ID: 947859430

View in Genome Browser
Species Human (GRCh38)
Location 2:233348311-233348333
Sequence CCCGGTGGGTACCTCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947859430_947859439 8 Left 947859430 2:233348311-233348333 CCTGCCCTGAGGTACCCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 947859439 2:233348342-233348364 TGATGGCACAGATACTGAACAGG 0: 1
1: 0
2: 2
3: 10
4: 146
947859430_947859441 18 Left 947859430 2:233348311-233348333 CCTGCCCTGAGGTACCCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 947859441 2:233348352-233348374 GATACTGAACAGGCTCATGGCGG 0: 1
1: 0
2: 1
3: 10
4: 143
947859430_947859440 15 Left 947859430 2:233348311-233348333 CCTGCCCTGAGGTACCCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 947859440 2:233348349-233348371 ACAGATACTGAACAGGCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 172
947859430_947859435 -9 Left 947859430 2:233348311-233348333 CCTGCCCTGAGGTACCCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 947859435 2:233348325-233348347 CCCACCGGGCCTGCTGCTGATGG 0: 1
1: 0
2: 0
3: 32
4: 313
947859430_947859442 24 Left 947859430 2:233348311-233348333 CCTGCCCTGAGGTACCCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 947859442 2:233348358-233348380 GAACAGGCTCATGGCGGCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 152
947859430_947859443 29 Left 947859430 2:233348311-233348333 CCTGCCCTGAGGTACCCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 947859443 2:233348363-233348385 GGCTCATGGCGGCCAAGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947859430 Original CRISPR CCCGGTGGGTACCTCAGGGC AGG (reversed) Intergenic
900103218 1:971583-971605 CAGGGTGAGAACCTCAGGGCGGG - Intronic
900343000 1:2197468-2197490 CCTGCAGGGGACCTCAGGGCTGG + Intronic
904130561 1:28272520-28272542 CCTGGTGGGTAACCCAGGGCAGG + Intronic
904424072 1:30412400-30412422 CACGGCTGGTCCCTCAGGGCAGG - Intergenic
906291229 1:44620566-44620588 CCCAGTGCCTACATCAGGGCTGG + Intronic
907410917 1:54282668-54282690 ACCTGTGGCTTCCTCAGGGCTGG - Intronic
907433379 1:54428080-54428102 CCCGGTGCCTAGCTCAAGGCTGG - Intergenic
1062874443 10:932515-932537 CCCGGTGGGGCCTTCGGGGCAGG - Intergenic
1063106111 10:2993768-2993790 CCTGGTGACTTCCTCAGGGCGGG + Intergenic
1067550377 10:47230245-47230267 CTCTGTGCGCACCTCAGGGCAGG + Intergenic
1068762732 10:60731779-60731801 CCAGGAGGGTAGGTCAGGGCAGG - Intronic
1073136743 10:101224545-101224567 CCCGCTGGGTCCCTTTGGGCTGG - Intergenic
1074852209 10:117448025-117448047 CCCTGTGGGCACCTGAGGGTAGG + Intergenic
1075872804 10:125782933-125782955 CCTGATGGGTCCCTCAGGGGCGG - Intergenic
1076161568 10:128247777-128247799 CCCGGGAGGTGCCTGAGGGCCGG - Intergenic
1076413147 10:130265851-130265873 CCCGGTGGGATCCCCAGGCCAGG - Intergenic
