ID: 947855455

View in Genome Browser
Species Human (GRCh38)
Location 2:233320759-233320781
Sequence CAGGCTCTCTTGCAGTTTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947855455_947855457 -9 Left 947855455 2:233320759-233320781 CCACAAAACTGCAAGAGAGCCTG 0: 1
1: 0
2: 0
3: 26
4: 211
Right 947855457 2:233320773-233320795 GAGAGCCTGCTTAAAAAGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 119
947855455_947855462 24 Left 947855455 2:233320759-233320781 CCACAAAACTGCAAGAGAGCCTG 0: 1
1: 0
2: 0
3: 26
4: 211
Right 947855462 2:233320806-233320828 TACCCCTTTCTCCTGACGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 65
947855455_947855461 23 Left 947855455 2:233320759-233320781 CCACAAAACTGCAAGAGAGCCTG 0: 1
1: 0
2: 0
3: 26
4: 211
Right 947855461 2:233320805-233320827 GTACCCCTTTCTCCTGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 68
947855455_947855460 20 Left 947855455 2:233320759-233320781 CCACAAAACTGCAAGAGAGCCTG 0: 1
1: 0
2: 0
3: 26
4: 211
Right 947855460 2:233320802-233320824 CACGTACCCCTTTCTCCTGACGG 0: 1
1: 0
2: 0
3: 3
4: 87
947855455_947855456 -10 Left 947855455 2:233320759-233320781 CCACAAAACTGCAAGAGAGCCTG 0: 1
1: 0
2: 0
3: 26
4: 211
Right 947855456 2:233320772-233320794 AGAGAGCCTGCTTAAAAAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 176
947855455_947855458 -8 Left 947855455 2:233320759-233320781 CCACAAAACTGCAAGAGAGCCTG 0: 1
1: 0
2: 0
3: 26
4: 211
Right 947855458 2:233320774-233320796 AGAGCCTGCTTAAAAAGCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947855455 Original CRISPR CAGGCTCTCTTGCAGTTTTG TGG (reversed) Exonic
903707609 1:25298423-25298445 CAGGCTGAATTGAAGTTTTGAGG - Intronic
903719632 1:25394931-25394953 CAGGCTGAATTGAAGTTTTGAGG + Intronic
907309247 1:53529945-53529967 CAGCCTCTCCTGCAGTTTGAAGG - Exonic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
911958076 1:104263127-104263149 CAGGCTCGCCCGCAGTTTTCCGG - Intergenic
913049848 1:115107952-115107974 CAGGTTTCTTTGCAGTTTTGAGG - Intergenic
916245665 1:162686017-162686039 CAGGCACTCTTACAGATCTGTGG - Intronic
917424666 1:174901747-174901769 CAGACTCTCTGGCTTTTTTGAGG + Intronic
918734940 1:188048566-188048588 CATGCTCTGTTGCTGTTTTCCGG + Intergenic
920455855 1:206100574-206100596 CAGGCTCTGGTGAAGCTTTGGGG - Intronic
920927799 1:210359038-210359060 TATGCTCTCAGGCAGTTTTGTGG + Intronic
922912550 1:229229862-229229884 CAGGCTGTTTTTCAGTGTTGAGG - Intergenic
923084805 1:230695114-230695136 CAGGCTCTCCTGCTGGCTTGGGG - Intergenic
923976804 1:239273236-239273258 CAGGCTCTCTTTTAGATTGGAGG - Intergenic
924741569 1:246797189-246797211 TAGACTCACTTGCAGTTGTGAGG - Intergenic
924927519 1:248697399-248697421 CAGGCTCTCTACTAGCTTTGAGG + Intergenic
1063813815 10:9746951-9746973 CAGGTTATCTTGCAGTGTTAAGG + Intergenic
1063825683 10:9895458-9895480 CAGACTATGTTGCAGTTCTGAGG + Intergenic
1063985240 10:11494912-11494934 CAGGCTCGCCTGCAGTTATCCGG - Intronic
1064018804 10:11793142-11793164 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
