568 12:60664441-60664463 AATGCCCAGTAGCAGGGTTGTGG + Intergenic
1097804012 12:63945418-63945440 CAGGGCCTGTTGAGGGGTAGGGG - Intronic
1098026833 12:66212869-66212891 CAGGGCCTGTTGGGGGGTTGGGG + Intronic
1098136607 12:67409508-67409530 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1098284362 12:68892954-68892976 CTGGGCCTGTTGGAGGGTTGGGG + Intronic
1098688127 12:73451571-73451593 CAGGGCCTGTTGTAGGGTGGGGG - Intergenic
1099792750 12:87357883-87357905 CAGGGCCTGTTGCTGGGTTGGGG - Intergenic
1100950475 12:99843412-99843434 CAGGGCCTGTTGGAGGGTTGGGG - Intronic
1101186689 12:102288333-102288355 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1101432684 12:104639777-104639799 CAGGCCCAGTTGGAGGTCGGTGG + Intronic
1101949368 12:109162593-109162615 CAGGCACAGTTGAGGGCATGGGG + Intronic
1101972430 12:109324874-109324896 CAGGGCCTGTTGGAGGGTAGGGG - Intergenic
1102018347 12:109663548-109663570 CAGACCCAGCTTAAGGGGTGTGG - Intergenic
1102302481 12:111780764-111780786 CAGGCACAGTTCTAGGGCTGAGG - Intronic
1104100535 12:125604434-125604456 CGGGGCCAGTTGGGGGGTTGTGG + Intronic
1104433766 12:128739321-128739343 CATGTCCAGTTGGAAGGTTGTGG + Intergenic
1104488584 12:129174231-129174253 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
1104534311 12:129604154-129604176 CAGGGCCCGTCGAGGGGTTGGGG + Intronic
1104781833 12:131426630-131426652 CAGGCTAAGATAAAGGGTTGTGG - Intergenic
1106110987 13:26776772-26776794 CAGGGCCTGTCGAAGGGTGGGGG - Intergenic
1106130889 13:26938583-26938605 CAGGGCCAGTTGGGGGGTTGGGG - Intergenic
1106539532 13:30677484-30677506 CAGGCCCTGCTGCAGTGTTGGGG - Intergenic
1107802586 13:44123220-44123242 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1109329348 13:60908861-60908883 ATGGCCCAGATGAATGGTTGTGG - Intergenic
1110715962 13:78704450-78704472 CTGGGCCTGTTGAAGGGTTGGGG + Intergenic
1110878384 13:80539369-80539391 CAGGACCTGTTGTGGGGTTGGGG - Intergenic
1110992187 13:82056268-82056290 CAGGACCTGTTGTGGGGTTGGGG + Intergenic
1111782844 13:92751585-92751607 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1112087919 13:96051320-96051342 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1113088809 13:106595883-106595905 CAGGCCCAGTGGAAGGAGTGAGG + Intergenic
1114011506 14:18374012-18374034 CAGGCCCTGTTGTGGGGTGGGGG + Intergenic
1114683116 14:24503719-24503741 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1114967106 14:27976110-27976132 CAGGGCCTGTTGTAGGGTGGGGG - Intergenic
1115067829 14:29286229-29286251 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1115737765 14:36353192-36353214 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1115792191 14:36892701-36892723 CGGGGCCAGTTGTGGGGTTGGGG - Intronic
1116978049 14:51137772-51137794 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1117646467 14:57858518-57858540 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1120781041 14:88486032-88486054 CAGGGCAGGTTGACGGGTTGGGG - Intronic
1122049380 14:99045078-99045100 CAGGGCCGGTTGAGGGGTAGGGG + Intergenic
1125977498 15:43967920-43967942 CAGGGCCTGTCGAGGGGTTGGGG - Intronic
1126569309 15:50132948-50132970 CAGGGCCTGTTGAGGGGTGGTGG + Intronic
1126693056 15:51302796-51302818 CAGGGCAATTTCAAGGGTTGTGG - Intronic
1126880047 15:53084522-53084544 CAGGCCCAGATGAGGGGATGAGG - Intergenic
1127329855 15:57928093-57928115 CAGGGCCTGTTGGAAGGTTGGGG - Intergenic
1128056366 15:64702857-64702879 AAGGCCCAGTTGCAGGGCTGAGG + Intronic
1130527742 15:84721749-84721771 CAGGCCCAGTTAGAGGGAAGAGG - Intergenic
1130545870 15:84857464-84857486 CAGCCCCAGGTGCAGTGTTGGGG - Exonic
1131335252 15:91542801-91542823 CATGACCATTTAAAGGGTTGTGG + Intergenic
