ID: 947860356

View in Genome Browser
Species Human (GRCh38)
Location 2:233353889-233353911
Sequence ACGGGGGAAGAAAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1017
Summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 932}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947860356_947860367 28 Left 947860356 2:233353889-233353911 CCAGCTTCCCTTTCTTCCCCCGT 0: 1
1: 0
2: 5
3: 79
4: 932
Right 947860367 2:233353940-233353962 TCCAGGCCTTTGCACAAATCTGG 0: 1
1: 0
2: 0
3: 13
4: 164
947860356_947860365 11 Left 947860356 2:233353889-233353911 CCAGCTTCCCTTTCTTCCCCCGT 0: 1
1: 0
2: 5
3: 79
4: 932
Right 947860365 2:233353923-233353945 ACTCGTTCTTTCTTGCCTCCAGG 0: 1
1: 0
2: 1
3: 22
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947860356 Original CRISPR ACGGGGGAAGAAAGGGAAGC TGG (reversed) Intergenic
900558379 1:3291343-3291365 ACAGGGGCAGAAGGGGAAGAAGG - Intronic
901150341 1:7097119-7097141 ACGGGAGCAGGAAGGGAAGAGGG - Intronic
901437618 1:9257634-9257656 AGTGGGGAAGAAAGAGAAACAGG + Intronic
901898527 1:12337041-12337063 AGGAAGGAAGAAAGGGAGGCAGG - Intronic
901909068 1:12439735-12439757 AGGAGGGAAGAAAGGGAAGAAGG + Intronic
902271051 1:15305411-15305433 ACGTGGAAAGAACTGGAAGCAGG + Intronic
902271793 1:15310113-15310135 AAGGGGGAAGAGAGAAAAGCAGG + Intronic
902398573 1:16145287-16145309 GCGGGGGAACCAAGGGAAGCTGG + Intronic
902679801 1:18035100-18035122 ACTCGGGGAGAATGGGAAGCTGG + Intergenic
902778919 1:18692192-18692214 AGGGGGGAAGAAAAGGAAGAAGG + Intronic
902814391 1:18907948-18907970 AAGGTGGAAGGAAGGGAAGGAGG - Exonic
902926418 1:19698704-19698726 AAGGAAGAAGAAAGGGAAGGAGG - Intronic
903156404 1:21446551-21446573 AAGGAGGAAGAAAGGGAGGGAGG - Intronic
903369173 1:22824258-22824280 ATGGGGGAAGGAAGGGAGGGAGG + Intronic
903535288 1:24062780-24062802 ACTGGGGGAGAAAGGGATGCAGG - Intronic
903856738 1:26342308-26342330 ACTGGGGAAGAAAGAGATTCTGG - Intronic
903946468 1:26967020-26967042 CCCAGGGAAGGAAGGGAAGCAGG - Intergenic
904171631 1:28595374-28595396 TTTGGGGAAGAAAAGGAAGCAGG - Exonic
904289430 1:29474680-29474702 AGGAGGGGAGAAAGGGTAGCAGG + Intergenic
904302027 1:29560419-29560441 AAGGGGCACGAAAGGGTAGCTGG + Intergenic
904480695 1:30791557-30791579 AAGGAGGAAGACAGGGAAGGAGG + Intergenic
904682825 1:32240854-32240876 ACGGTAGAATAAAGGGAAGGAGG + Intergenic
904866961 1:33587027-33587049 ACTGGGGAAGGAAGGGAAGGTGG - Intronic
905223654 1:36465933-36465955 AGGGGGGAAGGAAGGGAGGGAGG + Intergenic
906246856 1:44282347-44282369 AAGAGAGAAGAAAGGGAAGGGGG + Intronic
906327512 1:44856676-44856698 AAGGGGGAAGAAACTGAAGAAGG + Intronic
906360245 1:45150586-45150608 ATAGGGGCAGAAAGGGGAGCTGG - Intronic
906475173 1:46164692-46164714 ACGAGGTTAGAAAGGTAAGCAGG - Intronic
906772659 1:48499054-48499076 ACTGCGGAAGGAAGGGCAGCTGG - Intergenic
906825882 1:48979558-48979580 AGGGTGGGAAAAAGGGAAGCAGG + Intronic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
907072704 1:51551368-51551390 ACGGATGAAGAAAAGGAAGATGG - Intergenic
907382863 1:54105480-54105502 AAGGGGGCAGGAAAGGAAGCAGG - Intronic
908186434 1:61656941-61656963 ATGGGGGCAGAAAGAGAAGGAGG + Intergenic
908390373 1:63678391-63678413 AGGAGGGAAGAAAGGCAGGCAGG - Intergenic
908482486 1:64555805-64555827 ATGGGGGAAGAAAAGGAAATTGG - Intronic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
908792991 1:67801914-67801936 AGGGAGGAAGGAAGGGAAGGGGG + Intronic
908821359 1:68090144-68090166 ACAGAGGTAGAAAGAGAAGCTGG - Intergenic
908836356 1:68232582-68232604 AGGGAGGAAGAAAGGGAGGGAGG - Intronic
908916732 1:69136244-69136266 AAGGGAGGAGAAAGGGAAGGAGG + Intergenic
909157058 1:72091460-72091482 ACGGGAGAAGGAAGGGAGGGAGG - Intronic
909741160 1:79031204-79031226 ATGGGGGAAGAAAAGCAACCTGG + Intergenic
910219490 1:84876199-84876221 ACGGGGTAGGAGAGGGAGGCAGG - Intronic
911183780 1:94883902-94883924 ACAGAGGAAGAAAGGCAGGCTGG - Intronic
911260469 1:95679567-95679589 ACAGTGGAAGAAGTGGAAGCAGG - Intergenic
912075294 1:105866890-105866912 AGAGGGGAAGAGAGGGAATCAGG + Intergenic
912211348 1:107560562-107560584 AGGGGGGTGGGAAGGGAAGCAGG + Intergenic
913966718 1:143382984-143383006 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914061095 1:144208591-144208613 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
914118055 1:144757778-144757800 AAGGGAGAAGAAAGGAAGGCAGG + Intergenic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914902796 1:151720863-151720885 ACGGGAGGAGAAAGGGAATTTGG - Intronic
915015180 1:152726340-152726362 ACGGGAGAAGAAGAGGAGGCAGG + Intergenic
915666272 1:157448091-157448113 ACTGGGAAAGAAAGGAAATCAGG - Intergenic
915684078 1:157613627-157613649 ATGAGGGAATAAAGAGAAGCTGG + Intergenic