1064930596 10:20621407-20621429 AAGTCTCTCTGGCCGTTTTGTGG - Intergenic
1064951246 10:20853475-20853497 CAGGATCTCGTTCATTTTTGTGG - Intronic
1065280434 10:24132222-24132244 CAGCCTCCCTTGCAGTTAGGTGG - Intronic
1067051795 10:43025659-43025681 CAGTCTCTCTTGATGTGTTGTGG + Intergenic
1068782590 10:60937570-60937592 AAGCTTCTCTTGCAGATTTGTGG - Intronic
1069427899 10:68305787-68305809 CAGGCTCTCTGGGAGTTGGGGGG - Intronic
1070193133 10:74131065-74131087 CAGGCTGTAGTGCAGTGTTGTGG - Intronic
1070818386 10:79339662-79339684 GAGGGTCTCTTGCAGGTTGGGGG + Intergenic
1072002992 10:91216227-91216249 GAGGCTCTTTGGCAGCTTTGAGG + Intronic
1072343856 10:94482973-94482995 CAGGCTCTCATTCCTTTTTGTGG + Intronic
1073454842 10:103630189-103630211 CATGCCCTCTGGCTGTTTTGGGG - Intronic
1076449537 10:130547156-130547178 GAGGATCTCCTGCAGTTGTGCGG + Intergenic
1081290469 11:41319073-41319095 CATGTTCTCTGGCAGTCTTGAGG + Intronic
1084171470 11:67403115-67403137 CAGGCCCACTTCCAGTTCTGAGG - Intronic
1088191155 11:107229515-107229537 CAGGCACTCTTCCAGGTTTGGGG + Intergenic
1088628180 11:111748271-111748293 CCTGCTCTTTTGCAGTGTTGTGG - Intronic
1088770660 11:113032541-113032563 CAGGCTCCCTTGCAGGTAAGTGG - Intronic
1094830903 12:34299808-34299830 CAGGCCTTCTTGCGGCTTTGGGG - Intergenic
1095670825 12:44858015-44858037 CATGCTCCCTTGGACTTTTGAGG - Intronic
1098935105 12:76469834-76469856 CAGGCTCTGTTCTAGTTTTAAGG - Intronic
1100138431 12:91585423-91585445 CAGTCTCTCTTGCAGTTAGCTGG - Intergenic
1100350188 12:93773860-93773882 CAGGCTCTAGTGCAGTGGTGTGG + Intronic
1104340958 12:127948001-127948023 CAGGCTCCCTTGCTGTTGTGTGG + Intergenic
1104873660 12:132017958-132017980 CAGGCTTTCTTGGCGTTGTGTGG + Intronic
1104874901 12:132026976-132026998 CTTGCTCTGTTGCAGTTGTGAGG + Intronic
1106170379 13:27283441-27283463 CAGGCTCCCTTCCTGTTTTTTGG + Intergenic
1106539532 13:30677484-30677506 CAGGCCCTGCTGCAGTGTTGGGG - Intergenic
1108915775 13:55609251-55609273 AAGGCTCTCTTTAAGTTTTGGGG + Intergenic
1109663984 13:65505670-65505692 CAGGCTCTCTTTCTGTGTTGAGG + Intergenic
1110277260 13:73653963-73653985 GAGCCTCTCTTTCAGCTTTGAGG + Intergenic
1111845399 13:93501585-93501607 AAGGCACTCTATCAGTTTTGTGG - Intronic
1111955162 13:94749302-94749324 GAAACTTTCTTGCAGTTTTGAGG + Intergenic
1112462452 13:99614638-99614660 CTGGCTCTGTTGCAGCTGTGTGG + Intronic
1113880322 13:113621845-113621867 CAGGCTCGCCTGCAGTTATCTGG + Intronic
1116549739 14:46221670-46221692 CAGGATCTTTTGTATTTTTGTGG - Intergenic
1119529475 14:75349622-75349644 CAGCCTCTCTTGTAGTTTGCTGG + Intergenic
1119723249 14:76905893-76905915 CAGGCTGTGTTTCAGTTGTGTGG + Intergenic
1120386046 14:83847243-83847265 CATGCTCTCTTTCAGACTTGTGG - Intergenic
1120442034 14:84553748-84553770 CAGGCTCTGTTGCAGTGGTTGGG - Intergenic
1124401768 15:29354746-29354768 CAGTCTCTCTTTCTGTTTTGGGG - Intronic
1124602186 15:31143708-31143730 CAGCCTGTCTTCCAGTTTTAAGG + Intronic
1125294020 15:38183128-38183150 CAAGCTCTCTTGCAGTCAGGTGG - Intergenic