1131390010 15:92040035-92040057 CAGGGCCAGTTGGAGGCTTGGGG + Intronic
1131461033 15:92617654-92617676 CAGTTCCAGTTCAAAGGTTGAGG + Exonic
1131593876 15:93776734-93776756 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1131852276 15:96555778-96555800 CAGGACCTGATGAAGGGTTAGGG + Intergenic
1132238283 15:100238142-100238164 CAGGGCCATTAGAAGTGTTGAGG - Intronic
1132669574 16:1097084-1097106 CAGGCCAAGCTGAGGGGCTGCGG - Intergenic
1132683994 16:1154639-1154661 CATGCGCAGCTGAAGGGTAGGGG + Intronic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1134424069 16:14122437-14122459 CAGGGCCTGTTGCAGGGTAGGGG - Intronic
1134678846 16:16109781-16109803 CTGGCCCAGTTGTGGTGTTGAGG + Intronic
1135843006 16:25893696-25893718 CATGCTCAGTGGAAGGGGTGGGG - Intronic
1137825726 16:51493213-51493235 CAGGCCTGGGTGAAGGGTTTGGG - Intergenic
1138202159 16:55097415-55097437 CAGGGCCTGTTGAGGGGTGGAGG - Intergenic
1138590859 16:57999063-57999085 CAGGGATAGTTGAAGGGGTGTGG - Intronic
1138656444 16:58494355-58494377 CATGCCCACTTGTAGGGATGGGG - Intronic
1138927012 16:61604571-61604593 CAGGGCCTGTTGCAGGGTTGGGG + Intergenic
1139482216 16:67236837-67236859 CAGGCCCAGTGGAGGAGGTGGGG + Intronic
1140838318 16:78815914-78815936 CAGGGCCAGTGAATGGGTTGGGG - Intronic
1140901963 16:79376680-79376702 CAGGGCCTGTTGTAGGGTGGGGG - Intergenic
1141638672 16:85328972-85328994 TGGGCCCTGATGAAGGGTTGGGG - Intergenic
1143422188 17:6802635-6802657 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
1143720527 17:8805976-8805998 CAGGCACAGTGGGAAGGTTGTGG + Intronic
1143849213 17:9797103-9797125 CAGGGCCAGTCGCAGGGTGGAGG - Intronic
1145252033 17:21301954-21301976 CAGGCAGAGTTGGAGGGTGGGGG + Intronic
1145805863 17:27728964-27728986 CAGGGCCTGTTGGGGGGTTGTGG - Intergenic
1146455409 17:33005565-33005587 AAGGCACAGTTGAGGGGTGGGGG + Intergenic
1148485944 17:47991139-47991161 CAGGGCCAGCTGCAGGGTAGTGG + Intergenic
1148530335 17:48384221-48384243 CAGGCCTTGTTGATGGTTTGGGG + Intronic
1148990057 17:51658217-51658239 CAGGCCCATGTAAAGGATTGAGG - Intronic
1149579852 17:57742031-57742053 CAGGCCCAGGAGCAGAGTTGTGG + Intergenic
1150873976 17:68947898-68947920 CAGGGCCTGTTGAGGGGTAGAGG - Intronic
1151097350 17:71513739-71513761 CAGGGCCTGTTGAGGGGTTGGGG - Intergenic
1151246292 17:72797545-72797567 CAGGGCCAAGTAAAGGGTTGAGG + Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1153125950 18:1790463-1790485 CAGGGCCTGTTGAGGGGTAGGGG + Intergenic
1153667549 18:7379689-7379711 AAAGCCCATTGGAAGGGTTGCGG + Intergenic
1153704641 18:7733239-7733261 CAGGGCCTGTTGGAGGGTGGGGG - Intronic
1153928172 18:9854131-9854153 CAGGACCTGTTGAGGGGTTGGGG - Intronic
1154526329 18:15293945-15293967 CAGGCCCTGTTGTGGGGTGGGGG - Intergenic
1155320678 18:24615890-24615912 CAGGGCCTGTTGAGGGGTTGGGG + Intergenic
1156004373 18:32422142-32422164 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
1156022374 18:32614860-32614882 CAGGGCCTGTTGGGGGGTTGGGG - Intergenic
1156561220 18:38128012-38128034 CAGGCCCAGTTAAAGGTCAGTGG - Intergenic
1157772861 18:50365132-50365154 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1159219156 18:65437505-65437527 CAGGGCCTGTTGAGGGGTCGGGG + Intergenic
1159705193 18:71677596-71677618 CAGGGCCTGTTGAGGGGTGGGGG - Intergenic
1159909602 18:74132946-74132968 CAGGCACACTTGAAGGGCAGGGG - Intronic
1161026332 19:2038991-2039013 CAGGCGCGGGTGAAGGGCTGGGG + Exonic
1161518623 19:4711078-4711100 CAGGCGCTGTGGAGGGGTTGCGG + Intronic
1161951207 19:7469141-7469163 CAGGCCCAGGCGAAGGGGTGGGG - Intronic
1162180262 19:8863953-8863975 CAGACCCAGTACAAGGCTTGGGG + Intronic