916119280 1:161513324-161513346 AAGGGGGAAGGAAGGAAGGCAGG - Intronic
916129042 1:161594983-161595005 AAGGGGGAAGGAAGGAAGGCAGG - Intronic
916473446 1:165145970-165145992 AGGAGAGAAGAAAGGGAAGAAGG - Intergenic
917147551 1:171908956-171908978 AGGGAGGAAGAAAAGGAAGGAGG - Intronic
917165075 1:172102759-172102781 AGGGAGGAAAAGAGGGAAGCAGG - Intronic
917562017 1:176168431-176168453 AGGAAGGAAGAAAGGGAAGAAGG + Intronic
918197348 1:182234699-182234721 AGGGAGGGAGAAAGCGAAGCAGG - Intergenic
919105314 1:193142652-193142674 AAGGAGGAAGAGAGGGAAACGGG - Intronic
919331824 1:196181797-196181819 AATGGGAAATAAAGGGAAGCTGG - Intergenic
919613555 1:199776937-199776959 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
920191549 1:204197038-204197060 ACCGAGGAAAGAAGGGAAGCAGG - Intergenic
921046963 1:211484748-211484770 AGGTGGGAAGAGAGGGAGGCAGG - Intronic
921196048 1:212759411-212759433 GCATGGGAAGAAAGGGAAGCAGG + Intronic
921756668 1:218864687-218864709 AGGAAGGAAGAAAGGGAAGGGGG - Intergenic
922022325 1:221717306-221717328 AGAGGGGAAGGAAGGGAGGCAGG + Intronic
922366589 1:224870872-224870894 ATGGGGGAATAAAGAGAAGTTGG + Intergenic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
923063058 1:230494748-230494770 AGGGAGGAAGAAAGGAAAGAAGG + Intergenic
923129675 1:231064629-231064651 AGGGAGGAAGAAAGGAAAGGAGG - Intergenic
923249452 1:232166566-232166588 AAGAGGGAAGAATGGGAAACCGG + Intergenic
923357634 1:233176352-233176374 ACGGGAGAAGAAAAGGAAGAAGG - Intronic
924251086 1:242133622-242133644 AGGGAGGAAGAAAGGAAAGGAGG - Intronic
924272093 1:242344493-242344515 ACGTGGGAGGAAAAGGAAGTAGG + Intronic
924537570 1:244950175-244950197 TCGGGGGAAAGAAGGGAGGCAGG + Intergenic
1063250011 10:4264037-4264059 AAGGGTCAAGAGAGGGAAGCAGG - Intergenic
1063365188 10:5486336-5486358 CTGCGGGAAGAAAGGGAAGGAGG + Intergenic
1063521280 10:6743523-6743545 GCGGGGGAAGGCAGGGAAGCAGG + Intergenic
1063576314 10:7265180-7265202 AGGGAGGAAGAGAGGGAGGCAGG - Intronic
1063696835 10:8343887-8343909 ATGGAGGGAGACAGGGAAGCTGG + Intergenic
1063945555 10:11172684-11172706 AAGGAGGAAGAAGGGGAAGGAGG + Intronic
1064016058 10:11773232-11773254 ACGGGGGAAGGAAGGGAAGGAGG - Intergenic
1064409501 10:15092835-15092857 GGGGGGGAAGAAAGGGAGGAGGG + Intergenic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064686449 10:17867092-17867114 AGGGGGTAAGGAAGGGAAGGAGG - Intronic
1064722195 10:18240779-18240801 ATGGGGGAGAAAAGGGAAGGAGG - Intronic
1065279037 10:24116037-24116059 ACGAGGGAAGTCAGAGAAGCAGG - Intronic
1065383937 10:25115393-25115415 AGGGAGGAAGGAAGGGAAGGAGG - Intergenic
1065643829 10:27814146-27814168 ATGGGGGAAAAAAGGGAAACAGG + Intronic
1065866457 10:29919227-29919249 AGGGGGGAAGAAAGAGGAGCAGG - Intergenic
1065874218 10:29983127-29983149 AGGGTGGAAGAGAGGGAAGGAGG + Intergenic
1065933496 10:30500009-30500031 AGGGAGGAAGCAAGGGAAGCAGG + Intergenic
1066009488 10:31181342-31181364 AGAGGGGAAGAAAAGGAAGCAGG + Intergenic
1066433942 10:35379370-35379392 ATGGGGGCAGAAGGGGAAGGTGG + Intronic
1066712574 10:38251645-38251667 ACGTGGGAGGAAAAGGAAGTAGG - Intergenic
1067208195 10:44237495-44237517 AAGTGGGAAGAAAAGGAAGAAGG + Intergenic
1067397558 10:45936345-45936367 AATGGGGAAGGAAGGGAAGGAGG - Intergenic
1067526312 10:47040825-47040847 AGGGAGGGAGAAAGGGAAGGAGG + Intergenic
1067530287 10:47066219-47066241 ACGGGAGGAGAAGGGGGAGCAGG - Intergenic
1067865875 10:49905439-49905461 AATGGGGAAGGAAGGGAAGGAGG - Intronic
1067900874 10:50240268-50240290 AAGGAACAAGAAAGGGAAGCTGG - Intronic
1068261748 10:54592308-54592330 AAGGAGGAAGGAAGGGAAGGAGG - Intronic
1068474009 10:57502127-57502149 ACTGGGGAAAAGAGGGAGGCTGG - Intergenic
1068593275 10:58872945-58872967 AAGGGGGCAGAAAGAAAAGCTGG - Intergenic
1068948662 10:62755351-62755373 AAGGAGGAAGAAAGGGAGGAGGG + Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069230914 10:66007717-66007739 AGGGAGGAAGAAAGGGAGGGAGG - Intronic
1070182256 10:74025653-74025675 AGGGAGGGAGAAAGGGAGGCAGG + Intronic
1070391099 10:75971211-75971233 ATGGGGAGAGAAAGGGAAGAAGG - Intronic
1070481209 10:76884523-76884545 ATGGGGGAAGTGAAGGAAGCTGG + Intronic
1070549907 10:77482919-77482941 AAGGAGGGAGAAAGGGAAGGAGG - Intronic
1070780142 10:79132847-79132869 AAGGGAGAAAAAAGGGAAGTGGG - Intronic
1070888593 10:79925754-79925776 AGGAAGGAAGAAAGGGAAGGAGG - Intergenic
1071444352 10:85731846-85731868 AGGGAGGAAGAAAGGGAGGGAGG + Intronic
1071477724 10:86039124-86039146 ATGAGGGAAGGAAGGGAAGTGGG - Intronic
1071480019 10:86058095-86058117 AGTGGGGAAGAAAGGGAGGAAGG + Intronic
1071523628 10:86345920-86345942 TCAGGTGAAGAAAGGGAGGCAGG - Intronic
1072592929 10:96844096-96844118 AGGGGGGAAGGAAGGGAGGGAGG - Intronic
