ID: 947859668

View in Genome Browser
Species Human (GRCh38)
Location 2:233349555-233349577
Sequence CTTCTCCAGCCCTTCATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947859668_947859674 2 Left 947859668 2:233349555-233349577 CCAGCAATGAAGGGCTGGAGAAG 0: 1
1: 0
2: 2
3: 15
4: 229
Right 947859674 2:233349580-233349602 GGATGGATCCCTGCTATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947859668 Original CRISPR CTTCTCCAGCCCTTCATTGC TGG (reversed) Intergenic
900519502 1:3098778-3098800 CTGCTCCAGCCCTGCAGAGCTGG + Intronic
900691084 1:3981031-3981053 CTTGTCCTGCCCTCCATAGCAGG + Intergenic
901013965 1:6217226-6217248 CCTCTCCAGCCGTTCCTTCCTGG + Intronic
904298454 1:29539036-29539058 CTTCTCCAGCCCTGAAGTGGGGG + Intergenic
904867014 1:33587405-33587427 CCTCTCCCACCCTTCAGTGCTGG - Intronic
905651472 1:39659870-39659892 CTTCTCCAGCTGTTTATAGCTGG - Intronic
905880122 1:41457755-41457777 CCTCTCCAGCTCTTACTTGCAGG + Intergenic
908400917 1:63772341-63772363 CTTCTCCAGGACTTCATGGCAGG - Intergenic
908440734 1:64151357-64151379 CTTCTCCTGCCTTTCATCTCTGG + Intronic
910951221 1:92650482-92650504 CTTCTCTAGTTATTCATTGCTGG + Intronic
911271171 1:95802988-95803010 TTTCCCCAGTCCTTCATTGATGG - Intergenic
911724819 1:101232318-101232340 CTTTTCCAGTCCATCATTGGTGG - Intergenic
912852273 1:113137389-113137411 CTTCTGCAGCTCTTGAATGCAGG + Intergenic
912923019 1:113887291-113887313 CTTCTTGAGCCCAACATTGCAGG - Exonic
917764739 1:178203491-178203513 CTTTTCCATCCCTTGATTCCTGG - Intronic
918809668 1:189099859-189099881 ATTCTCCAGCCTTTCTTTACTGG - Intergenic
919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG + Intronic
921583632 1:216924099-216924121 CTCCCCCTGCCCTTCATTTCTGG - Intronic
922239832 1:223748408-223748430 CTGCTCCAGCCCTTCTTCCCAGG + Intronic
922252839 1:223865231-223865253 TTTCTCCAGTCTGTCATTGCTGG + Intergenic
922652966 1:227356842-227356864 CCTCACCTGCACTTCATTGCTGG + Intergenic
923115511 1:230933396-230933418 CTTTTCCATCCCTTCATTCTAGG + Intronic
923565975 1:235076167-235076189 CTGCACCATTCCTTCATTGCTGG + Intergenic
924862121 1:247936063-247936085 CTTCTGCACCCCGTCTTTGCTGG - Intergenic
1063501853 10:6562407-6562429 CTTCTCCAGGCATTCTCTGCTGG - Intronic
1064299169 10:14106956-14106978 TTTATCCAGCCCACCATTGCTGG - Intronic
1064904781 10:20333975-20333997 CTTCTCCTGCCTTCCAATGCCGG + Intergenic
1067225869 10:44375317-44375339 CTTCTTCAGCCCCTCCTTCCTGG - Intronic
1070746441 10:78936622-78936644 TCTCTCCAGCACTTCATTCCTGG + Intergenic
1070758058 10:79005756-79005778 CCTCTGCAGCCCCTCATTTCTGG + Intergenic
1071394054 10:85204356-85204378 CTTCTGCAGCCGTCCATTGAGGG - Intergenic
1072359975 10:94649938-94649960 CTTATCCAGCCTATCATTGATGG + Intergenic
1075387733 10:122069181-122069203 TTTCTCCAGACCTTCAGTGGGGG + Intronic
1076726782 10:132417564-132417586 CTTCCCCAGCCCTTGGGTGCGGG + Exonic
1077387224 11:2275753-2275775 CTGCTCCTGCCCCTCTTTGCTGG - Intergenic
1078068637 11:8094230-8094252 CTTCCCCAGCCCTACAGTGGAGG - Intronic
