ID: 947855477

View in Genome Browser
Species Human (GRCh38)
Location 2:233320862-233320884
Sequence GCAGCACCTTATCATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947855466_947855477 22 Left 947855466 2:233320817-233320839 CCTGACGGTGGGTGACTCCTCCG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 103
947855465_947855477 29 Left 947855465 2:233320810-233320832 CCTTTCTCCTGACGGTGGGTGAC 0: 1
1: 0
2: 0
3: 15
4: 118
Right 947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 103
947855468_947855477 5 Left 947855468 2:233320834-233320856 CCTCCGGCCAGCCCTGCTTCCTT 0: 1
1: 0
2: 7
3: 58
4: 534
Right 947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 103
947855472_947855477 -7 Left 947855472 2:233320846-233320868 CCTGCTTCCTTCACCCGCAGCAC 0: 1
1: 0
2: 4
3: 20
4: 254
Right 947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 103
947855470_947855477 -2 Left 947855470 2:233320841-233320863 CCAGCCCTGCTTCCTTCACCCGC 0: 1
1: 0
2: 2
3: 53
4: 606
Right 947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 103
947855471_947855477 -6 Left 947855471 2:233320845-233320867 CCCTGCTTCCTTCACCCGCAGCA 0: 1
1: 0
2: 0
3: 24
4: 264
Right 947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 103
947855464_947855477 30 Left 947855464 2:233320809-233320831 CCCTTTCTCCTGACGGTGGGTGA 0: 1
1: 0
2: 2
3: 13
4: 131
Right 947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 103
947855469_947855477 2 Left 947855469 2:233320837-233320859 CCGGCCAGCCCTGCTTCCTTCAC 0: 1
1: 1
2: 9
3: 90
4: 972
Right 947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947855477 Original CRISPR GCAGCACCTTATCATGTGGA TGG Intronic
908993808 1:70127754-70127776 GCAGCACCTCAAAAGGTGGAAGG + Intronic
914442893 1:147722612-147722634 GCAGGACCTTGTCAAATGGAAGG + Intergenic
916258396 1:162814503-162814525 GCAGCATCTGATCAAGTGGGAGG + Intergenic
917159328 1:172040054-172040076 AGAGGACCTTGTCATGTGGAAGG + Intronic
920415567 1:205797151-205797173 GCAGCACCTAATCCTGTCAAGGG - Intronic
920987956 1:210908351-210908373 CCAGCACCTTAACAAGTGGAAGG - Intronic
922043170 1:221916990-221917012 GCAGCACCATGTCATGTGGAAGG + Intergenic
923223170 1:231914694-231914716 TCTCCAACTTATCATGTGGAGGG + Intronic
924013915 1:239698800-239698822 GCAGATCCTGGTCATGTGGAGGG - Intronic
1065063654 10:21935727-21935749 GAAGCAACTTATCATGTATAAGG + Intronic
1066724838 10:38380186-38380208 GCAGCATCTGATCAAGTGGGAGG + Intergenic
1067763831 10:49070537-49070559 GGGGCACCTTCTCATGTGCAGGG - Intronic
1069623275 10:69850946-69850968 GCAGCACCCTAGCATCTGAAGGG + Intronic
1076566453 10:131402878-131402900 GTAGCATCTTAACATGGGGATGG + Intergenic
1077266904 11:1655367-1655389 GCAGCACCTCATTCTGTGGTTGG - Intergenic
1077886105 11:6389517-6389539 CTAGCACATTATCATGTGAAGGG + Intergenic
1078018656 11:7637155-7637177 ACATCACCTTCTCATGTGCATGG + Intronic
1078955146 11:16185420-16185442 GCAGCACTTTATCATTTAGGAGG - Intronic
1082852589 11:57778606-57778628 TCAGCTCCTTATCATGTTCAGGG - Intronic
1083323874 11:61863586-61863608 GCAGGACGGTATGATGTGGACGG + Intronic
1083544283 11:63537535-63537557 GCACCACCTGATCCTGGGGAAGG + Intronic
1084085898 11:66855136-66855158 GCATCACCGAGTCATGTGGAGGG + Intronic