1076475644 10:130749919-130749941 GCAGGTGGGGACCTCAGGCCAGG - Intergenic
1076475678 10:130750045-130750067 GCAGGTGGGGACCTCAGGACAGG - Intergenic
1076475685 10:130750081-130750103 GCAGGTGGGGAGCTCAGGGCAGG - Intergenic
1076693722 10:132237037-132237059 CCGTGTGGGTCCCTGAGGGCCGG - Intronic
1076697090 10:132252068-132252090 CCTGCTGGGCCCCTCAGGGCTGG + Intronic
1077085298 11:747165-747187 CCCGGTGCGTCCCGCGGGGCAGG + Intergenic
1077541571 11:3149034-3149056 CCCAGTGGGGAGGTCAGGGCTGG - Intronic
1077992733 11:7426361-7426383 CCCTGTGGATCCCTGAGGGCAGG + Intronic
1078099340 11:8320590-8320612 CCCAGGGGATAGCTCAGGGCTGG + Intergenic
1078889130 11:15538220-15538242 TCAGCTGGGCACCTCAGGGCTGG + Intergenic
1079336792 11:19577318-19577340 CCAGGTGGGTATCTGAGGACAGG - Intronic
1080347016 11:31336303-31336325 CCAGGAGGGTGCCTTAGGGCAGG + Intronic
1080861147 11:36151218-36151240 CCATGTGGGTACATCAGAGCTGG - Intronic
1083593789 11:63909660-63909682 CCGGGAGGGTGGCTCAGGGCTGG + Exonic
1084305811 11:68282747-68282769 CCCGTTGACAACCTCAGGGCTGG - Intergenic
1084531527 11:69730598-69730620 CTGGGTGGGTTCCACAGGGCTGG + Intergenic
1085349761 11:75790911-75790933 CCCTGTCAGGACCTCAGGGCTGG - Intronic
1101864282 12:108508645-108508667 CTCTTTGGGTACCTCAAGGCAGG - Intergenic
1101921372 12:108935962-108935984 CCCCTTGGGTACCACAGGGGTGG - Intronic
1105770459 13:23606480-23606502 CCAGGTGGACAGCTCAGGGCAGG - Intronic
1106418375 13:29565358-29565380 CCTGGGGAGTACTTCAGGGCAGG + Intronic
1115910833 14:38255262-38255284 CCCGGGAGGTACCTCCGTGCTGG - Exonic
1121108141 14:91294049-91294071 CCCGTTGGGATCCTGAGGGCAGG - Intronic
1121738306 14:96234240-96234262 CACCCTGGGTGCCTCAGGGCTGG + Intronic
1122599360 14:102913642-102913664 CCCGGTGTGCACCTGAGGGCTGG - Intergenic
1122860925 14:104582088-104582110 CCCTGAGGGTTCCTCGGGGCGGG - Intronic
1125536915 15:40446334-40446356 CCCTGTTGGAACCCCAGGGCTGG - Intronic
1125580587 15:40782761-40782783 CCCGGTGGCTGCCTCATGGATGG - Intronic
1128555918 15:68631668-68631690 CCTGGTGTGTACTTCAGGGTTGG - Intronic
1132778885 16:1612352-1612374 GCCGGTGGGGACCTCACGGACGG - Exonic
1133284369 16:4683774-4683796 CCCGGCAGGTCCCTCTGGGCAGG - Intronic
1135768131 16:25195542-25195564 GCCGGTGGATACCTGAGGTCAGG - Intergenic
1137593839 16:49710701-49710723 CCAGGTGGGTTCCTTAAGGCTGG - Intronic
1138602376 16:58063685-58063707 CCCTGTAGGCACCACAGGGCAGG - Intergenic
1139289412 16:65844016-65844038 CCCAGTGGGTGCCCCTGGGCTGG + Intergenic
1141509203 16:84501677-84501699 CCCAGTAGGAACCCCAGGGCTGG + Intronic
1142859064 17:2749814-2749836 CCCGCTGGGGGCCTCAGGCCCGG - Intergenic
1147962567 17:44177091-44177113 CCCATTGGGGACCTCAGCGCGGG - Exonic
1149541256 17:57469885-57469907 CCAGGTGGGCACCACAGGACAGG - Intronic