1126905011 15:53355445-53355467 CAACCTCCCTTGCAGTTTTTAGG - Intergenic
1127162802 15:56207930-56207952 CAGATTCTCATGCAGGTTTGTGG - Intronic
1127397989 15:58558394-58558416 CAGCCTCTTTTGCTGTCTTGAGG + Intronic
1131360116 15:91783339-91783361 CTGGCTCTCTTCCACTTTAGTGG + Intergenic
1132117261 15:99146535-99146557 GAGGCTCTCTAGCGGTTTTTCGG - Intronic
1134839624 16:17391413-17391435 CAGTCTCTCTGGAAATTTTGAGG - Intronic
1135681482 16:24460962-24460984 CAGGCTGTCTGGTTGTTTTGGGG - Intergenic
1135706929 16:24683154-24683176 AAGGCTCTCCTGCAGTTTTTTGG + Intergenic
1136663540 16:31787493-31787515 GAGGATCTCTTGCATTTCTGTGG + Intronic
1138017552 16:53443916-53443938 CTAGCTCACTTACAGTTTTGGGG + Intronic
1139227315 16:65245299-65245321 CAGGCTACCTTGCAGATTTTTGG + Intergenic
1146437920 17:32868575-32868597 CTAGCTCTCTAGCAGTTATGGGG + Intronic
1147132432 17:38417491-38417513 CAGGTTCTCTTTCAGTGCTGAGG - Intergenic
1148069871 17:44902449-44902471 CAGGCTCTACTGCAGCTTGGGGG + Exonic
1148519457 17:48257087-48257109 TAGGCTCTCATACAGTTGTGAGG - Intronic
1149120815 17:53161817-53161839 CAAGCTGTCTTGCATTTGTGTGG + Intergenic
1149291316 17:55220367-55220389 CAGCTTCTCCTGCAGTTTTAAGG + Intergenic
1149866676 17:60154942-60154964 CAGCCTCTTTTCCAGGTTTGGGG + Intronic
1150088699 17:62300122-62300144 CAGGCTCTGTTTCAGTACTGGGG - Intergenic
1151255097 17:72870644-72870666 CACGCTCTCCTGCAGATTTGTGG + Intronic
1151445702 17:74162127-74162149 CAGGCTTTCTTTTAGTTTTCTGG - Intergenic
1157993844 18:52530906-52530928 AAGGCTTTCTTGCTATTTTGAGG - Intronic
1159630699 18:70746301-70746323 TAGGCTCTCTTGGGGTTTTCTGG - Intergenic
1161894076 19:7067136-7067158 CAGGCTCGCCTGCAGTTATCTGG - Intergenic
1162333384 19:10044606-10044628 CAGCCTCTCTTGCACTTAGGTGG - Intergenic
1166971907 19:46574530-46574552 TTTGCTCTCTTGCAGTTCTGAGG + Intronic
1167519043 19:49941395-49941417 CAGGCTCGCCTGCAGTTATCCGG + Intronic
927131514 2:20064345-20064367 CAGGCTCACTTCCAGGTCTGAGG + Intergenic
927452073 2:23217319-23217341 CAGCCTCTCTTGCAGTTAGATGG - Intergenic
927641631 2:24849208-24849230 CAGGCTCTCTTGGAACCTTGGGG + Intronic
927879063 2:26677713-26677735 CAGCCTCTCTTGCAGCTAGGTGG + Intergenic
928273359 2:29877019-29877041 TAAGCTCTCTTCCAGTTTGGAGG - Intronic
928467538 2:31536514-31536536 CAGCCTCCCTTGCAGTTGGGTGG - Intronic
930837376 2:55808621-55808643 CAGGCTCCCTTGCAGTCTGGGGG - Intergenic
931998189 2:67858999-67859021 CAGGCTCTCTTGCATTCTCCAGG + Intergenic
933395423 2:81725041-81725063 CAAGCTCTCTCTCACTTTTGGGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936716709 2:115195012-115195034 CAGTGTCTTTTGCAGATTTGGGG + Intronic
937665160 2:124478769-124478791 CAGACTCTCTTACAGTTATTAGG + Intronic
940089175 2:149896920-149896942 GAAGCTTTCTTTCAGTTTTGGGG + Intergenic
947855455 2:233320759-233320781 CAGGCTCTCTTGCAGTTTTGTGG - Exonic
1170328940 20:15187060-15187082 CTGGCTCTTTGGCAGTTTGGTGG - Intronic
1170633973 20:18088817-18088839 CAGGCTGTCTTCCACTTTTAAGG + Intergenic