1163552112 19:17971278-17971300 CAGGCCTGGGAGAAGGGTTGGGG - Intronic
1164330517 19:24250116-24250138 CAGGTACAGTTGTGGGGTTGGGG + Intergenic
1164433883 19:28211430-28211452 CAGGGCCTGTTGTAGGGTCGGGG - Intergenic
1164912688 19:32025595-32025617 TAGGCCCAGCTGAAGGTCTGCGG - Intergenic
1165174052 19:33914293-33914315 CAGGCACTGTTGCAGGGTGGAGG + Intergenic
925132931 2:1506039-1506061 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
926651142 2:15346989-15347011 CAGGGCCTGTTGAGGGGTTGCGG + Intronic
926925505 2:17983283-17983305 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
927564651 2:24101101-24101123 CAGGGCCTGTTGGGGGGTTGGGG + Intronic
928268051 2:29829153-29829175 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
928817711 2:35319911-35319933 CAGGGCCTGTTGCGGGGTTGGGG - Intergenic
931015761 2:57978805-57978827 CAGGGCCTGTTGTAGGGTCGGGG - Intronic
931971792 2:67594880-67594902 CAGGGCCTGTTGTAGGGTGGAGG + Intergenic
932014076 2:68006803-68006825 CAGGGCCTGTTGAGGGGTTAGGG + Intergenic
932527294 2:72484603-72484625 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
933132519 2:78690242-78690264 CAGGGCCTGTTGCAGGGTTGGGG + Intergenic
933194788 2:79376638-79376660 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
933381937 2:81559067-81559089 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935186317 2:100736716-100736738 CAGGCCCTGGTGCAGGGATGGGG + Intergenic
935329492 2:101966189-101966211 CAGGCCCAGACAAAGGGTAGAGG - Intergenic
936437928 2:112523947-112523969 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
938525431 2:132125310-132125332 CAGGCCCTGTTGTGGGGTGGGGG - Intergenic
938782244 2:134595267-134595289 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
938976672 2:136485199-136485221 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
939143019 2:138378008-138378030 CAGGGCCTGTTGAGGGGTGGGGG - Intergenic
939849197 2:147283683-147283705 CAGGGCCTGTTGCGGGGTTGGGG + Intergenic
940634594 2:156283560-156283582 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
943101791 2:183495780-183495802 CTGGCCCACTTGGAGGGCTGTGG + Intergenic
943514561 2:188868242-188868264 CAGGGCCCATTGAGGGGTTGGGG + Intergenic
943766920 2:191673036-191673058 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
943998654 2:194804549-194804571 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
944189174 2:196983015-196983037 CAGGGCCTGTTGGTGGGTTGGGG + Intronic
944439848 2:199731181-199731203 CAGGGCCTGTCGAGGGGTTGGGG + Intergenic
944601267 2:201305922-201305944 CAGGGCCAGTTGTGGGGTGGGGG + Intronic
944879402 2:203996117-203996139 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
945549386 2:211200785-211200807 CAGGGCCTGTTGGAGGGTAGGGG - Intergenic
945865681 2:215172386-215172408 CAGGGCCTGTTGGGGGGTTGGGG - Intergenic
946684230 2:222251257-222251279 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
946902293 2:224384162-224384184 AAGGCCCAGTGGAGGGGCTGTGG - Intronic
946952074 2:224887114-224887136 CAGGACAATTTGAAAGGTTGGGG + Intronic
946960125 2:224976222-224976244 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
947099435 2:226604036-226604058 CTGGCCTATTTGTAGGGTTGTGG - Intergenic
947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG + Intronic
1169821488 20:9715884-9715906 CGGGGCCTGTTGAGGGGTTGGGG + Intronic
1170568747 20:17621242-17621264 AAGGCCAAGTTGAAGGTTCGGGG - Intronic
1171422489 20:25026529-25026551 CAGGTTGACTTGAAGGGTTGGGG - Intronic
1171980947 20:31628426-31628448 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1172866962 20:38107735-38107757 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1172881571 20:38203217-38203239 CAGGCACAGGGGCAGGGTTGTGG - Intergenic