1089307366 11:117535154-117535176 GCATCACCTTGTCATGGGGATGG + Intronic
1090335681 11:125961918-125961940 GTAGCACCTTATCCTCAGGATGG - Exonic
1091443124 12:527175-527197 CCAGCACTTTAGCAGGTGGAGGG - Intronic
1093357322 12:18181936-18181958 GCAGTACCTAATGATGTGTAGGG + Intronic
1103527388 12:121577894-121577916 GCGTCACCTTAACATCTGGAGGG + Intronic
1108322226 13:49300562-49300584 GGAGCACCTTCCCATGGGGAGGG - Intergenic
1109402755 13:61857070-61857092 GCATCAATTTATCATGAGGATGG + Intergenic
1109988526 13:70021741-70021763 GAAGCACCTTTTCATTTGGTTGG + Intronic
1110565051 13:76949559-76949581 GCAGCACGGTCTCATATGGATGG + Intronic
1113672582 13:112185060-112185082 GCAGCCCCTGATGATGAGGAAGG + Intergenic
1115409201 14:33053213-33053235 GAAGCAACTTATCATGAGAATGG - Intronic
1119751117 14:77078130-77078152 TCAGGACCTAATCATGTGGCAGG - Intergenic
1119994086 14:79232841-79232863 GTAGCACCTCATCAAGTGCAGGG + Intronic
1120666051 14:87308130-87308152 ACAGCACCTATTCATCTGGATGG - Intergenic
1124116718 15:26850318-26850340 GCAGCACCTTTCCTTGAGGAAGG + Intronic
1127846264 15:62874187-62874209 ACTGCACCTTCACATGTGGAAGG - Intergenic
1131499021 15:92942931-92942953 CCAGTACCTCATCAAGTGGAAGG + Exonic
1131878762 15:96839568-96839590 GGAGCACCTTTTCATGTGTGTGG - Intergenic
1132286210 15:100664707-100664729 GAAGCACCTGGCCATGTGGAAGG - Intergenic
1136657433 16:31718544-31718566 GCAGCACCTTAGCAGAGGGAGGG + Intronic
1136673731 16:31880320-31880342 GCAGCACCTTAGCAGAGGGAGGG + Intronic
1137839139 16:51623850-51623872 TCAGTAACTTAACATGTGGAAGG + Intergenic
1139787797 16:69407921-69407943 GGAGCACCCTCCCATGTGGAGGG - Intronic
1139832314 16:69810056-69810078 GCAGCATCTTTTCCTGGGGAAGG + Intronic
1140107862 16:71977242-71977264 GCCACACCTTATCCTTTGGAAGG + Exonic
1141833210 16:86521382-86521404 GCAGCACTTCTTCATGTGAATGG - Intergenic
1144513182 17:15895128-15895150 GGACCATCTAATCATGTGGATGG - Intergenic
1146479576 17:33194016-33194038 GCAGCACCTTGGCAGGGGGAGGG + Intronic
1150008789 17:61486495-61486517 GCAGACCCTTTTCATGTGGCAGG - Intergenic
1153464750 18:5376933-5376955 GCAGCACCTTCTCATTTAGTTGG + Intergenic
1153602878 18:6799051-6799073 GCAGAACCTTTTCATCTGGTAGG + Intronic
1156095145 18:33521842-33521864 GCAGGGTCTTATTATGTGGACGG + Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
927447563 2:23177869-23177891 GGAGCAACTTTTCATGTGCAAGG - Intergenic
930402571 2:50908876-50908898 GCTGCATCATAACATGTGGAGGG - Intronic
931135393 2:59394041-59394063 GCAGCACCGTACGATGTGTAAGG + Intergenic
934581073 2:95439181-95439203 GCAGAACCCTATCATATGGAGGG - Intergenic
934598377 2:95637533-95637555 GCAGAACCCTATCATATGGAGGG + Intergenic
938102976 2:128511100-128511122 GCAGCACATTGGCATGTGGTGGG - Intergenic
939960562 2:148561652-148561674 GCTGCCCCTTACCTTGTGGATGG - Intergenic
947712589 2:232324579-232324601 TCAGCACTTTATCAGGTGCATGG + Intronic
947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG + Intronic
948841261 2:240650628-240650650 GCAGCACCCTTTCCTGTGGGAGG + Intergenic
1169206360 20:3742393-3742415 ACCTCACCTCATCATGTGGATGG - Exonic
1171542651 20:25976347-25976369 GCAGGACCTGACCATGTAGATGG + Intergenic