1079691094 11:23417987-23418009 CCCCTCCAGCCTCTCATTGCAGG - Intergenic
1084454685 11:69261620-69261642 TTTTTCCAGGCCTTCAATGCTGG + Intergenic
1084459105 11:69286387-69286409 CTTCTCCAGCCCTTCAGAAATGG + Intergenic
1086694682 11:89829325-89829347 CTTATCCAGCCTATCATTGATGG - Intergenic
1086711466 11:90015174-90015196 CTTATCCAGCCTATCATTGATGG + Intergenic
1088321985 11:108563738-108563760 CCTCTCCACCCCTTCAGTGGTGG - Intronic
1088848174 11:113684740-113684762 CACCTCCACCCCTTCATTCCAGG + Intergenic
1089279069 11:117359973-117359995 TTTCCCCAGCCCTTGCTTGCAGG + Intronic
1089315186 11:117586636-117586658 CTTCCCCAGCCCCTCACTACTGG - Intronic
1090432589 11:126658591-126658613 CTTTGCCAGCCCTACATTGCTGG + Intronic
1091845917 12:3656365-3656387 CTGCTCCAGCTCTTGACTGCGGG + Exonic
1092112645 12:5974732-5974754 CTGCTCCAGCTCCTCACTGCAGG - Intronic
1094271949 12:28626755-28626777 CTTCTCCCTCCCTTCAGTGAGGG + Intergenic
1095606907 12:44079097-44079119 CTTATCCAGCCTATCATTGATGG + Intronic
1095790111 12:46157579-46157601 CTTCTCCAGCCCCAGAATGCAGG + Intergenic
1097966409 12:65586255-65586277 CTTTTCCAGGCCTTCAATTCAGG - Intergenic
1098452778 12:70639082-70639104 CTTCTCCTTCCTTCCATTGCAGG + Exonic
1103763075 12:123265251-123265273 CTTCCCCAGCTCTTCAATGATGG + Exonic
1103876019 12:124127850-124127872 GCTCTCCACCTCTTCATTGCTGG + Intronic
1104646778 12:130503047-130503069 ATTCTGGAGCCCTTCATTCCTGG - Intronic
1105068474 12:133219354-133219376 CTTTTCCAGCCCTCCAGAGCTGG - Exonic
1106571831 13:30934523-30934545 CTTGTCCAGACCTTGATTTCAGG - Intronic
1106836728 13:33642989-33643011 CTCTTGCAGGCCTTCATTGCAGG - Intergenic
1110418945 13:75283097-75283119 CTTCTCCACCCCTGAATTTCAGG + Intergenic
1110461759 13:75752817-75752839 TTTATCCAGTCCTTCATTGATGG + Intronic
1111445224 13:88338999-88339021 TTTATCCAGCCTATCATTGCTGG + Intergenic
1111965710 13:94859437-94859459 CTTCTGCAGCTCTGCGTTGCTGG + Intergenic
1112802633 13:103129572-103129594 CTTCTCCTGTCCTTCAATGTAGG + Intergenic
1113657637 13:112078339-112078361 CTTTTCCAGCCCCTCATCTCTGG - Intergenic
1115294848 14:31813918-31813940 CTTATCCAGTCCATCATTGATGG + Intronic
1115433458 14:33347492-33347514 CTTTTCCAACTATTCATTGCCGG + Intronic
1115459629 14:33645888-33645910 CTTCAACAGACCTTCATTGAGGG + Intronic
1116158193 14:41235203-41235225 CACCTCCACCCCTTAATTGCTGG + Intergenic
1118627752 14:67674663-67674685 CTTCTCCAGCCAGTGATTGCTGG + Exonic
1119127051 14:72137255-72137277 TTTCTGCAGCCCTTCATGGTAGG + Intronic
1120141633 14:80936057-80936079 CTGCTCCAGCACTTCAGAGCAGG + Intronic
1120760225 14:88278153-88278175 CTTCTCTAGCCCCTGAGTGCTGG - Intronic
1120771583 14:88385724-88385746 CTTTTCCAGTCCTCCACTGCCGG + Exonic
1121131874 14:91454721-91454743 ATTCTCTACCCCTTCAATGCTGG - Intergenic
1122166120 14:99825296-99825318 TTTATCCAGTCCTTCATTGATGG + Intronic
1122359302 14:101150211-101150233 CTTCTCCTGCCCTCCGCTGCAGG + Intergenic
1122539510 14:102489914-102489936 CTTCTCAAGCCTTTCTTTGGAGG - Intronic