1173235312 20:41239756-41239778 CAGTGCCAGGTGAAGGGTGGAGG - Intronic
1174163589 20:48569114-48569136 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1174171368 20:48620016-48620038 CAGGGCCAGCTGCAGGGTGGGGG + Intergenic
1175555951 20:59856904-59856926 CAGGGCCTGTTGTAGGGTAGGGG + Intergenic
1176231870 20:64037018-64037040 GGGGCCCAGGGGAAGGGTTGGGG + Intronic
1176268027 20:64220820-64220842 CAGGCCCCTATGAAGGGTAGGGG + Intronic
1176268038 20:64220849-64220871 CAGGCCCCTATGAAGGGTGGGGG + Intronic
1176268049 20:64220878-64220900 CAGGCCCCTATGAAGGGTGGGGG + Intronic
1176268060 20:64220907-64220929 CAGGCCCCTATGAAGGGTGGGGG + Intronic
1176909114 21:14541119-14541141 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1177772341 21:25530684-25530706 CAGGGCCTGTTGCAGGGTCGGGG - Intergenic
1178220917 21:30658985-30659007 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1178795815 21:35743326-35743348 CAGGCCCAGGAGAGAGGTTGAGG - Intronic
1178813216 21:35903719-35903741 CAGGGCCTGTTGAGGGGTGGAGG + Intronic
1180057061 21:45364551-45364573 CAGGCCCAGCTGCGGGGTAGAGG + Intergenic
1180106489 21:45622290-45622312 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1180436000 22:15304816-15304838 CAGGCCCTGTTGTGGGGTGGGGG + Intergenic
1180518240 22:16168986-16169008 CAGGCCCTGTTGTGGGGTGGGGG + Intergenic
1181035167 22:20166444-20166466 CAGGTCAAGTTGAATGGTAGAGG - Intergenic
1181286845 22:21758663-21758685 CAGGACCAGTGGAGGGGCTGTGG - Exonic
1182358789 22:29734841-29734863 CAGCCCCATTTGCAGGGCTGGGG - Intronic
1182422977 22:30257526-30257548 CACCTCCAGTTGAAGGGCTGGGG + Intergenic
1182470368 22:30544488-30544510 AAGCCCCAGTTGAGGGGTGGTGG - Intronic
1183216259 22:36482054-36482076 GAGGCACAGTTGAAGGGGCGGGG + Intergenic
1183678041 22:39310753-39310775 CAGGCCCAGCCTAAGGGATGGGG + Intergenic
1183697635 22:39432168-39432190 CATGGCCAGTGGCAGGGTTGTGG + Intronic
1184661939 22:45969447-45969469 CAGGCCAAGAGGAAGGCTTGTGG - Intronic
1184678026 22:46053991-46054013 CAGGCCTCGTTGCGGGGTTGGGG + Exonic
949811077 3:8006748-8006770 GTGGCACAGATGAAGGGTTGTGG + Intergenic
950389082 3:12682550-12682572 CAGGCCCAGTGGAAGGGGCTGGG + Intergenic
950871220 3:16231129-16231151 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
951201082 3:19875899-19875921 CGTCCCCAGTAGAAGGGTTGGGG + Intergenic
951311471 3:21130939-21130961 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
951312862 3:21150535-21150557 CAGGGCCTGTGGAAGGGTGGGGG - Intergenic
951468553 3:23030569-23030591 CGGGGCCTGTTGTAGGGTTGGGG - Intergenic
951485049 3:23202306-23202328 CATGCCCAGTTGAAGGATATGGG - Intergenic
951795123 3:26530281-26530303 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
952986201 3:38786466-38786488 CAGGGCCTGTTGAGGGGTTGGGG + Intronic
954375320 3:50191477-50191499 CAGCCCGATTAGAAGGGTTGGGG + Intergenic
955637797 3:61048963-61048985 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
955832272 3:63016693-63016715 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
955993648 3:64655517-64655539 CAGGTCAAGTTGATGGGATGTGG - Intronic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
956888733 3:73588088-73588110 CAGGGCCTGTTGAGGGGTGGAGG - Intronic
957745292 3:84333272-84333294 CAGGGCCTATTGGAGGGTTGGGG - Intergenic
959006939 3:101030323-101030345 CAGGGCCAGTTGGGGGGTGGGGG - Intergenic
959016207 3:101136727-101136749 AAGGCACAGTTGAAGGGCTTAGG - Intergenic
959351015 3:105263303-105263325 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
959618933 3:108379303-108379325 CAGGGCCTGTTGCAGGGTGGGGG + Intergenic
