ID: 947852652

View in Genome Browser
Species Human (GRCh38)
Location 2:233300794-233300816
Sequence CAGGGTAAGCCCTCGGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947852646_947852652 -8 Left 947852646 2:233300779-233300801 CCCATCCAGGGATCCCAGGGTAA No data
Right 947852652 2:233300794-233300816 CAGGGTAAGCCCTCGGTTTGTGG No data
947852642_947852652 -1 Left 947852642 2:233300772-233300794 CCCGAAGCCCATCCAGGGATCCC No data
Right 947852652 2:233300794-233300816 CAGGGTAAGCCCTCGGTTTGTGG No data
947852643_947852652 -2 Left 947852643 2:233300773-233300795 CCGAAGCCCATCCAGGGATCCCA No data
Right 947852652 2:233300794-233300816 CAGGGTAAGCCCTCGGTTTGTGG No data
947852647_947852652 -9 Left 947852647 2:233300780-233300802 CCATCCAGGGATCCCAGGGTAAG No data
Right 947852652 2:233300794-233300816 CAGGGTAAGCCCTCGGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947852652 Original CRISPR CAGGGTAAGCCCTCGGTTTG TGG Intergenic
No off target data available for this crispr