1129005732 15:72371887-72371909 CTTCTCCAGCCCTTTTATTCTGG - Intronic
1129301801 15:74629809-74629831 CTGCTGCACCCCTTCTTTGCTGG + Exonic
1130633896 15:85598191-85598213 CTTCTCTAGCCCAGCATGGCAGG - Intronic
1131178223 15:90223441-90223463 CTTCTCCTGCCCTTCAGTCCTGG + Intronic
1131306732 15:91251797-91251819 CCTCTCCTCCCCCTCATTGCAGG + Exonic
1132752587 16:1465627-1465649 GTTGTCCAGCCCTTCTTTCCTGG - Intronic
1133000848 16:2850694-2850716 CCTCTCCAGCCCTCCTTTGCTGG - Intergenic
1133161613 16:3915738-3915760 CTTCCCCAGCCCCTCTCTGCTGG + Intergenic
1134281777 16:12823355-12823377 CTTATCCAACCCTTTTTTGCTGG + Intergenic
1136717131 16:32289839-32289861 CTTCACCATCCCCTCGTTGCAGG - Intergenic
1136835505 16:33496093-33496115 CTTCACCATCCCCTCGTTGCAGG - Intergenic
1137389041 16:48066376-48066398 CCTCTCCTGCCCTTCAATTCTGG + Intergenic
1137391705 16:48086819-48086841 CCTCTCCTCTCCTTCATTGCAGG - Exonic
1139572827 16:67824060-67824082 CTTCTCCACCCCTTCCAGGCTGG - Intronic
1140242426 16:73215332-73215354 TTTCTCCACCCCTTCCATGCAGG + Intergenic
1140547030 16:75820724-75820746 GAACTCCAGCCCTTCCTTGCAGG - Intergenic
1141366338 16:83446982-83447004 CTTCTTAACCCCTTCAATGCAGG - Intronic
1141368566 16:83466406-83466428 CTTATCCAGCCCTCTGTTGCTGG - Intronic
1141569522 16:84925719-84925741 CTTCTTCAAACCTGCATTGCAGG - Intergenic
1203009298 16_KI270728v1_random:227939-227961 CTTCACCATCCCCTCGTTGCAGG + Intergenic
1203145682 16_KI270728v1_random:1796406-1796428 CTTCACCATCCCCTCGTTGCAGG - Intergenic
1142766161 17:2065390-2065412 CTCCTTCAGCCCTTCCTTCCTGG + Intronic
1143790268 17:9289314-9289336 CTTTTGGAGCCCTTCATTCCTGG - Intronic
1143919439 17:10319156-10319178 CTCCTCCAGCTCTTCTATGCGGG + Exonic
1143933153 17:10452307-10452329 CTCCTCCAGCTCCTCAATGCGGG + Exonic
1143937447 17:10501476-10501498 CTCCTCCAGCTCCTCAATGCGGG + Exonic
1143939859 17:10529056-10529078 CTCCTCCAGCTCCTCAATGCGGG + Exonic
1145973078 17:28968340-28968362 CTCTTCCAGCCCTTCCTTGGAGG + Intronic
1146127663 17:30241430-30241452 TTTTCCTAGCCCTTCATTGCTGG - Intergenic
1146534203 17:33635774-33635796 ATTCTCCAGCCCTGCCTTCCTGG + Intronic
1146661727 17:34669467-34669489 CTTCTCCCTCCCTTCCTAGCTGG + Intergenic
1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG + Intronic
1149343126 17:55707254-55707276 CCTCTCCAGCCGTTAACTGCAGG + Intergenic
1152735601 17:81995527-81995549 CTTCTCCACCCCTTCCTCACAGG + Intronic
1152878949 17:82804521-82804543 CGTCTCAAGGCCTGCATTGCTGG + Intronic
1153589893 18:6662365-6662387 CATCTGCAGCCCTAGATTGCTGG - Intergenic
1153933920 18:9903755-9903777 CTTATCCAGCCTATCATTGATGG - Intergenic
1154489691 18:14910511-14910533 TTTATCCAGCCCTCCATTGATGG + Intergenic
1156502443 18:37567954-37567976 CTTCTCCTGCCTTTGCTTGCCGG + Intergenic
1158308530 18:56133599-56133621 TTTATCCAGTCCATCATTGCTGG - Intergenic
1159843210 18:73425479-73425501 CTTCTTCAGCCGTTCATTCCAGG + Intergenic
1165089795 19:33378760-33378782 CTTTTCCCCCCTTTCATTGCAGG + Intronic