960015104 3:112878239-112878261 CAGGGCCTGTTGGAGGGTAGGGG + Intergenic
960075602 3:113481570-113481592 CGGGGCCTGTTGGAGGGTTGGGG - Intronic
960127636 3:114017722-114017744 CAGGGCCTGTTGAGGGGTGGAGG + Intronic
960456875 3:117883095-117883117 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
960491800 3:118324414-118324436 CAGGGCCTGTTGAGGGGTTGGGG + Intergenic
962122146 3:132573082-132573104 CGGGGCCAGTTGGAGGGTGGGGG - Intronic
962749108 3:138420093-138420115 CAGGACCAGTTGGAGGGTCTAGG - Intergenic
964648528 3:158985749-158985771 CAGGGCCTGTTGGGGGGTTGGGG - Intronic
965365878 3:167799195-167799217 CGGGGCCTGTTGGAGGGTTGGGG - Intronic
966395521 3:179498919-179498941 CAGGGCCTGTTGAAGAGTTGGGG - Intergenic
970044337 4:11833539-11833561 CAGGCCCTGTTGAGAGGTGGGGG - Intergenic
971971785 4:33630509-33630531 CAGGGCCTGTTGCAGGGTCGGGG + Intergenic
972356922 4:38288132-38288154 CAGGCCCAGTTGAAGGTGAGTGG + Intergenic
972697463 4:41461900-41461922 GAGGCCCTGATGAAGGGCTGTGG - Intronic
973031619 4:45348965-45348987 CAGGGCCTGTTGCAGGGTTGGGG + Intergenic
973328311 4:48886493-48886515 CAGGGCCTGTTGTAGGGTGGGGG - Intronic
973348273 4:49080424-49080446 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
973546109 4:51983517-51983539 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
974444011 4:61955689-61955711 CAGGCCCTGTTGTGGGATTGGGG - Intronic
974504133 4:62746256-62746278 CAGGCCCTGTTGTGGGGTGGGGG + Intergenic
974685730 4:65225661-65225683 TAGGGCTAGTTGAAGTGTTGTGG - Intergenic
975651389 4:76597001-76597023 AAGCCCCAGTTGAAGGGGTGAGG - Intronic
975652097 4:76603735-76603757 CAGGACCTTTTGCAGGGTTGGGG - Intronic
975756345 4:77575449-77575471 CAGGGCCTGTTGAGGGGTAGGGG - Intronic
975959841 4:79889066-79889088 CAGGGCCTGTTGAGGGGTAGGGG - Intergenic
977390104 4:96398009-96398031 TAGGGCCTGTTGAGGGGTTGGGG - Intergenic
977625176 4:99182077-99182099 CAGGGCCTGTTGAAGAGTTGGGG - Intergenic
977701108 4:100023974-100023996 CATGCCCAGATGATGGGTTAAGG + Intergenic
977793535 4:101135057-101135079 CAGGGCCTGTGGAAGGGTGGGGG + Intronic
978076694 4:104539995-104540017 CGGGGCCTGTTGGAGGGTTGGGG - Intergenic
980147264 4:129003272-129003294 CAGGGCCTGTTGTGGGGTTGAGG + Intronic
980285938 4:130778496-130778518 CAGGGCCTGTTGGAGGGTAGGGG + Intergenic
980584769 4:134797457-134797479 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
981340796 4:143619094-143619116 CAGGCCCAGTTAAAGGTCAGTGG - Intronic
981637209 4:146894518-146894540 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
981858334 4:149323129-149323151 CAGGGCCTGTTGAGGGGTTGGGG - Intergenic
981884134 4:149652284-149652306 CAGGGCCTGTTGAGGGGTGGAGG + Intergenic
982295680 4:153826413-153826435 CAGGGCCTGTTGGAGGGTGGGGG - Intergenic
982582866 4:157201486-157201508 CAGGGCCTGTTGCAGGGTTGTGG - Intergenic
982653801 4:158120720-158120742 CAGGGCCTGTGGAGGGGTTGGGG - Intergenic
982949139 4:161666343-161666365 CAAGCCAATTTGAAGGGTTTTGG - Intronic
983508017 4:168576388-168576410 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
985390625 4:189488818-189488840 CAGGGCCTGTTGTAGGGTAGGGG + Intergenic
986119189 5:4815016-4815038 ATGGGCCAGTTGAAGGGTAGAGG - Intergenic
986672971 5:10159337-10159359 CCGGGCCTGTTGAGGGGTTGGGG + Intergenic
987834186 5:23140598-23140620 CAGGACCTGTTTAGGGGTTGGGG - Intergenic
987850113 5:23340874-23340896 CTGGCCCTGTTGGAGGGTGGAGG + Intergenic
988691439 5:33576608-33576630 CAGGCCAAGTGATAGGGTTGCGG + Exonic
989018753 5:36973833-36973855 CAGGGCCTGTTGGAGGGTAGGGG - Intronic
990032465 5:51278366-51278388 CAGGACCTGTTGAGGGGTGGTGG - Intergenic