1170725543 20:18923081-18923103 CAGACTCCCTTGCAGTTAGGAGG - Intergenic
1170915393 20:20619269-20619291 CAGGCTTTGTTGCAGGTATGTGG - Exonic
1176458298 21:6932054-6932076 CAGTCTCCCTTGCAGTTAGGTGG - Intergenic
1176836472 21:13797148-13797170 CAGTCTCCCTTGCAGTTAGGTGG - Intergenic
1176869378 21:14073599-14073621 GGGGCTTTCTTGCAGCTTTGGGG + Intergenic
1177554248 21:22669314-22669336 GAAAGTCTCTTGCAGTTTTGCGG - Intergenic
1177675430 21:24292297-24292319 CAGGCTCTCTTCCAGTTCCCAGG + Intergenic
1179436245 21:41364023-41364045 CAGGCTCTCTTGAGAATTTGGGG + Intronic
1179769867 21:43606454-43606476 CAGGAGGTCTTGCAGTTTAGAGG + Intronic
1181545797 22:23601736-23601758 CAGCTTCTCATGCAGTTGTGAGG - Intergenic
1181640929 22:24198080-24198102 CAGGCTCTGTTGTAGGTTGGTGG - Intergenic
1184383641 22:44161903-44161925 CAGGCTGTCCTGCAGGGTTGGGG + Intronic
1184858854 22:47161897-47161919 CCGGCGCTCTTGCATTTTTCGGG + Intronic
949702361 3:6773997-6774019 CTGGGTCTCTTGCTGGTTTGAGG - Intronic
950191332 3:10978458-10978480 CTGTTTCTCTGGCAGTTTTGGGG - Intergenic
951202409 3:19890084-19890106 CAGCATCTGTTTCAGTTTTGGGG - Intronic
951731896 3:25818963-25818985 CAGGCTCTGTTGGATTTTTCAGG + Intergenic
953607950 3:44424174-44424196 CAGGCACACTTCCAGTTTTGGGG - Intergenic
954099438 3:48358014-48358036 CAGGCATTCTTGCACTCTTGGGG - Intergenic
954269102 3:49493559-49493581 GAGGATCCCTTGAAGTTTTGAGG + Intronic
954973578 3:54672263-54672285 CTGGCTGCTTTGCAGTTTTGGGG + Intronic
955088928 3:55730331-55730353 CAGACTCTCTGGCAGTGCTGGGG - Intronic
956697557 3:71931385-71931407 CAGCCTCTCTTGCAGATAGGTGG + Intergenic
956883706 3:73537090-73537112 CAGCCTCTCTTGCAGTTGGCTGG + Intronic
958823660 3:99004266-99004288 GAGGATCTTTTGCATTTTTGTGG + Intergenic
961147775 3:124609676-124609698 CTGGCTGTCTTGCAGGCTTGAGG + Intronic
963126036 3:141817596-141817618 CAGTTTCTTTTGCAATTTTGTGG + Exonic
963544337 3:146636474-146636496 GAAGCTCTCTTGTTGTTTTGAGG + Intergenic
964767363 3:160191677-160191699 CAGGCTCACCTGCAGTTCTAGGG - Intergenic
966006408 3:175018761-175018783 CATGCTCTTTTGCAGTGTTGTGG - Intronic
968050847 3:195654004-195654026 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
968104977 3:195994334-195994356 CAGGCTCGCCTGCAGTTATCCGG - Intergenic
968209583 3:196837483-196837505 TAGACTCTCTTGCAGCTATGAGG - Intergenic
968303272 3:197631921-197631943 CAGGCTCGCCTGCAGTTATCCGG - Intergenic
968332362 3:197882076-197882098 CAGGCTCTCATGTGGTTTAGGGG + Intronic
970177302 4:13352346-13352368 CAGGCTTCCTTGCAGTTAGGAGG + Intergenic
970563677 4:17309621-17309643 AACGCTTTCTTGAAGTTTTGGGG - Intergenic
970687180 4:18581746-18581768 TAGCCTCTCTTGAAGTTTTGTGG - Intergenic
971033249 4:22664151-22664173 CAGGCTCTCTCGAAATTTTATGG + Intergenic
971067253 4:23047338-23047360 CACGTTCTCCTGTAGTTTTGAGG + Intergenic
972072498 4:35038727-35038749 CAGGCATTCCTGCAGTCTTGGGG + Intergenic
972931140 4:44072461-44072483 CAGGCATCCTTGCACTTTTGGGG - Intergenic