1166906745 19:46115845-46115867 CCACTCCAGCCCCTCATTGCAGG + Intergenic
1167076973 19:47256270-47256292 CGCCTCCAGCCCCTCATTCCTGG - Intronic
1168267667 19:55231299-55231321 CTGCTCCAGGCCTCCTTTGCAGG - Intronic
925322329 2:2983261-2983283 CTTATCCAGTCCTCCATTGATGG - Intergenic
927443364 2:23135913-23135935 CTTCTCCAGCTTTGCATTCCTGG - Intergenic
927713666 2:25340449-25340471 CTCCCCCAGCCCCTCATCGCTGG - Intronic
928658104 2:33473876-33473898 CATCTCCATCCCCTCATTCCCGG - Intronic
929189860 2:39129886-39129908 CATTTCCACCCCTTGATTGCTGG - Intergenic
930780324 2:55218600-55218622 CTTCTCCTGTCCTTCTCTGCAGG - Intronic
936004273 2:108868561-108868583 CTCCTCCAGCCTTTCATTGCTGG + Intronic
937311325 2:120905165-120905187 CTTTTACAGCCCCTCACTGCAGG - Intronic
937801912 2:126090520-126090542 CTGCTTCAGAGCTTCATTGCTGG + Intergenic
938739777 2:134220218-134220240 CTTCGCCAGCCTCTCATTTCAGG + Intronic
939568175 2:143809543-143809565 ATTCTCCAGAACTTCAATGCAGG + Intergenic
942963873 2:181865968-181865990 CATCCCCAGCCCTTCAATGCTGG - Intergenic
944546365 2:200802866-200802888 CTTATCCATTCCTTCATTGATGG - Intergenic
945428163 2:209733383-209733405 CTTCTCCAGCCGTACCTAGCTGG - Exonic
945487356 2:210412532-210412554 TTTATCCAGTCCTTCATTGATGG + Intergenic
946190471 2:218005156-218005178 CTCCCACAGCCCTTCACTGCTGG + Intergenic
947859668 2:233349555-233349577 CTTCTCCAGCCCTTCATTGCTGG - Intergenic
1169902364 20:10566534-10566556 CTTTTCCAGTCCTTCGTTCCAGG + Intronic
1172562539 20:35902220-35902242 AATCTCCAGTCCTTCAGTGCTGG - Intronic
1173058059 20:39635649-39635671 CTTCCCCAGACCTTCTTTCCAGG + Intergenic
1174435599 20:50504606-50504628 CTTCTCCAGCCTTTCCTTCGTGG - Intergenic
1177832424 21:26154019-26154041 CTTCTCCAACCCTCCATGTCAGG + Intronic
1178194321 21:30325913-30325935 CTTCTCCTGCTCTTCAATACTGG - Intergenic
1178385870 21:32149987-32150009 CTTTTCCACCCCTTGATTCCCGG - Intergenic
1182148151 22:28010144-28010166 CTTCTGCTGCCCTTCAGAGCTGG - Intronic
1182819648 22:33204190-33204212 CCTCTCCAGCCCCTCAATTCGGG - Intronic
1183531108 22:38353829-38353851 CCTCTCCATCCCTCCCTTGCAGG + Intronic
1183675545 22:39297123-39297145 CTTCCCCAGCCCTGCCTGGCGGG - Intergenic
951748424 3:26005797-26005819 CTTCTCCATCCCATCCCTGCAGG + Intergenic
953977910 3:47396177-47396199 CTTCTTCAGTTCTTCATTGTAGG - Exonic
958716797 3:97793562-97793584 GTTCTCCATCCCTTCTTTTCTGG + Intronic
960280240 3:115773245-115773267 CTTCACCTTCACTTCATTGCAGG - Intergenic
960603541 3:119481687-119481709 TTTGTCCAGCCCTTTATTTCAGG + Intronic
962987207 3:140546626-140546648 AATGTCCAGCCCTTCCTTGCAGG - Exonic
965708335 3:171532017-171532039 CATTTCCAGCCCTTGATTCCTGG + Intergenic
967411121 3:189167408-189167430 CTTTGCCAGCCATTCATGGCAGG - Intronic
967833069 3:193938742-193938764 CTGCTCCAGCTCTTCCTTGTTGG + Intergenic
969227196 4:5806577-5806599 CTTATCCAGTCCTCCATTGATGG + Intronic
972310298 4:37875596-37875618 CTTTTCGTGCCCTACATTGCAGG + Intergenic