991088730 5:62672953-62672975 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
991539425 5:67709963-67709985 CAGGGACAGTTGTGGGGTTGGGG + Intergenic
992340912 5:75822604-75822626 CAGGGCCTGTTGGGGGGTTGGGG + Intergenic
992477145 5:77114499-77114521 CAGGGCCTGTTGAGGGGTTGGGG + Intergenic
993611477 5:90059767-90059789 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
993945474 5:94112507-94112529 CAGGCACTGTTGTATGGTTGAGG - Intergenic
994284597 5:97949502-97949524 CAGGGCCTGTTGGGGGGTTGGGG - Intergenic
994517352 5:100787376-100787398 CAGGGCCACTTGGAGGGTTGGGG + Intergenic
995984446 5:118152131-118152153 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
996676773 5:126184415-126184437 CAGGCCCATGTAAAGTGTTGGGG - Intergenic
997114995 5:131117014-131117036 CAGGGCCTGTTGCAGGGTGGGGG - Intergenic
997861134 5:137417957-137417979 CAGGGCCTGTTGTAGGGTAGCGG - Intronic
998411224 5:141913056-141913078 CATGCACAGTTGAAGGGTTAAGG + Intergenic
998541419 5:142985659-142985681 CAGGGCCTGTTGTAGGGTGGGGG - Intronic
998953058 5:147411377-147411399 CAAGCCCAGCTGCAGGCTTGTGG - Intronic
999573284 5:152944881-152944903 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
999953719 5:156677527-156677549 CAGGGCCTGTTGTAGGGTTGGGG + Intronic
1000418146 5:161005751-161005773 CAGGCCCAGTTTCAGCATTGAGG - Intergenic
1000531319 5:162423849-162423871 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1000950595 5:167477420-167477442 CAGGCCCTGTTGGCGGGTGGGGG + Intronic
1001042657 5:168348119-168348141 CAGCCCCATTTGACAGGTTGGGG + Intronic
1002721924 5:181266692-181266714 CAGGCCTGGTTGTAGGTTTGTGG - Intergenic
1002909187 6:1475834-1475856 CAGGGCCTGTTGGGGGGTTGGGG + Intergenic
1003330656 6:5125608-5125630 CAGGCTCAGCTGCAGGCTTGTGG - Intronic
1003686457 6:8308854-8308876 CAGGGCCTGTTGCAGGGTGGAGG - Intergenic
1003739567 6:8920593-8920615 CAGGGCCTGTTGGGGGGTTGGGG + Intergenic
1003803017 6:9692974-9692996 CAGGGCCTGTTGGGGGGTTGGGG - Intronic
1005971965 6:30768793-30768815 CAGGCCTAGCTGTAGGGCTGTGG + Intergenic
1007365180 6:41386389-41386411 CTGGCCCAGGGGAAGGGCTGAGG + Intergenic
1008038344 6:46771093-46771115 CAAGCCCAGCTGACAGGTTGAGG + Intergenic
1009241332 6:61189448-61189470 CAGGGCCTGTTGGGGGGTTGGGG + Intergenic
1009376940 6:62984361-62984383 CAGGGCCTGTTGGAGGGTGGGGG - Intergenic
1009992967 6:70866063-70866085 CATACTCAGTTGAAGAGTTGAGG - Intronic
1010026117 6:71219356-71219378 CAGGGCCTGTTGGGGGGTTGGGG - Intergenic
1010164654 6:72901136-72901158 CAGGCCCTGTTGTGGGGTCGGGG - Intronic
1011640283 6:89411711-89411733 CGGGTCCAGTTGAGGGTTTGGGG - Intronic
1011951364 6:92969303-92969325 CAGGGCCTGTCGAAGGGTCGGGG + Intergenic
1012527468 6:100195605-100195627 CAGGGCCTGTTGTAGGGTGGGGG + Intergenic
1014766978 6:125418045-125418067 CAGGGCCTGTTGAGGGGTAGGGG - Intergenic
1014770707 6:125454924-125454946 CAGGGCCAGTTGATGTTTTGGGG - Intergenic
1015874982 6:137814024-137814046 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1015936135 6:138407490-138407512 CAGGGCCACTTGAAGCCTTGGGG - Intronic
1016148002 6:140700688-140700710 CAGGGCCTGTTGAAGGGTGGGGG - Intergenic
1017065381 6:150524080-150524102 CAGGCCCTCTTGCTGGGTTGGGG - Intergenic
1017724230 6:157265705-157265727 CAGGTCCACTTCAAGGGCTGGGG - Intergenic
1017868242 6:158463484-158463506 CAGGGCCTGTTGTAGGGTGGGGG + Intronic
1018325569 6:162664050-162664072 CAGGGCCTGTTGCAGGGTGGAGG - Intronic
1018816849 6:167339557-167339579 CAGGCCCACTGGAGGGGTTTCGG - Intronic
1019157096 6:170046373-170046395 CAGGCCCAGTGGAAGGCTCCGGG - Intergenic
1020554633 7:9655555-9655577 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1020833512 7:13120978-13121000 CAGGGCCTGTTGAGGGGTGGGGG - Intergenic