1172416834 20:34776128-34776150 GCAGCACCTTAGGATGAAGAGGG - Intronic
1172578342 20:36026879-36026901 GAAGCACTTAATCAGGTGGAAGG - Intronic
1172764623 20:37345034-37345056 GGAGCACCCTAGAATGTGGAAGG - Intronic
1182429968 22:30293616-30293638 CCTGCCCCTTATCATGGGGAGGG - Intronic
950038331 3:9903054-9903076 GCAGCACCTTACCGTGTGGGAGG - Exonic
955745886 3:62140137-62140159 GCAGCACCATATCCTGGGGCCGG - Intronic
962426396 3:135272506-135272528 GCACAGCCTTGTCATGTGGAAGG + Intergenic
962611905 3:137084752-137084774 GCAGCTCCTCTTCATGTGCAGGG - Intergenic
963074955 3:141337327-141337349 ACAGCATTTTATCATGTTGATGG + Intronic
968072031 3:195790042-195790064 GCAGCACCTGTTGATGTTGAGGG + Exonic
968505615 4:970030-970052 GCGGCCCCTCGTCATGTGGACGG - Intronic
968942805 4:3647798-3647820 GCAACAGCTTGGCATGTGGAAGG + Intergenic
971171355 4:24236417-24236439 GCAGTACCTTAAGATGTGCATGG + Intergenic
971287838 4:25307616-25307638 GCAGCTCCTTAAGATGTGGATGG + Intergenic
972559333 4:40212872-40212894 GGGGATCCTTATCATGTGGATGG + Intronic
981230087 4:142342518-142342540 GCAGCACTTTATGTTGAGGATGG + Intronic
989707742 5:44357935-44357957 GCATCATCTTATAATGTGGTGGG - Intronic
991133175 5:63149977-63149999 GCAGAAAATTAGCATGTGGAAGG - Intergenic
992715911 5:79511139-79511161 GCAGCAGTTTTTCATGTTGATGG - Intronic
995399859 5:111728743-111728765 TCATCACCTTATCATCTGGTAGG + Intronic
996086436 5:119310230-119310252 GTAGTACCTCATCTTGTGGAGGG - Intronic
997367450 5:133335102-133335124 GCACCACCTCCTCATGTTGAAGG + Intronic
997697760 5:135874746-135874768 GCAGCACCTTTTCAGGTGGTGGG - Intronic
998701415 5:144704527-144704549 ACTGCACCTCATCATGTGCAAGG + Intergenic
1001105402 5:168849260-168849282 CCAGCATCTCATCAGGTGGATGG + Intronic
1001380436 5:171302791-171302813 TCAGCTCCTTATGATGAGGAGGG + Intergenic
1002468525 5:179420738-179420760 GCAGCACCGTGTCCTGTGGGTGG + Intergenic
1012991421 6:105930275-105930297 GCAGCACAGAATCATATGGATGG - Intergenic
1016321911 6:142855414-142855436 GCACCATCTTATCATTAGGAAGG + Intronic
1018656675 6:166043367-166043389 GCTGGACCCTATCATGTTGAAGG + Intergenic
1018662713 6:166103033-166103055 GAAGCTTCTAATCATGTGGAAGG + Intergenic
1026495843 7:70902393-70902415 AAAGCAACTTATCATGTAGAAGG - Intergenic
1028088220 7:86664053-86664075 GCAGCACTATATTATGTTGAGGG + Intronic
1028287719 7:89023964-89023986 GCAGCACCCTGCCAAGTGGAAGG + Intronic
1033319646 7:140328049-140328071 GCAGCAGTTTATCAAGTGGATGG + Intronic
1035467840 7:159091355-159091377 GCAGCGCCTTATCCCATGGATGG + Intronic
1043294830 8:78649598-78649620 ACAGCTCCTTATCATCAGGAGGG - Intergenic
1044446223 8:92280009-92280031 GAAGGACCCTATCATCTGGAGGG + Intergenic
1050406505 9:5314281-5314303 GCAGCAGCTCAGCTTGTGGATGG - Intergenic
1051106517 9:13587085-13587107 GCAGTACATTATAATGTGGGGGG - Intergenic
1056930068 9:90866967-90866989 GCAACACCTGATCATTGGGAAGG - Intronic
1187496787 X:19802455-19802477 GCCGCACCGTCACATGTGGATGG - Intronic
1188559794 X:31454588-31454610 GCATCTCATTGTCATGTGGAAGG + Intronic
1189711091 X:43812827-43812849 GCAGCACCACAGCATGTGAAAGG + Intronic
1193327649 X:80199695-80199717 TCAGCACCATAACATGTGTATGG - Intergenic
1200962554 Y:9008657-9008679 GCAGGACCTTACCATGGAGACGG + Intergenic