972735456 4:41836628-41836650 CTTCTCCATTCTTTCATTGATGG - Intergenic
976056929 4:81080123-81080145 TTTATCCAGTCCATCATTGCTGG - Intergenic
976088861 4:81434565-81434587 CTTCTCCAGCACCGCATTCCTGG - Intronic
976224022 4:82781043-82781065 CTTCTCCAGCCCTCCTCTGGGGG - Intronic
977494515 4:97758379-97758401 CTTATCCAGCCTATCATTGATGG - Intronic
977688534 4:99876752-99876774 CATTTCCACCCCTTTATTGCTGG - Intergenic
978370918 4:108029018-108029040 CTTCAACAGCCTATCATTGCTGG + Intronic
979465929 4:121038598-121038620 CTTTTCCAGCTTATCATTGCAGG + Intronic
981290198 4:143066024-143066046 CTTATCCAGTCCATCATTGATGG + Intergenic
982578920 4:157153565-157153587 CTTCTCCTGCCACTCACTGCTGG - Intronic
987974765 5:24999432-24999454 AGTCTTCAGCCCTTAATTGCAGG - Intergenic
988128555 5:27074069-27074091 TTTCTCTACCCCTTAATTGCTGG - Intronic
988318065 5:29657570-29657592 CTTTTCCAGTCTTTCATTGATGG - Intergenic
991021057 5:61980620-61980642 CTACTCCAGCATTTCATTCCGGG + Intergenic
991148704 5:63339706-63339728 ATTCTCCATCCCTTTATTGATGG + Intergenic
993080109 5:83286026-83286048 CTGATCCAGCCCTTAATTCCTGG + Intronic
993504092 5:88690790-88690812 GTTCTCCAGCTCTTCAAGGCTGG - Intergenic
997593220 5:135088198-135088220 CTTCTCCACCCCAACTTTGCAGG - Intronic
1001746840 5:174098861-174098883 GTTCTCCAGCGCTACATTGGAGG - Intronic
1002057055 5:176604267-176604289 CCACTCCAGCTCTTCATGGCTGG - Intronic
1005410490 6:25540027-25540049 CTTCTCCAGCCATTGATTCCAGG - Exonic
1008225203 6:48906302-48906324 TTTATCCAGCCCATCATTGATGG + Intergenic
1013037316 6:106398662-106398684 CTTCTCCAGCTTCTCAGTGCTGG + Intergenic
1013164401 6:107576712-107576734 CATCTGCAGCCCTGCTTTGCTGG + Intronic
1016913402 6:149221762-149221784 CTTCTCCCCTCCTTCATTCCAGG - Intronic
1017043876 6:150329403-150329425 CATTTCCACCCCTTCATTCCTGG + Intergenic
1018045595 6:159963403-159963425 CATCTCATGCCCTTGATTGCTGG - Intergenic
1018122493 6:160649547-160649569 CATCTCCTGCCCTTCAGTGCAGG + Intronic
1019102268 6:169641081-169641103 CTTCGCAACCCCTGCATTGCCGG - Intronic
1019355508 7:576782-576804 CCTCTCCCGCCCCTCATTCCCGG - Intronic
1019921532 7:4166466-4166488 CTTCTCCAGCCTTTCACTGCAGG - Intronic
1021815320 7:24441847-24441869 CTCCGCCCGCCCTTCTTTGCAGG + Intergenic
1022787029 7:33648611-33648633 CTTCTTCAGGGCTTCATTTCTGG - Intergenic
1023881557 7:44324283-44324305 CTCCTCCGTCCCTTCAGTGCAGG - Intronic
1024158070 7:46646862-46646884 CTGCTCCAGACCTTCATGGTGGG - Intergenic
1026943141 7:74299624-74299646 CTTCCCCAGCCCTTGCCTGCAGG + Intronic
1028803337 7:94994337-94994359 CTTCTCCCGCCCTTTCTTCCTGG - Intronic
1029140338 7:98405066-98405088 CTTCTGCAGCTCTTCTATGCAGG - Intergenic
1029936534 7:104430834-104430856 CTCCTCCACCCCATCTTTGCAGG + Intronic
1031008609 7:116500389-116500411 ATTCCCCTGGCCTTCATTGCGGG + Exonic
1032097098 7:128944835-128944857 TTTCACCAGCCCCTCATTGATGG + Intronic
1032573111 7:133022239-133022261 GTTCTCAAGCACTTCATAGCTGG - Intronic
1033437977 7:141351536-141351558 TTTCTCCACCCCTTCAATGTGGG - Intronic
