ID: 947856268

View in Genome Browser
Species Human (GRCh38)
Location 2:233326656-233326678
Sequence TGAACAGCAGGTGACCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947856256_947856268 20 Left 947856256 2:233326613-233326635 CCCGCACTGGGTGCCTTGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 947856268 2:233326656-233326678 TGAACAGCAGGTGACCATGGGGG 0: 1
1: 0
2: 2
3: 19
4: 223
947856259_947856268 7 Left 947856259 2:233326626-233326648 CCTTGCTGCCTGGCCACATGAGG 0: 1
1: 0
2: 0
3: 20
4: 287
Right 947856268 2:233326656-233326678 TGAACAGCAGGTGACCATGGGGG 0: 1
1: 0
2: 2
3: 19
4: 223
947856261_947856268 -1 Left 947856261 2:233326634-233326656 CCTGGCCACATGAGGCTGCCGCT 0: 1
1: 0
2: 0
3: 14
4: 133
Right 947856268 2:233326656-233326678 TGAACAGCAGGTGACCATGGGGG 0: 1
1: 0
2: 2
3: 19
4: 223
947856262_947856268 -6 Left 947856262 2:233326639-233326661 CCACATGAGGCTGCCGCTGAACA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 947856268 2:233326656-233326678 TGAACAGCAGGTGACCATGGGGG 0: 1
1: 0
2: 2
3: 19
4: 223
947856257_947856268 19 Left 947856257 2:233326614-233326636 CCGCACTGGGTGCCTTGCTGCCT 0: 1
1: 0
2: 4
3: 44
4: 376
Right 947856268 2:233326656-233326678 TGAACAGCAGGTGACCATGGGGG 0: 1
1: 0
2: 2
3: 19
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947856268 Original CRISPR TGAACAGCAGGTGACCATGG GGG Intronic