ID: 947856256

View in Genome Browser
Species Human (GRCh38)
Location 2:233326613-233326635
Sequence GGCAGCAAGGCACCCAGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 209}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947856256_947856263 8 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856263 2:233326644-233326666 TGAGGCTGCCGCTGAACAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 205
947856256_947856265 17 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856265 2:233326653-233326675 CGCTGAACAGCAGGTGACCATGG 0: 1
1: 0
2: 0
3: 8
4: 122
947856256_947856268 20 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856268 2:233326656-233326678 TGAACAGCAGGTGACCATGGGGG 0: 1
1: 0
2: 2
3: 19
4: 223
947856256_947856267 19 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856267 2:233326655-233326677 CTGAACAGCAGGTGACCATGGGG 0: 1
1: 0
2: 0
3: 12
4: 199
947856256_947856266 18 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856266 2:233326654-233326676 GCTGAACAGCAGGTGACCATGGG 0: 1
1: 0
2: 0
3: 21
4: 169
947856256_947856270 26 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856270 2:233326662-233326684 GCAGGTGACCATGGGGGTCAGGG 0: 1
1: 1
2: 2
3: 28
4: 286
947856256_947856269 25 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856269 2:233326661-233326683 AGCAGGTGACCATGGGGGTCAGG 0: 1
1: 0
2: 1
3: 25
4: 243
947856256_947856260 -10 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856260 2:233326626-233326648 CCTTGCTGCCTGGCCACATGAGG 0: 1
1: 0
2: 1
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947856256 Original CRISPR GGCAGCAAGGCACCCAGTGC GGG (reversed) Intronic