1072680230 10:97500361-97500383 ATGGGGGAACCAGGGGAAGCAGG + Intronic
1072723227 10:97793713-97793735 TGGGAGGAAGAAAGGGAAGAAGG - Intergenic
1072794808 10:98346586-98346608 AAGGGGGAGGAAAGGGAAGAGGG + Intergenic
1073215292 10:101832853-101832875 AAGGGGGAAGAGAGGGCATCTGG - Intronic
1073312881 10:102556758-102556780 AGGGAGGAAGGAAGGGAAGAAGG + Intronic
1073590812 10:104756009-104756031 AGGCAGCAAGAAAGGGAAGCAGG - Intronic
1073943969 10:108729935-108729957 AGGGAGGAAGAGAGGGAAGGAGG + Intergenic
1073943975 10:108729955-108729977 AGGGAGGAAGAGAGGGAAGGAGG + Intergenic
1073943981 10:108729975-108729997 AGGGAGGAAGAGAGGGAAGGAGG + Intergenic
1073943987 10:108729995-108730017 AGGGAGGAAGAGAGGGAAGGAGG + Intergenic
1074020151 10:109574276-109574298 ACTGGGAAACAAAGGAAAGCAGG - Intergenic
1074388287 10:113034964-113034986 AAAGGGGAGGAAAGGGAAGGAGG - Intronic
1074609129 10:115004429-115004451 ACGGAGGGAGGGAGGGAAGCAGG - Intergenic
1074813802 10:117130035-117130057 AGGAGGGGAGAAAGGGAAGAAGG + Intronic
1074830831 10:117247469-117247491 AGGTGGGAAGAACAGGAAGCGGG - Intronic
1074885438 10:117689323-117689345 AAGGGGGAAGAAGGGGAGGGAGG + Intergenic
1074983656 10:118639400-118639422 AGGGAGGAAGAAACGGAGGCAGG - Intergenic
1075065663 10:119287374-119287396 AGGGAGGAAGGAAGGGAAGAAGG + Intronic
1075614475 10:123881453-123881475 AGAGGGGAAGGAAGGGAAGCAGG + Intronic
1075624332 10:123950882-123950904 TGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1076117957 10:127913755-127913777 ACTGGAGAAGAAAGGAAGGCTGG - Intronic
1076578682 10:131491739-131491761 AGGGAGGAAGGAAGGGAAGGAGG + Intergenic
1077664798 11:4098289-4098311 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1077723596 11:4651374-4651396 GCAGGGGAAGAAAGCTAAGCAGG + Intronic
1078484019 11:11705381-11705403 AGGGAGGGAGAAAGGGAAGGAGG + Intergenic
1078861655 11:15253571-15253593 AAGGAGGAAGAAAAGGAAGTTGG + Intergenic
1078923240 11:15850949-15850971 ACAGAGAGAGAAAGGGAAGCAGG - Intergenic
1078923647 11:15854461-15854483 AGGAGGGAAGGAAGGGAAGAAGG + Intergenic
1079035335 11:17014901-17014923 ACAGGGGAAGAGAAGGAGGCTGG - Intergenic
1079567849 11:21904594-21904616 AGGAAGGAAGAAAGGAAAGCAGG + Intergenic
1080046680 11:27816086-27816108 AGGGAGAAAGAAACGGAAGCTGG - Intergenic
1080145827 11:28982403-28982425 AGGAAGGAAGAAAGGAAAGCTGG + Intergenic
1080820016 11:35796700-35796722 TGGGGGGAGGAAAGGGAAGCTGG + Intronic
1081325212 11:41736574-41736596 ATGGAGGATGAAAGGGCAGCAGG + Intergenic
1081680202 11:44997145-44997167 AGGGGGCAAAAGAGGGAAGCAGG + Intergenic
1081935308 11:46899827-46899849 ACGGGGGAAGGCAGGCAAGGTGG - Intronic
1081937941 11:46917946-46917968 GCGTGCGAAGAAAGGGAGGCGGG - Intronic
1082053857 11:47796520-47796542 AAGGGGGAAGAAAGGAAAGGAGG + Intronic
1082772425 11:57218621-57218643 TCGGGGAAAGAATGGGAAGGGGG + Intergenic
1082842141 11:57698537-57698559 ACTGAGGAAGAAAGTAAAGCAGG - Exonic
1083309612 11:61777567-61777589 GCGGGGGAAGGAAGGGAGGGAGG + Intronic
1083310121 11:61779703-61779725 AAGGGAGAAGAAAGAGAAACGGG - Intronic
1083433269 11:62626017-62626039 ATGGGGGAAGGAGGGGAAGCCGG - Intronic
1083583519 11:63839829-63839851 AAGGGAAGAGAAAGGGAAGCTGG - Intronic
1083605871 11:63978611-63978633 AGAGGAGGAGAAAGGGAAGCTGG - Intronic
1083913065 11:65721050-65721072 AGGGGGGAAGGAAGGGAGGCAGG - Intergenic
1084662518 11:70554535-70554557 AGGGGGGAGGAGAGGGAATCTGG - Intronic
1084771013 11:71343051-71343073 ACAGGGGAACACAGGGAAGGTGG + Intergenic
1085760973 11:79241294-79241316 AAGGAGGAAGACAGGGAAGGAGG + Intronic
1085810232 11:79673423-79673445 AATGGGGTAGAAATGGAAGCTGG - Intergenic
1086584888 11:88439287-88439309 ATGGGGGAAGAGAGGGATGAAGG + Intergenic
1088711643 11:112513806-112513828 ACTGGGGAGGAAAGAGAAGCAGG + Intergenic
1088768269 11:113007046-113007068 AAGGGAGAAGGAAGGGGAGCAGG - Intronic
1088868054 11:113867828-113867850 AGGGAGGAAGAAAGGGAGGAAGG + Intronic
1089132971 11:116226580-116226602 ACTGGGGAAGAAAGGGGAACAGG + Intergenic
1089453002 11:118610092-118610114 TCGGGGGAAGAAAGGACAGGCGG - Intronic
1089598858 11:119600814-119600836 AGTGGAGCAGAAAGGGAAGCGGG + Intergenic
1089691524 11:120189736-120189758 AGGGAGGAAGAAAGGGAGACAGG + Intergenic
1089894500 11:121915849-121915871 AGGGAGGAAGAAAGGGAGGGAGG - Intergenic
1090264732 11:125346816-125346838 AGGGGGGAAGGAAGGGAGGAAGG + Intronic
1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG + Intronic
1090443541 11:126744357-126744379 AGAGAGGATGAAAGGGAAGCTGG + Intronic
1091102501 11:132888090-132888112 AAGGGGGAATAAAGAGAAGAGGG + Intronic
1091112697 11:132984951-132984973 ACGGGGGAACAAAGGACAGGAGG - Intronic
1091430951 12:434244-434266 ACAGGTAAAGAAAGGTAAGCAGG - Intronic