1033722228 7:144073856-144073878 CTTCTGTATTCCTTCATTGCAGG - Intergenic
1035919648 8:3663097-3663119 CTGCTTCAGGTCTTCATTGCGGG - Intronic
1036229131 8:6984618-6984640 GTTCTCTAGCTCTTCCTTGCAGG - Intergenic
1036231584 8:7003723-7003745 GTTCTCTAGCTCTTCCTTGCAGG - Intronic
1036234064 8:7022931-7022953 GTTCTCTAGCCCATCCTTGCAGG - Intergenic
1037358279 8:18046180-18046202 CTTCTCCAGCCCTCCCTTTTGGG + Intergenic
1038533613 8:28338267-28338289 TTTCTCCAGCCCCTCTTGGCTGG - Intronic
1038761902 8:30392174-30392196 CAGCTCCATCCCTTCCTTGCAGG - Intronic
1038832480 8:31076918-31076940 CTTGTCCTGGCCTTAATTGCAGG + Intronic
1039465721 8:37783907-37783929 CTCCTCCAGCCCCTCACTCCTGG - Intergenic
1043277147 8:78412511-78412533 CCTCTCCAGCCCTTTATTGTTGG + Intergenic
1044545851 8:93458481-93458503 CTGCTCCATCCCTCCTTTGCTGG - Intergenic
1044725284 8:95189792-95189814 CTTCCCCAGCCCTTCTTTTTTGG - Intergenic
1048584204 8:135757413-135757435 TGTCTCCACCCCTTCATTCCTGG + Intergenic
1049847716 8:144811258-144811280 CTTCCCCAACCCCTTATTGCTGG + Intergenic
1050789384 9:9447272-9447294 CTTATCCAGTCTATCATTGCTGG - Intronic
1051707488 9:19895849-19895871 CTGCTGCACCCCTTCTTTGCTGG - Intergenic
1052347583 9:27425882-27425904 CTTTTCCAGTCCCTCATTTCAGG - Intronic
1053152343 9:35751003-35751025 CTTCCCCAGCCCTTCCCTCCAGG - Intronic
1053393814 9:37754231-37754253 CTCCTCCATCCCTTCAATGTAGG - Intronic
1053439971 9:38108106-38108128 CTTGCCCAGACCTTCATAGCTGG - Intergenic
1056825494 9:89873867-89873889 CTTCTCCAGCCCATCGCTGTCGG + Intergenic
1056998950 9:91489800-91489822 CTGTTCTTGCCCTTCATTGCAGG + Intergenic
1058141160 9:101358001-101358023 CTTTTCCAGGCCTACAGTGCAGG + Intergenic
1059588659 9:115633247-115633269 CTTCTCCACCCCTTGATTTCAGG + Intergenic
1185461451 X:334517-334539 CTTCGCCATCCCCTCGTTGCAGG - Exonic
1185843523 X:3416023-3416045 CTTCTCCACCCCCTCATTCATGG + Intergenic
1186865784 X:13719418-13719440 CTTCTGCAGCACTTCCTGGCTGG - Intronic
1191766086 X:64699643-64699665 TTTATCCAGCCCATCATTGATGG + Intergenic
1191791445 X:64976273-64976295 CCTCTCCAACCCTTCGTTGCGGG - Intronic
1191933382 X:66399153-66399175 TTTATCCAGCCTATCATTGCTGG + Intergenic
1192021086 X:67391980-67392002 TTTCTCCAGCCTATCATTGATGG - Intergenic
1193436346 X:81478796-81478818 CCTCTCTAGCCCTTGATTGCTGG + Intergenic
1195353517 X:104016311-104016333 CTTATCCAGCCTATCATTGATGG + Intergenic
1196868526 X:120090891-120090913 TTTCACCTGCACTTCATTGCTGG + Intergenic
1197209843 X:123819546-123819568 CTCCTCCAGCCCCTCATAACTGG - Intergenic
1197364154 X:125543963-125543985 CTTCTCCAGTCCTTAAATGCGGG + Intergenic
1197988822 X:132295428-132295450 CTTTGCCACCCCTTAATTGCTGG + Intergenic
1198793239 X:140368569-140368591 CTTCACCATCCCTTGTTTGCTGG - Intergenic
1199694709 X:150335649-150335671 CCTCTGCAGCCATTCAGTGCTGG - Intergenic
1200021514 X:153214648-153214670 TTTCTCCACCCCTTCACTTCTGG - Intergenic
1201042795 Y:9854085-9854107 TCTCTCCAGGCATTCATTGCTGG - Intergenic