973531901 4:51843510-51843532 CTGGCTCTCTTTCAGTGTTGGGG + Intronic
974611946 4:64229083-64229105 CAGGCTCTCTAGCTTTTTTGGGG + Intergenic
977441614 4:97075066-97075088 CAGGCTTTATTACAGTCTTGCGG + Intergenic
981453305 4:144924438-144924460 CAGGATCTCTTTCTTTTTTGTGG + Intergenic
983956871 4:173708404-173708426 CAGAATTTCCTGCAGTTTTGAGG + Intergenic
984312975 4:178087235-178087257 TAGGTTCTCTTCCAGTTTTGTGG + Intergenic
985665394 5:1179405-1179427 CTGCCTCTCCTGCAGTCTTGAGG - Intergenic
986171206 5:5316217-5316239 CATACTCTCTTGTAGGTTTGGGG + Intronic
987422198 5:17733846-17733868 CAGGTACTCTTGCACTTTTGAGG + Intergenic
992202625 5:74399286-74399308 CAGGCTCTCTTGCAGTTGGCTGG + Intergenic
992762133 5:79959974-79959996 CAGTTTCCCTTGCAGTTTTCTGG - Intergenic
992803578 5:80315221-80315243 CATGTTCTCATGGAGTTTTGGGG - Intergenic
995619941 5:114014107-114014129 CAGTCTGTTGTGCAGTTTTGGGG - Intergenic
998139018 5:139689668-139689690 CAGCCCCTCTTCCAGCTTTGAGG + Intergenic
999267138 5:150274039-150274061 CAGGCACTCTTGCATTCTAGTGG - Intronic
1000602747 5:163294903-163294925 CAAGCTTTATTTCAGTTTTGGGG - Intergenic
1000702761 5:164473722-164473744 CAGGCTCCCTTGCCATTTTTGGG + Intergenic
1001066556 5:168539357-168539379 CTGGCTCCCTTGCAGTTGAGAGG - Intergenic
1001406022 5:171478197-171478219 CAGCCTCCCTTGCAGTTAAGTGG + Intergenic
1004101277 6:12614630-12614652 CTTGCTGTCTTGCAGTCTTGTGG - Intergenic
1004150257 6:13112201-13112223 CATGATCTCTTTCTGTTTTGTGG + Intronic
1004647334 6:17574845-17574867 CAGCCTCTCTTGCAGTTGGATGG + Intergenic
1005329558 6:24736491-24736513 CATGCTCTCTTGGAGTTCTAAGG - Intergenic
1006702562 6:35987774-35987796 CAGTCTCTCTTGCAATTAGGAGG - Intronic
1007727183 6:43923675-43923697 TGGGCTCTCTTGCAGGTTTGAGG + Intergenic
1007921277 6:45611815-45611837 CAGGCTCTGTTGAAGCTTGGGGG - Intronic
1008260840 6:49365429-49365451 CAGCCTCTCTTGCATCTATGTGG + Intergenic
1010159442 6:72834912-72834934 CTGGCTCAATTTCAGTTTTGTGG - Intronic
1010598567 6:77795608-77795630 CAGGATTTTTTGCATTTTTGTGG - Intronic
1012548057 6:100441852-100441874 AAGCCTATCTTGAAGTTTTGTGG + Intronic
1014883709 6:126753978-126754000 CTAGCGGTCTTGCAGTTTTGGGG + Intergenic
1015583622 6:134753573-134753595 CAGCCTCTCTTGCAGTTAGGCGG + Intergenic
1015770238 6:136761331-136761353 CATGCACTCTTGCATTTTAGTGG - Intronic
1017065381 6:150524080-150524102 CAGGCCCTCTTGCTGGGTTGGGG - Intergenic
1017181079 6:151552723-151552745 CAGGCTTTCTTGCAATATTCAGG + Intronic
1018455304 6:163946454-163946476 CAGACTCTCTTTGTGTTTTGAGG + Intergenic
1018750380 6:166798967-166798989 GGGGCTCTCTTTCAATTTTGTGG - Intronic
1019701644 7:2477168-2477190 CAGGCTGTCGGGCAGCTTTGGGG + Intergenic
1019897992 7:3997980-3998002 CAGGCATTCTTGCACTCTTGGGG - Intronic
1021441271 7:20679792-20679814 ATGGCTCTCTTGCACTATTGGGG + Intronic
1021656780 7:22881051-22881073 CAGGCACTGTTTCAGTGTTGGGG - Intergenic
1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG + Intronic
1024107295 7:46105875-46105897 CAGTTTTTCTTGCTGTTTTGAGG - Intergenic