1091783969 12:3231221-3231243 AGGGGAGAATGAAGGGAAGCGGG + Intronic
1092195620 12:6548160-6548182 GCTGGAGTAGAAAGGGAAGCGGG + Exonic
1092258768 12:6941394-6941416 ATCGGGGCAGAAAGGGAGGCCGG - Exonic
1092940483 12:13403026-13403048 AGTGGGGAAGAAAGAGAAGCAGG + Intergenic
1093796731 12:23321832-23321854 ACTGGTGAAGAAGGGCAAGCAGG - Intergenic
1094019574 12:25899990-25900012 AAGGGGGAAGAAAGGGTAAAGGG - Intergenic
1094189128 12:27679057-27679079 ATGGGGGAAGAAAAAAAAGCAGG + Intronic
1094500461 12:31016541-31016563 AGGGAGGAAGAGAGGGAAGGAGG + Intergenic
1094636702 12:32233509-32233531 AAGGGGGAAGAACGGGAGGGAGG - Intronic
1094696853 12:32828150-32828172 ATGGGGGAAGAAATAGAATCTGG + Intronic
1095801107 12:46269955-46269977 AAGCGGGAAAAAAGGGAACCAGG - Intronic
1095989510 12:48024945-48024967 GCGGAGGAGGAAAGGGAAGGTGG + Exonic
1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG + Intronic
1096777681 12:53973990-53974012 AGGGGGGAGGCAAGGGGAGCGGG + Intronic
1097129725 12:56803117-56803139 AGGGAGGAAGAAAGAGAATCAGG - Intergenic
1097350608 12:58544510-58544532 AAGAGAGAAGAAAGGGAAGAAGG - Intronic
1097466967 12:59938378-59938400 AAGGGGAAAGAAAGGAAAGGAGG + Intergenic
1097472783 12:60016539-60016561 AGGGAGGAAGGAAGGGAAGGAGG - Intergenic
1097879113 12:64671178-64671200 ACCAGGAAAGAAAGGGAGGCAGG + Intronic
1098406037 12:70126887-70126909 ACACAGGAAGATAGGGAAGCAGG - Intergenic
1098763223 12:74451369-74451391 AAAGGAGAAGAAAGGTAAGCAGG + Intergenic
1099595426 12:84656923-84656945 ACAGGGGAAGAAAGAGAATGAGG - Intergenic
1099760427 12:86913343-86913365 ATGGAAGATGAAAGGGAAGCAGG - Intergenic
1100877183 12:98974957-98974979 AGGGAGGAAGAAAGGAAAGAAGG - Intronic
1100950788 12:99847303-99847325 CTTGGGGAAGAAAGGGGAGCAGG - Intronic
1101778768 12:107817153-107817175 ACAGGGGAAGCAAAGCAAGCAGG + Intergenic
1102331061 12:112031195-112031217 AGGAAGGAAGAAAGGGAATCAGG + Intronic
1102771073 12:115476911-115476933 AGGGGGAAAGAATGGGAAGGGGG - Intergenic
1102890732 12:116556823-116556845 AGGGGGGAAAAAAAGGGAGCGGG - Intergenic
1103343459 12:120233824-120233846 ACGCTGGCAAAAAGGGAAGCGGG - Intronic
1103388380 12:120551948-120551970 ACAGCGGGAGAACGGGAAGCAGG + Intronic
1103425505 12:120830379-120830401 AGGGGGGAAGAAGGGGGAGGGGG + Intronic
1103425551 12:120830464-120830486 AGGGGGGAAGAAGGGGGAGGGGG + Intronic
1103428183 12:120857068-120857090 ACAGGAGAAGAAAAGGAAGAAGG + Intronic
1103473042 12:121197369-121197391 AAGAGGGAAGGAAGGAAAGCAGG - Intergenic
1104112984 12:125721584-125721606 AAGGGGTAAGAAAAGGAAGGAGG + Intergenic
1104466373 12:128994073-128994095 AAGGGGGCAGGAAGGGAAGATGG - Intergenic
1104523972 12:129500665-129500687 ACGGGGGAAGGAGGAAAAGCGGG - Intronic
1104575941 12:129965896-129965918 TTGGGGGAAGAAAAGGAAGCTGG + Intergenic
1104683230 12:130766912-130766934 AGGGAGGAAGAGAGGGAAGGAGG + Intergenic
1105045764 12:133002009-133002031 ACGTGAGAAGAAAGGGAAGCGGG - Intronic
1105508797 13:21034298-21034320 AGTAAGGAAGAAAGGGAAGCTGG - Intronic
1106594431 13:31124421-31124443 AAGGGGGCAGAAAGAGGAGCTGG - Intergenic
1106594656 13:31125866-31125888 AAGGGGGCAGAAAGAGGAGCTGG + Intergenic
1106827799 13:33542908-33542930 AGGGCGGGAGAAAGGAAAGCAGG - Intergenic
1107375172 13:39796611-39796633 ACGGGGGCAGAGAGGGAGGGAGG + Intergenic
1107572167 13:41674262-41674284 AAGGGGGAAGAAAGGAAGCCTGG + Intronic
1107577592 13:41744026-41744048 CCTGAGGGAGAAAGGGAAGCAGG - Intronic
1107604927 13:42048279-42048301 CCTGGGGAAGAATGGGAACCTGG - Intronic
1108396679 13:49996987-49997009 ACGGGAGGGGAAGGGGAAGCGGG + Intronic
1108515120 13:51194236-51194258 AGGGGAGCAGACAGGGAAGCAGG - Intergenic
1109184843 13:59255686-59255708 ACGGTGGAAGAAAGGGAAGTGGG + Intergenic
1109321555 13:60816603-60816625 AGGGAGGAAGGAAGGGAAGAAGG - Intergenic
1109402714 13:61856397-61856419 ATGGGAGAAGAAAGAGAAGGTGG + Intergenic
1110325763 13:74213602-74213624 AGGGAGGAAGAGAGGGAAGGGGG - Intergenic
1110561074 13:76911207-76911229 GCAGGGGAAGAAAGGGAAGGAGG + Intergenic
1110832847 13:80051564-80051586 ATGATGGAGGAAAGGGAAGCAGG - Intergenic
1110834966 13:80073178-80073200 AGAGGGGAAGGCAGGGAAGCTGG - Intergenic
1111396349 13:87672939-87672961 ACGGAGGAAGAAGGGGAGGGAGG - Intronic
1111407694 13:87831329-87831351 AGGGGGAAAGAATGGGAAGGCGG - Intergenic
1111529857 13:89522125-89522147 AGGGAGGAAGAGAGGGAAGGAGG + Intergenic
1112248256 13:97754163-97754185 ACTGGGGGAGGAAGGGCAGCAGG - Intergenic
1112733135 13:102389107-102389129 AAAGGGGAAGAAGGGGAAGAAGG - Intronic
1113217428 13:108058719-108058741 AGGGAGAAAGAAAGGGAGGCAGG + Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1114042511 14:18692060-18692082 ATGGGGGCAAAAAAGGAAGCAGG + Intergenic
