ID: 947856262

View in Genome Browser
Species Human (GRCh38)
Location 2:233326639-233326661
Sequence TGTTCAGCGGCAGCCTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 106}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947856262_947856270 0 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856270 2:233326662-233326684 GCAGGTGACCATGGGGGTCAGGG 0: 1
1: 1
2: 2
3: 28
4: 286
947856262_947856268 -6 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856268 2:233326656-233326678 TGAACAGCAGGTGACCATGGGGG 0: 1
1: 0
2: 2
3: 19
4: 223
947856262_947856269 -1 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856269 2:233326661-233326683 AGCAGGTGACCATGGGGGTCAGG 0: 1
1: 0
2: 1
3: 25
4: 243
947856262_947856266 -8 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856266 2:233326654-233326676 GCTGAACAGCAGGTGACCATGGG 0: 1
1: 0
2: 0
3: 21
4: 169
947856262_947856265 -9 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856265 2:233326653-233326675 CGCTGAACAGCAGGTGACCATGG 0: 1
1: 0
2: 0
3: 8
4: 122
947856262_947856272 18 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856272 2:233326680-233326702 CAGGGTTTCCATACCCTATCAGG 0: 1
1: 0
2: 1
3: 17
4: 132
947856262_947856267 -7 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856267 2:233326655-233326677 CTGAACAGCAGGTGACCATGGGG 0: 1
1: 0
2: 0
3: 12
4: 199
947856262_947856275 28 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856275 2:233326690-233326712 ATACCCTATCAGGGCATTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 126
947856262_947856273 19 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856273 2:233326681-233326703 AGGGTTTCCATACCCTATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947856262 Original CRISPR TGTTCAGCGGCAGCCTCATG TGG (reversed) Intronic