1025972275 7:66338165-66338187 TAGGCTCTCTTGCTCTTTTTTGG - Intronic
1026486933 7:70829895-70829917 CAGGCTCACTTGCAATATGGGGG + Intergenic
1033166717 7:139045285-139045307 CTGGCTTCCTTTCAGTTTTGTGG - Exonic
1033801738 7:144909574-144909596 CAGGTTCTTTTGCGGTTCTGGGG - Intergenic
1034329615 7:150270906-150270928 CAGGAACTCTTGCTGTTCTGGGG + Intronic
1034668440 7:152838956-152838978 CAGGAACTCTTGCTGTTCTGGGG - Intronic
1035063278 7:156085642-156085664 CATGCTCTCTTGGAGATCTGTGG - Intergenic
1035331064 7:158097856-158097878 CAGACTCTCCTGCGGTTTTGTGG - Intronic
1037479985 8:19295536-19295558 CTGGCTATCTGGCTGTTTTGGGG + Intergenic
1038651384 8:29406927-29406949 CAGGATCCCTTGCAGTTAGGTGG - Intergenic
1038871422 8:31498449-31498471 CTGGCTCTCATACAGTTTTTAGG + Intergenic
1039218082 8:35295997-35296019 CAGGATTTCTTGCTTTTTTGTGG + Intronic
1040466243 8:47697858-47697880 CATGCTCTCTGGCAGTCTTGTGG + Intronic
1041254558 8:55968764-55968786 GAGGCTATATTACAGTTTTGGGG - Intronic
1041340653 8:56842128-56842150 AAGGCACTCTTGCAGTTTCCTGG - Intergenic
1042618906 8:70682733-70682755 CAGGCTTTCTGGTAGTCTTGTGG - Intronic
1043103391 8:76076724-76076746 CAGCATCTCTTGCATTTTTGAGG + Intergenic
1044046878 8:87447037-87447059 TAGACTTTCTAGCAGTTTTGTGG - Intronic
1044806528 8:96013798-96013820 CAGGCTCTCATGGAAGTTTGGGG + Intergenic
1045289071 8:100816346-100816368 CAGGCTCCCTTGCAGCTGTGTGG - Intergenic
1045501213 8:102745674-102745696 CAGACCCTCTTGGAGTCTTGAGG - Intergenic
1049297233 8:141848654-141848676 CAGCCTCCCTTGCAGCTTGGTGG - Intergenic
1049666223 8:143844322-143844344 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
1050233482 9:3554089-3554111 CAGGCTCCCTTGCTGTTTGAGGG + Intergenic
1051077665 9:13259664-13259686 CATGCACTCTTGCATTTATGTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053111813 9:35467430-35467452 CAAGCTCTCTTGCAGTTATATGG - Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1057479925 9:95436860-95436882 CAGGCTCTCTTCTAGATTTTGGG + Intergenic
1059064800 9:111072036-111072058 CAGGCTCTCCTGAAGTTGTGAGG - Intergenic
1060513689 9:124252341-124252363 CAGCCTCTCTTGCAGGATTGGGG - Intergenic
1060779863 9:126403408-126403430 CAGGCTTTCTAGCAGTGATGTGG - Intronic
1061179369 9:129014681-129014703 CAGGCTCTCTTCCAGTGCTGGGG - Intronic
1186611261 X:11140100-11140122 CAGCCTCTCTGGCAGTTAGGAGG + Intronic
1189304987 X:39980105-39980127 CAGCCACTCTTGCTCTTTTGTGG - Intergenic
1192003538 X:67183363-67183385 AAGACTCTCTTGAAGTTTTCTGG + Intergenic
1194925830 X:99821936-99821958 CAGGATCTCATTCATTTTTGTGG - Intergenic
1195312858 X:103650124-103650146 CAGGATCTCATTCTGTTTTGTGG - Intergenic
1195892759 X:109713238-109713260 CAGGCTCTCTTGCAGAGCTTAGG + Intronic
1197297116 X:124732552-124732574 CAGGCTGTGTTTCAGTTTTTTGG - Intronic
1199423174 X:147670223-147670245 CAGGCTTTCTTTCAGATTTTTGG - Intergenic
1200206110 X:154317550-154317572 CTGGTTCTCTTGCAGTTTGCTGG + Intronic
1201970235 Y:19784746-19784768 GAGGCTCTTTTGTACTTTTGTGG - Intergenic