1114428516 14:22640360-22640382 AAGGGGGAAAAAAGAGAAGGAGG + Intergenic
1114548536 14:23520334-23520356 AAGGGGGAAGAAAAGGAGACTGG + Intergenic
1114720893 14:24880800-24880822 AAAAGGAAAGAAAGGGAAGCAGG + Intronic
1114939090 14:27583604-27583626 GCAGGGGAAGAAAAGGAGGCTGG + Intergenic
1115694000 14:35876924-35876946 AAGAAGGAAGAAAGGGAAGGAGG - Intronic
1115786047 14:36827047-36827069 ACAGGGGAACAAAAGGAAGAGGG - Intronic
1115825489 14:37267537-37267559 AAAGAGGAAGAAAGGGAAGAAGG - Intronic
1116340821 14:43721751-43721773 AGGGAGCAAGAAAGGGAAGGAGG + Intergenic
1116659610 14:47692206-47692228 AAGAGGGAAGAAAGGGAGGAAGG - Intergenic
1116950051 14:50871370-50871392 AAGGAGGAAGAAAGGGAATTAGG - Intronic
1117402772 14:55372614-55372636 ACTGGGGAAGAAAGGAAGGGAGG - Intronic
1117427414 14:55615356-55615378 ACGGGGGAAAAGGGGGAGGCAGG - Intronic
1117903503 14:60560396-60560418 AAGGGTGCAGAAAAGGAAGCTGG + Intergenic
1117918293 14:60701637-60701659 AAGGGGGAAGGAAGGAAAGAAGG - Intergenic
1118171883 14:63396012-63396034 AGGGGGGAAGAGAGGGGAGGGGG + Intronic
1118347311 14:64949829-64949851 ATGGGGGCAGAAAGGGTAGGAGG - Intronic
1118788157 14:69064103-69064125 AGGTGGTATGAAAGGGAAGCTGG + Intronic
1118994440 14:70823168-70823190 AGAGGGGAAGAAAGAGAAACAGG - Intergenic
1119479519 14:74950866-74950888 AGTGGGGAAGAATGGGGAGCTGG + Intronic
1119927013 14:78504199-78504221 ATGGGGTCAGAAAGGGAAACTGG + Intronic
1120288172 14:82532317-82532339 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1120935809 14:89893703-89893725 TTTGGGGAAGAAAAGGAAGCAGG - Intronic
1121513747 14:94535068-94535090 AGGGTGGTAGAAAGTGAAGCAGG + Intergenic
1121603201 14:95221296-95221318 ATGGGAGAAGAAGGGGAAGAGGG - Intronic
1121800277 14:96768952-96768974 AGGGAGGAAGGAAGGGAAGAAGG - Intergenic
1121800289 14:96768991-96769013 AGGGAGGAAGAAAGGAAAGAAGG - Intergenic
1122007374 14:98716565-98716587 ACAGGGGCAGAAAAGGAGGCTGG - Intronic
1122047488 14:99034419-99034441 AAGGGGAAAGAAAGGGGAGGGGG + Intergenic
1122101130 14:99410425-99410447 AGGTGGGATGAAAGGGCAGCTGG - Intronic
1122831697 14:104400761-104400783 AAGGAGGAAGACTGGGAAGCAGG - Intergenic
1123036583 14:105474322-105474344 ACCGAGCAACAAAGGGAAGCGGG + Intronic
1123632141 15:22268844-22268866 ACGGGGGAGAAAGGGGAAGTGGG - Intergenic
1124394702 15:29291080-29291102 TAGGGGGAAGAAAGGGATGGGGG - Intronic
1124439198 15:29674808-29674830 AGCGGGGAAGGAAGGGAGGCCGG - Intergenic
1124850161 15:33329119-33329141 ATGGGAGAAGAAGAGGAAGCAGG - Intronic
1124992740 15:34692018-34692040 TTTGGGGAAGAAAGAGAAGCAGG + Intergenic
1125550091 15:40538585-40538607 AAGGGCACAGAAAGGGAAGCCGG - Intronic
1126803359 15:52320684-52320706 ATGGGGAAAGAAAGTGTAGCTGG + Intronic
1127602859 15:60555694-60555716 AGGTGGGAAGAAAAGGAAGGTGG + Intronic
1127653613 15:61034240-61034262 AAGGGGGAAAAAGAGGAAGCAGG + Intronic
1128061765 15:64739793-64739815 TCGGGGGAAGGAAGTGAAGTGGG - Intergenic
1128311584 15:66634316-66634338 CTGGAGGTAGAAAGGGAAGCGGG + Intronic
1129845052 15:78764306-78764328 AGGGAGGAACAAAGGCAAGCTGG + Intronic
1130208775 15:81903517-81903539 TCTGGGGAAGAAAGGTAAGATGG - Intergenic
1130513517 15:84608141-84608163 AGGGTGGAAGAGAGGGAAGAGGG - Intronic
1131449209 15:92525332-92525354 GGGGAGGAAGAAAGGGAGGCAGG - Intergenic
1131449285 15:92525860-92525882 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1131833234 15:96367356-96367378 AAGGGGGAAAAAAGGCAAGATGG - Intergenic
1132010737 15:98274048-98274070 AAGGGGGAAGAAAGGGAGGTGGG - Intergenic
1132105245 15:99058648-99058670 AGTGGGGAAGAGAGGGAAGGGGG + Intergenic
1132271721 15:100532179-100532201 GATGGGGAAGAAGGGGAAGCGGG + Intronic
1132706394 16:1245312-1245334 CCTGAGGAAGAATGGGAAGCGGG - Intergenic
1133175967 16:4014839-4014861 ACTGGGAGAGAGAGGGAAGCTGG - Intronic
1133392688 16:5422549-5422571 GAGGGGGAAGAAAGGGGAGGAGG + Intergenic
1133431645 16:5742259-5742281 AGGGAGGAAGAAAGGAAAGAAGG - Intergenic
1133551158 16:6855802-6855824 AAGGAGGAAGGAAGGGAAGAAGG - Intronic
1133650497 16:7808249-7808271 ATGGGGGAAGGATGGGAGGCAGG + Intergenic
1133688296 16:8188060-8188082 ATGGGGGAAGTAAAGGAAGGGGG + Intergenic
1133839271 16:9394057-9394079 AGGGAGGAAGGGAGGGAAGCAGG - Intergenic
1133839286 16:9394097-9394119 AGGGAAGAAGGAAGGGAAGCAGG - Intergenic
1133839430 16:9394540-9394562 AGGGTGGAAGGGAGGGAAGCAGG - Intergenic
1133839442 16:9394572-9394594 AGGGTGGAAGGGAGGGAAGCAGG - Intergenic
1133839454 16:9394604-9394626 AGGGTGGAAGGGAGGGAAGCAGG - Intergenic
1135007500 16:18839600-18839622 ACAGAGGAAGGAAGGGAAGGAGG + Intronic
1135182846 16:20290520-20290542 AGGAGGGAAGAAAGGAAAGAAGG - Intergenic
1135840089 16:25868369-25868391 AAGGGGGAAGAGAGAGAAGCAGG - Intronic