1021148268 7:17116860-17116882 CAGGGCCTGTTGAGGGGTGGAGG - Intergenic
1021187595 7:17583350-17583372 CAGGGCCTGTTGGGGGGTTGGGG + Intergenic
1021240059 7:18189330-18189352 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1021738354 7:23660909-23660931 CAGGACCAGTTGGCGGGTTGTGG - Intergenic
1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG + Intronic
1024119668 7:46224006-46224028 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1024715710 7:52077359-52077381 CAGGCCTAGTTAAAGGTTGGTGG - Intergenic
1025728942 7:64092971-64092993 CAGGGCTTGTTGTAGGGTTGGGG + Intronic
1026136774 7:67670278-67670300 CAGGGCCAATTGAGAGGTTGAGG + Intergenic
1027490907 7:78825054-78825076 CAGGGCCTGTTGGAGGGTGGGGG + Intronic
1027551195 7:79598150-79598172 AAGGCCTAGTTGAAGTGTAGGGG - Intergenic
1027744420 7:82055751-82055773 CAGGTCCTGTTGTAGGGTGGGGG + Intronic
1028064737 7:86369276-86369298 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1028526418 7:91791534-91791556 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
1033408067 7:141089848-141089870 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1033433451 7:141310579-141310601 CAGGGCCTGTTGAAGGGTGGGGG - Intronic
1033953574 7:146815912-146815934 CAGGGCCCGTTGTGGGGTTGGGG - Intronic
1037546140 8:19924754-19924776 CAGGGCCTGTTGGAGGGTGGGGG - Intronic
1037615576 8:20516048-20516070 CCGGTCCACTTGCAGGGTTGCGG + Intergenic
1037631964 8:20666199-20666221 CAGAGCCAGTTGAAAAGTTGAGG + Intergenic
1038395723 8:27244125-27244147 CTGGCCCAATTCAAGGGTTAGGG + Intronic
1039126848 8:34213063-34213085 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1039407881 8:37328393-37328415 CAGGCCAAATTGGAGGGCTGAGG - Intergenic
1039472218 8:37820634-37820656 CACGTCCAGTGGGAGGGTTGAGG + Intronic
1039686996 8:39813758-39813780 CAGGGCCTGTTGTGGGGTTGCGG + Intronic
1039755231 8:40515735-40515757 CAGGGCCTGTTGTAGGGTGGTGG - Intergenic
1040436999 8:47400185-47400207 CAGGCCCAGTGAGAGGGTAGGGG + Intronic
1040538934 8:48334097-48334119 CAGGGCCTGTTGTAGGGTCGGGG - Intergenic
1041387660 8:57321102-57321124 CAGGGCCTGTTGCAGGGTTGGGG - Intergenic
1042693933 8:71534740-71534762 CAGGGCCTGTTGCAGGGCTGGGG + Intronic
1042879264 8:73469293-73469315 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1043834799 8:85033871-85033893 CAGGGCCTGTCGGAGGGTTGGGG + Intergenic
1043985411 8:86689714-86689736 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
1045097455 8:98812874-98812896 CAGGGCCTGTTGTAGGGTGGGGG + Intronic
1045742741 8:105381079-105381101 CAGGGCCTGTTGAGGGGTGGGGG - Intronic
1046085838 8:109434087-109434109 CAGGGCCTGTCGAGGGGTTGGGG + Intronic
1046234681 8:111407512-111407534 CAGGGCCTGTTAAAGGGTTGGGG - Intergenic
1047615193 8:126557682-126557704 CAGGGCCAGGCGAAGGGCTGGGG - Intronic
1047991340 8:130289729-130289751 CAGCCCCAGCTAAAGGATTGTGG - Intronic
1048349445 8:133604164-133604186 CAGTCCCAGGTGAGGGATTGGGG - Intergenic
1048602505 8:135933032-135933054 CTGGCCCAGTTAAAGGTATGCGG + Intergenic
1048695792 8:137026380-137026402 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1049082822 8:140456792-140456814 AAGGCCCAGTTGAAAGGTATGGG - Intronic
1049665879 8:143842253-143842275 CAGGGCCAGTTTCAGGGTGGAGG - Intergenic
1050678957 9:8087569-8087591 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1050982833 9:12041811-12041833 CAGGGCCTGTTGGGGGGTTGGGG + Intergenic
1051125462 9:13798499-13798521 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1051819142 9:21144180-21144202 CAGGGCCTGTTGTAGGGTGGGGG + Intergenic