1151656850 17:75500178-75500200 GCGGGTGGGTCCCTCAGGTCTGG + Intergenic
1152621588 17:81367532-81367554 CATGGTGGCTGCCTCAGGGCTGG + Intergenic
1158840637 18:61382855-61382877 CACGGTGGATGCCTCTGGGCTGG - Intronic
1160038207 18:75320619-75320641 GTTGGTGGGTAACTCAGGGCAGG - Intergenic
1160869405 19:1270185-1270207 CCTGGGGGGCACCTCAGGGCAGG - Intronic
1161468994 19:4447046-4447068 CCCTGGGGGTGCCTCAGTGCTGG + Intronic
1162009574 19:7804127-7804149 GCTGGAGGGAACCTCAGGGCAGG + Intergenic
1162063748 19:8111958-8111980 CACGGTGAGTACCTGGGGGCAGG - Exonic
1162786107 19:13036078-13036100 CTTGGTGGGGATCTCAGGGCAGG - Intronic
1163747154 19:19055386-19055408 CGAGGTGGGTACCTGGGGGCTGG - Exonic
1163810069 19:19425607-19425629 CCAGTTGGGTACCTCAGGCGGGG + Intronic
1166041609 19:40206147-40206169 ACGGGTGGGTACCAGAGGGCAGG - Exonic
927207101 2:20617611-20617633 GCCGGGGGCTCCCTCAGGGCTGG + Intronic
927488243 2:23503939-23503961 CCCAGTGGGTTCATCTGGGCTGG - Intronic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
936039921 2:109142107-109142129 CCCGGTAGGTGACTCAGGGTGGG - Intronic
937317136 2:120938836-120938858 GCTGGTGGGGAACTCAGGGCTGG - Intronic
946077421 2:217086152-217086174 CACTGTGGGTGGCTCAGGGCAGG + Intergenic
947859430 2:233348311-233348333 CCCGGTGGGTACCTCAGGGCAGG - Intergenic
1172063285 20:32201872-32201894 CCCTCTGGGAACCTCAGGGCAGG + Intronic
1172110207 20:32540161-32540183 CCCAGAGGCTACCTCAGGGCAGG - Intronic
1175804936 20:61821895-61821917 CCAGGTGGGCCCTTCAGGGCAGG + Intronic
1175937091 20:62518857-62518879 CCCCTTGGGGACCTCGGGGCAGG + Intergenic
1175957389 20:62618365-62618387 CCCTGTGGGGCTCTCAGGGCTGG - Intergenic
1175997480 20:62818053-62818075 CCCTATGGGTATCTCAGGACTGG + Intronic
1176074226 20:63241138-63241160 CCAGGTGGGCACCTGAGGGAGGG + Exonic
1179074022 21:38101058-38101080 CCCTGTGGGGTACTCAGGGCAGG + Intronic
1181168016 22:20993572-20993594 CCAGGTGGGGACCTCAGGGTCGG + Intronic
1182520455 22:30881799-30881821 CCAGGTGGGTGCATCCGGGCTGG + Intronic
1184662143 22:45970391-45970413 CCCCGGGTTTACCTCAGGGCTGG - Intronic
950640156 3:14343539-14343561 CCCGGTGGGCTCCCCAGGGGCGG - Intergenic
954455045 3:50593178-50593200 CCCGATGGGAGCCTCAGGCCTGG + Intergenic
963939393 3:151085235-151085257 CCCGCGGGGTCCCTCAGGACAGG + Intergenic
967838185 3:193981730-193981752 CCCTGAGGGCACCTCAGGTCAGG + Intergenic
967859455 3:194140769-194140791 CCCTGGGGGTCCCTCAGGCCTGG + Intergenic
968731272 4:2270465-2270487 CCTGGTGGCTGCCTCAGGGCAGG - Exonic
969213891 4:5708320-5708342 CCCGGAGGGATCCTCAGGCCGGG + Exonic
969608818 4:8215961-8215983 CACTGTGGGCACCCCAGGGCAGG + Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
982070470 4:151689810-151689832 CCTGGTAAGTGCCTCAGGGCTGG - Intronic
984157174 4:176207206-176207228 CCCTGTGGGTAGCTCAGATCAGG + Intergenic