1135927657 16:26709761-26709783 AGGAGGGAAGAAAGGAAAGAAGG + Intergenic
1136080266 16:27847772-27847794 AAGGAGGAAGAGAGTGAAGCGGG - Intronic
1136539857 16:30923371-30923393 ACGGGGGAACAATAGGACGCTGG - Intronic
1137039604 16:35598857-35598879 TTGGGAGAAGAAAGGGAAACAGG - Intergenic
1137683343 16:50369271-50369293 AAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1137723971 16:50644821-50644843 AGGAGGGAAGGAAGGGAAGGCGG - Intergenic
1137947993 16:52752591-52752613 AAGAGGGAAGAAAGGAAAGAGGG + Intergenic
1138540728 16:57685790-57685812 GCGGGGGAAGAACCGGAAGAAGG + Exonic
1138894822 16:61190803-61190825 GAAGGGGAAGAAAGGGAAGAAGG - Intergenic
1139320416 16:66109719-66109741 AAGGGGGAAGGAAGGGAAGAGGG + Intergenic
1139320451 16:66109812-66109834 AAGGGGGAAGGAAGGGAGGAGGG + Intergenic
1139341324 16:66269965-66269987 AGGGAGGGAGACAGGGAAGCAGG + Intergenic
1140018678 16:71215247-71215269 AAGGAGGAAGAAAGGGAGGAAGG + Intronic
1140033083 16:71353974-71353996 AAGGAGGATGAAAGGGATGCAGG - Intergenic
1140067086 16:71620793-71620815 AGGGAGGAAGAAAGGGGACCAGG - Intergenic
1140213900 16:72992331-72992353 ATGGGGGAAGGCAGGGAAGCTGG - Intronic
1140459869 16:75131052-75131074 ACAGGGACAGAAAGGAAAGCTGG - Intergenic
1140516945 16:75550129-75550151 ACTAGAGAAGAAGGGGAAGCGGG + Intronic
1140798633 16:78464348-78464370 AAGGAGGAAGAGAGGGAAGGAGG + Intronic
1141686914 16:85575464-85575486 AGGGGAGACGAGAGGGAAGCCGG - Intergenic
1141718510 16:85741379-85741401 ACAGGGGAAGGAAGGAAGGCAGG + Intronic
1141890307 16:86922091-86922113 AAGGGGAAGGAAAGGGAAGATGG + Intergenic
1142608433 17:1095121-1095143 GAGGGGGAAATAAGGGAAGCAGG + Intronic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143183819 17:4998985-4999007 AGGGAGAAAGAAAAGGAAGCCGG - Intronic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1143960559 17:10714530-10714552 TCTTGGAAAGAAAGGGAAGCTGG - Exonic
1144247757 17:13384356-13384378 AAGGGGGGAGAGAGGGAAGGAGG + Intergenic
1144298260 17:13899664-13899686 ATGGGGGAAGCAGGGTAAGCAGG - Intergenic
1144512993 17:15893505-15893527 AGGGAGGAAGAAAGGGAGGAGGG - Intergenic
1144663213 17:17084974-17084996 AAGGGGCAAGACAGGGAACCGGG + Intronic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1145868350 17:28255055-28255077 AAGGTGGAAGAAAGGAAAGGAGG + Intergenic
1146408826 17:32564528-32564550 AAGAGGGAAGGAAGGAAAGCAGG - Intronic
1146422234 17:32698341-32698363 AGGGGGGAAGAGAGGGAGGGAGG - Intronic
1146529521 17:33596440-33596462 ACGGGGGAGAAAAGGTAAGAGGG + Intronic
1147535241 17:41316457-41316479 ACCGGGGAAGGAAGAGATGCAGG + Intergenic
1147776569 17:42906129-42906151 AGGGAGAAAGAAAGGGAAGGAGG + Intronic
1147998969 17:44376565-44376587 TCTGAGGAAGAAAGGGAACCAGG + Intronic
1148085323 17:44990380-44990402 ATGGGGGAAGAAAGATAGGCAGG + Intergenic
1148341284 17:46875043-46875065 AAGGGGGAAGAGAGGAAAGGAGG - Intronic
1148548187 17:48532570-48532592 TCAGGAGAGGAAAGGGAAGCAGG + Intergenic
1148872816 17:50668700-50668722 AGGGAGGAAGAAAGGGATGTGGG - Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1149728820 17:58924273-58924295 AGGGAGGAACAAAGGGAAGGAGG + Intronic
1149742682 17:59062418-59062440 ATGGGGGAAGAAGGGGAACAGGG + Intronic
1149824182 17:59811981-59812003 AAGAAGGAAGAAAGGGAAGGAGG - Intronic
1150692797 17:67379063-67379085 GAAGGGGAAGAAAGGGAAGCCGG - Intronic
1151452432 17:74206534-74206556 GCTGGGGAAGAATGGGGAGCTGG - Intronic
1152166603 17:78712127-78712149 AGGGAGGAAGGAAGGGAAGGAGG + Intronic
1152888003 17:82863836-82863858 ATGGGGGCAGAGAGGGTAGCAGG + Intronic
1152917884 17:83051485-83051507 ACGGGGGCAGGAAGCGCAGCCGG + Intronic
1152926237 17:83089042-83089064 AGGGAGGGAGAAAGGGAGGCAGG + Intronic
1152992615 18:377080-377102 AAAGGGGAGGAAAGGGAAGAGGG + Intronic
1153243815 18:3054333-3054355 ACAAGGTCAGAAAGGGAAGCAGG - Intergenic
1153299822 18:3582871-3582893 AGGGAGGAAGAAAGGAAAGAAGG - Intronic
1153891955 18:9525406-9525428 ACAAGGGAAGAAAAGCAAGCAGG - Intronic
1153927488 18:9846949-9846971 AGGAGGAAAGAAAGGGAAGGTGG - Intronic
1154223773 18:12481560-12481582 AGGGAGGAAGAAAGGAAAGAAGG + Intronic
1155424220 18:25689457-25689479 AAGGGGGAAGAGAGGAAAGCAGG + Intergenic
1155506699 18:26540516-26540538 GAGGAGGTAGAAAGGGAAGCAGG - Intronic
1155829249 18:30492246-30492268 AGGGAGGAAGAAAGGGAGGAAGG + Intergenic
1155988755 18:32257567-32257589 ATGGAGGAAGGAAGGGCAGCTGG - Intronic
1156384210 18:36591399-36591421 ACGAGGTGAGAAAGGGAGGCTGG + Intronic
1156602088 18:38619558-38619580 AGGCAGGAAGAAAGGGAGGCAGG - Intergenic
1156755630 18:40521262-40521284 AGGAGGGAAGAAAGGAAAGGAGG - Intergenic
1156866377 18:41893206-41893228 ACGGGGGAAGGATGGAAAGAGGG + Intergenic
1156966907 18:43105487-43105509 AGGGAGGAAGAAAGGGAGGGAGG + Intronic