1052416367 9:28183292-28183314 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054991931 9:71337920-71337942 CAGGCCCTGTTGCAGGGTGGGGG + Intronic
1055578596 9:77684922-77684944 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1056190956 9:84183301-84183323 CAGGGCCTGTTGAGGGGTGGGGG + Intergenic
1057683326 9:97211130-97211152 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1058795349 9:108492505-108492527 CAGGGCCTTTTGAGGGGTTGGGG - Intergenic
1059129845 9:111735337-111735359 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
1059745651 9:117198182-117198204 CAGGGCCTGTTGGAGGGTTGGGG - Intronic
1059960556 9:119560306-119560328 CATGCCAAATTGGAGGGTTGGGG - Intergenic
1060198947 9:121640676-121640698 AAGGGCCAGTTGGAGAGTTGGGG - Intronic
1185724585 X:2409428-2409450 CAGGGCCTGTCGAGGGGTTGAGG - Intronic
1186134765 X:6507461-6507483 CAGGCCCAGATGAAGGGTCATGG - Intergenic
1186770373 X:12812227-12812249 CTGGCCCAGTGGAAGGTTAGAGG + Intronic
1187115239 X:16342743-16342765 CAGGGCCTGTTGGAGGGTGGGGG + Intergenic
1187196884 X:17095391-17095413 CAGGCCCAGATGAAGGCATGAGG - Intronic
1187784958 X:22873400-22873422 CAGGGCCTGTTGCAGGGTGGGGG + Intergenic
1188219452 X:27523770-27523792 CAGGCCCTGTTGTGGGGTGGGGG - Intergenic
1188336788 X:28945587-28945609 CAGGGCCAGTTGGAGGGTTGGGG + Intronic
1188928938 X:36080768-36080790 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1188974195 X:36653838-36653860 CAGGGCCTGTTGAGGGGTGGGGG - Intergenic
1189019121 X:37316403-37316425 CAGGCCCACCTGATGGCTTGTGG + Intergenic
1189319788 X:40080772-40080794 CAGGGTCAGATGGAGGGTTGAGG + Intronic
1191090675 X:56617136-56617158 CAGGGCCTGTTGGAGGGTGGGGG - Intergenic
1191575460 X:62699898-62699920 CAGGGCCTGTTGTAGGGTGGGGG + Intergenic
1192063262 X:67853357-67853379 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1192904498 X:75536449-75536471 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1192914896 X:75641487-75641509 CAGGGCCTGTTGAATGGTGGAGG - Intergenic
1192981012 X:76341338-76341360 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1193394766 X:80970481-80970503 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
1193718938 X:84965514-84965536 CAGGGCCTGTTGAGGGGTAGGGG - Intergenic
1193932110 X:87565950-87565972 CAGGGCCTGTTGAGGGGTGGGGG + Intronic
1193934166 X:87595173-87595195 CAGGGCCTGTTGTGGGGTTGGGG - Intronic
1194937166 X:99964716-99964738 CAGGGCCTGTTGTAGGGTAGGGG + Intergenic
1195110932 X:101648454-101648476 CGGGGCCTGTTGTAGGGTTGGGG + Intergenic
1195405299 X:104506127-104506149 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1195947991 X:110235801-110235823 CAGGGCCTGTTGTGGGGTTGGGG + Intronic
1196911723 X:120490480-120490502 CGGGGCCTGTTGAGGGGTTGGGG + Intergenic
1197384990 X:125791440-125791462 CAGGCCCTGTTGTGGGGTCGGGG + Intergenic
1197417658 X:126194539-126194561 CAGGGCCTGTTGTGGGGTTGGGG + Intergenic
1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG + Exonic
1197907064 X:131436846-131436868 CAGGGCCTGTTGTGGGGTTGGGG - Intergenic
1198225962 X:134646196-134646218 CAAGGCCAGGTGAAGGGTGGAGG + Intronic
1198723215 X:139647493-139647515 CAGGCAGAGGTGTAGGGTTGTGG + Intronic
1198755577 X:139978786-139978808 CAGGGCCTGTTGGAAGGTTGGGG + Intergenic
1198984544 X:142434311-142434333 CAGGGCCTGTTGGAGGGTAGGGG + Intergenic
1199451753 X:147985471-147985493 CAGGGCCTGTCGAGGGGTTGGGG - Intronic
1199663543 X:150078548-150078570 CAGGGCCTGTTGTAGGGGTGGGG - Intergenic
1199847013 X:151698910-151698932 CAGGCCCACTTGGGGGGTAGGGG - Intronic
1200088108 X:153620747-153620769 CAGGCCCAGCTGATGGATGGTGG - Intergenic
1201387889 Y:13463019-13463041 CAGGGCCTGTTGTGGGGTTGGGG - Intronic