985539529 5:481710-481732 GCTGGTGGGTTCCTCGGGGCTGG - Intronic
986580882 5:9264660-9264682 CCCGCTGGTGACCTCAGGGTGGG - Intronic
1001411521 5:171515689-171515711 CAGGGAGGGGACCTCAGGGCAGG - Intergenic
1001674023 5:173497741-173497763 CCAGGTGGGTCCCAGAGGGCTGG - Intergenic
1004069999 6:12289120-12289142 CCCTGTGTGTACTTCAGGGGGGG + Intergenic
1006845046 6:37056130-37056152 CCCTGTGGGTGGCTGAGGGCCGG - Intergenic
1007108553 6:39299707-39299729 CACAGTGGGTACCTCTGGGAGGG + Exonic
1007196620 6:40066913-40066935 CCCAGTGGGTACCTGGGGGGAGG - Intergenic
1007548219 6:42709879-42709901 CCTGGTAGGTACCTGAGGGTAGG - Intronic
1007708762 6:43807572-43807594 CCCGGTGGCTCCCTAGGGGCAGG + Intergenic
1017793502 6:157822628-157822650 CCCGGAGGCTCCCTCAGGCCGGG - Intronic
1018392748 6:163352941-163352963 CCGGGTTTGGACCTCAGGGCTGG - Intergenic
1018877718 6:167840082-167840104 CCCGGTAGGTAGCTCATGGGCGG + Intronic
1022478736 7:30729216-30729238 TGCAGTGGGTACCTAAGGGCTGG + Intronic
1027232713 7:76281892-76281914 CCTGGAGGGTAGCTCAGCGCGGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1029278260 7:99420335-99420357 CCCGCTGGGTACCCTGGGGCAGG + Intronic
1029278943 7:99424595-99424617 CCCAGTGAGTGCTTCAGGGCTGG - Intronic
1032579954 7:133095281-133095303 CTCTGTGGGTCCCTGAGGGCAGG - Intergenic
1033126654 7:138712685-138712707 CCCAGTGGGTGAATCAGGGCAGG + Intronic
1036223178 8:6938122-6938144 CCCGCTGGGTCCCTCTGGGGTGG + Intronic
1036233302 8:7018119-7018141 CCCGCTGGGTCCCTCTGGGGCGG + Intronic
1039472330 8:37821229-37821251 CCAGGTGAGTAACCCAGGGCTGG - Intronic
1039964999 8:42277722-42277744 CCCGGTGAGTTCCTCTGGGCTGG + Intronic
1041177810 8:55214739-55214761 ACCTGTGGGTACCTAAGGGGAGG + Intronic
1042859080 8:73295142-73295164 CCCGGCGGGCACCTCGGGGGCGG + Exonic
1045663960 8:104466615-104466637 CTCCGTGGGTACCGCGGGGCGGG + Intronic
1049354540 8:142181168-142181190 CACAGTGGGTACCTTAGGGGTGG + Intergenic
1059440080 9:114301714-114301736 CCCGGTAGGTAACTGAGTGCTGG + Exonic
1060109176 9:120894467-120894489 CCCGGGAGGTACCTCCGGGATGG - Intronic
1061326859 9:129869422-129869444 CCGGGTGGGTGCCCCAGGGATGG + Exonic
1061450321 9:130664020-130664042 CCCCGTGGGAAGCGCAGGGCAGG - Intergenic
1061498030 9:130986698-130986720 CCAGGAGGGCACCTCAGGCCAGG - Intergenic
1061521377 9:131120313-131120335 CCAGGCGGGGTCCTCAGGGCAGG - Exonic
1062020946 9:134319215-134319237 TCTAGTGGGTGCCTCAGGGCGGG + Intronic
1062589528 9:137267145-137267167 CCAGGGGGCTGCCTCAGGGCTGG + Intronic
1062615960 9:137395767-137395789 CCATGTGGCTCCCTCAGGGCAGG - Intronic
1062732926 9:138119648-138119670 CCAGGAGGGTACCACTGGGCGGG - Intronic
1186718987 X:12282275-12282297 CCAGGTGGGTGGGTCAGGGCAGG + Intronic
1192795496 X:74421709-74421731 GCCGGTGGGTAGCCCAGAGCCGG + Exonic