1157372761 18:47132059-47132081 AAAGGGGAAGCAAGGGAAGAGGG - Intronic
1157392926 18:47317873-47317895 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1157482374 18:48063545-48063567 AAAAGGGAGGAAAGGGAAGCAGG + Intronic
1157565911 18:48679222-48679244 ACAGCAGAAGAAATGGAAGCTGG - Intronic
1158984567 18:62801064-62801086 ATAGGGCAAGAAAGGGAAGGAGG - Intronic
1159028753 18:63209792-63209814 GTGGGGGAAGACAGAGAAGCTGG + Intronic
1159325103 18:66904641-66904663 GAAGGGGAAGAAAGAGAAGCAGG - Intergenic
1159487448 18:69082495-69082517 AGGGGGGAAGGAAGGGAAGAAGG + Intergenic
1159683699 18:71389435-71389457 AAGGGGGAGGGAAGGAAAGCAGG + Intergenic
1160313339 18:77818532-77818554 AAGAAGGAAGAAAGGGAAGATGG - Intergenic
1160460026 18:79032050-79032072 AAGGAGGAAGAGAGTGAAGCGGG + Intergenic
1160501947 18:79406003-79406025 ACGGGGCAGGAAAGGGGAGGCGG - Intronic
1161143494 19:2663349-2663371 ACTGGGGAAGAAAGAGGAGGGGG - Intronic
1161256548 19:3313142-3313164 AAGGGGGATGAGTGGGAAGCCGG + Intergenic
1161445899 19:4318959-4318981 AGGGGAGAAGAAAGGGGAGAGGG + Intronic
1161753946 19:6117744-6117766 AGGGGGAAAGGAAGGGAAGGAGG + Intronic
1161764589 19:6199690-6199712 CCGGGGGAAGAAAGGCGCGCAGG - Intergenic
1162072942 19:8165854-8165876 AGGGAGGAAGAGAGGGAAGGAGG + Intronic
1162306774 19:9879508-9879530 GCAGGGGGTGAAAGGGAAGCAGG - Intronic
1162887288 19:13705028-13705050 AGGAGGGAAGAAAGGGAGGGAGG + Intergenic
1163391857 19:17036035-17036057 ACAGGGCAAGAATGGGAACCTGG - Intergenic
1163432650 19:17277502-17277524 AGGCAGGAAGAAAGGGAAGAGGG - Intronic
1164591754 19:29511293-29511315 AATGAGGAAGAAAGGGAAGTCGG + Intergenic
1164744092 19:30598916-30598938 AGGGAGGGAGAAAGGGAAGAAGG - Intronic
1164818745 19:31227562-31227584 AAGGGGGAAGAAAGAGAGGATGG + Intergenic
1165142086 19:33705698-33705720 AGGGGGGCAGAAAGGGAGCCAGG - Intronic
1165158173 19:33800559-33800581 ACTGGGGAAGAAGGGAAAGAGGG - Intronic
1166350296 19:42194906-42194928 AAGGAGGAAGGAAGGGAAGGAGG + Intronic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1166861819 19:45815705-45815727 CCGGGGAAGGAAAGGGCAGCCGG + Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166962435 19:46506389-46506411 ATGGAGGAAGAAAGGAAAGGAGG + Intronic
1167195239 19:48023604-48023626 GGGAGGGAAGAAAGGGAAGGAGG + Intronic
1167626486 19:50592983-50593005 AGGGAGGAAGGAAGGGAAGGAGG - Intergenic
1167665253 19:50819742-50819764 GCGGGGGAAGGAGGGGGAGCTGG + Intronic
1168304278 19:55426662-55426684 ACTGGGTGGGAAAGGGAAGCAGG + Intergenic
1168351172 19:55676806-55676828 ACATGGGAAGACAGGGAGGCAGG - Exonic
1168611352 19:57803550-57803572 TCCGGAGAAGAAAGGGAAACGGG - Intronic
1202700502 1_KI270712v1_random:160479-160501 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
925186484 2:1850136-1850158 AAGGGGAAGGAAAGGGAAGGAGG - Intronic
925283587 2:2701701-2701723 AAGGCGGAAGAAAGGGAGACTGG - Intergenic
925467705 2:4123789-4123811 GCAGGTGAAGAAATGGAAGCAGG - Intergenic
925719549 2:6813750-6813772 AGGGAGGAAGAAAGGGAGGGAGG + Intergenic
926001687 2:9338626-9338648 ACAGTGGAAGAAAGGGTAGCTGG - Intronic
928118859 2:28567099-28567121 AAGGAGGAAGAAAGTAAAGCGGG + Intronic
928373709 2:30758937-30758959 AGGAGGGAAGAAAGGGAGGGAGG - Intronic
928373761 2:30759102-30759124 ACAGAGGAAGAAAGGGAGGGAGG - Intronic
928471372 2:31580205-31580227 GTGAAGGAAGAAAGGGAAGCGGG + Intronic
928555209 2:32416799-32416821 ACGGGGAAAGAAAGGGGAGGGGG - Intronic
929172814 2:38948577-38948599 AGGGAGGAAGAAAGGGAGGGAGG + Intronic
929664353 2:43822354-43822376 AGGGAGGTAGAAAGAGAAGCAGG - Intronic
929720298 2:44361328-44361350 GCGGGGGGAGAAAGGGGAGAAGG + Intronic
929815404 2:45227246-45227268 ACCGGGGAAAAAAGGGTAGTGGG + Intergenic
930092265 2:47539750-47539772 AAAGGGGAAGAAACGGACGCAGG + Intronic
930648338 2:53936732-53936754 AGGGGGGAAGAAAGGGAAAAAGG + Intronic
930669221 2:54130547-54130569 AGGGGGGCAGAATTGGAAGCAGG + Intronic
930826376 2:55700417-55700439 AGGAAGGAAGAAAGGGAAGGTGG - Intergenic
931319486 2:61162146-61162168 ACGAGAGAAGAATGGGGAGCTGG + Intronic
931724182 2:65092976-65092998 ACTGTGGCAGAAAGGGAAGCAGG - Intronic
931835626 2:66095917-66095939 ACAGCAGACGAAAGGGAAGCTGG - Intergenic
931855599 2:66299117-66299139 AAGGAGGAAGTCAGGGAAGCAGG + Intergenic
932120493 2:69095235-69095257 AAGGAGGAAGAAAGGAAAACAGG - Intronic
932155801 2:69416032-69416054 AAGGAGGAAGGAAGGCAAGCAGG + Intronic
932275646 2:70450398-70450420 ACTGGGGAAGAAAGTGAAGGAGG - Exonic
932567525 2:72918845-72918867 CTGGGGGAAGCAAGGGCAGCAGG + Intronic
933153266 2:78940547-78940569 AAGGAGGAAAATAGGGAAGCTGG + Intergenic
933191065 2:79334631-79334653 AGGGAGGAAGAAAGGAAAGAAGG + Intronic
933708430 2:85308352-85308374 AGGGAGGAAGAAAGGGAGGGAGG - Intronic
933727350 2:85434388-85434410 AGGGGAGAAGAGAGGGAGGCAGG + Intronic
934171430 2:89543952-89543974 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934281739 2:91618270-91618292 AAGGGAGAAGAAAGGAAGGCAGG - Intergenic
934659584 2:96136125-96136147 ACAGGGGGAGTGAGGGAAGCAGG + Intronic
935338095 2:102035308-102035330 AGGGGGGAAAAAAGAGAAACAGG - Intergenic
935706509 2:105861946-105861968 CAGGTGGAAGAAAGGGAAGGGGG - Intronic
936403657 2:112184271-112184293 ACGGGAGAAGAGAGGGCAGAGGG + Intronic
936556472 2:113502054-113502076 AAGAGGGAAGAATTGGAAGCTGG - Intergenic
936599613 2:113883082-113883104 ACGGGGGAAGACAGTGAGACAGG + Intergenic
936817452 2:116476215-116476237 AGGGAGGAAGGAAGGGAGGCAGG + Intergenic
937946277 2:127340992-127341014 ACGGGGGAAGCAAGGGGAGATGG + Intronic
938671175 2:133588337-133588359 AGGGAGGAAGGAAGGGAAGAAGG - Intergenic
938671182 2:133588361-133588383 AGGAGGGAAGAAAGGAAAGAGGG - Intergenic
940219906 2:151341081-151341103 TGGGGGGAAGAGTGGGAAGCGGG - Intergenic
940329009 2:152454666-152454688 ATGTGGGCAGAAAGGGATGCTGG + Intronic
940854938 2:158722550-158722572 TCTGAGGCAGAAAGGGAAGCAGG + Intergenic
941336044 2:164245084-164245106 AGGGAGGAAGGAAGGGAAACAGG - Intergenic
941849131 2:170161590-170161612 AGTGGGGAAGAAAGGGAAGGAGG - Intergenic
941924541 2:170882761-170882783 ACGGAGGAAGGAAGGAAAGAAGG + Intergenic
941976356 2:171409556-171409578 AGTGGGGGAGAAAGGAAAGCTGG - Intronic
942211767 2:173678283-173678305 AGGAAGGAAGAAAGGGAAGGAGG + Intergenic
942211793 2:173678365-173678387 AGGGAGGAAGGAAGGGAAGGAGG + Intergenic
942751443 2:179292308-179292330 AAGTAGGAAGAAAGCGAAGCTGG - Intergenic
942793176 2:179784316-179784338 TAGGGGGAAGAATGGGAAGAGGG + Intronic
943180746 2:184537519-184537541 AGGGAGGAAGGAAGGGAAGGAGG + Intergenic
944240451 2:197480688-197480710 AAGGGGTAACAAAGGGAAGGAGG + Intergenic
944472048 2:200064049-200064071 ACGGGGCATAAAAGGGAACCAGG + Intergenic
944661390 2:201924571-201924593 ATGGGGGAGGAGAGGGGAGCTGG - Intergenic
944663604 2:201940943-201940965 AGGGTGGAAGAAAGGTAAGAGGG - Intergenic
945041277 2:205745670-205745692 AAGGGGAAGGAAAGGGAAGAAGG + Intronic
945102551 2:206275099-206275121 GCAGGGGCAGAAAGGGACGCGGG - Intronic
945193563 2:207216108-207216130 GTGTGTGAAGAAAGGGAAGCAGG + Intergenic
945934320 2:215887455-215887477 TGGGGGCAAGAAAGAGAAGCAGG + Intergenic
946053042 2:216880040-216880062 AAGGGGAAAGGAAGGGAAGAGGG + Intergenic
946060141 2:216934440-216934462 AAGAAGAAAGAAAGGGAAGCAGG - Intergenic
946169506 2:217886214-217886236 ACGGGGTAGGAAGGGGAAGGAGG + Intronic
946271104 2:218594983-218595005 ATGGGAGAAGGAAGGGAAACAGG - Exonic
946310531 2:218880491-218880513 TGGGGGGAGGAAAGGGAAGGCGG + Exonic
946485172 2:220094660-220094682 GGGGAGGAAGAAAGGGAAGGAGG - Intergenic
946485187 2:220094711-220094733 AGGGAGGAAGAAAGGGAGGGAGG - Intergenic
946485198 2:220094743-220094765 AGGGAGGAAGAAAGGGAGGGAGG - Intergenic
946485203 2:220094759-220094781 AGGGAGGAAGAAAGGGAGGGAGG - Intergenic
946485208 2:220094775-220094797 AGGGAGGAAGAAAGGGAGGGAGG - Intergenic
946485213 2:220094791-220094813 AGGGAGGAAGAAAGGGAGGGAGG - Intergenic
946836036 2:223773597-223773619 AAGGGGGAAAAAAGGGAGGGAGG + Intronic
946899937 2:224362321-224362343 AGGTGGGAAGGAAGGGAAGGAGG + Intergenic
947860356 2:233353889-233353911 ACGGGGGAAGAAAGGGAAGCTGG - Intergenic
948145233 2:235703571-235703593 GCGGGGGAGGGGAGGGAAGCGGG - Intronic
948282708 2:236760246-236760268 AGGAAGGAAGAAAGGGAAGGAGG + Intergenic
948759900 2:240183961-240183983 AAGAGGGAGGAAAGGGGAGCCGG + Intergenic
948832345 2:240604163-240604185 AGGAGGGAAGGAAGGCAAGCAGG + Intronic
948949633 2:241240593-241240615 TCGTGGGAAGAAAGGGAGCCTGG - Intronic
1168846550 20:949045-949067 AAGGGGGAAGCAGGGGAAGCAGG + Intergenic
1168889823 20:1287798-1287820 AAGGGGGAAGGGAGAGAAGCCGG + Intronic
1169451526 20:5716088-5716110 AAGGAGGTAGAAGGGGAAGCAGG + Intergenic
1169638356 20:7720362-7720384 AAGGGTTAAGAAAGGGCAGCAGG + Intergenic
1169709728 20:8548081-8548103 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1169831344 20:9828864-9828886 ATGGGGGAAGGAAAGGAAGAAGG - Intronic
1169951416 20:11048494-11048516 ACTGGGGAAGAAAGGAAAGAAGG - Intergenic
1170022257 20:11849572-11849594 AGGGAGGAAGAAAGGAAAACAGG - Intergenic
1170292165 20:14782731-14782753 ACAGTGGAAGTGAGGGAAGCAGG - Intronic
1171343848 20:24451139-24451161 ACGGGGGCAGTAAGGAGAGCAGG - Intergenic
1171784118 20:29447898-29447920 AGGGAGGAAGAGAGGGAAGGAGG - Intergenic
1172285004 20:33734115-33734137 TTGGGTGAAGAAAGGGCAGCAGG + Intronic
1172442109 20:34973154-34973176 ACTGGGGCATAAAGGGGAGCGGG - Intergenic
1172443898 20:34983414-34983436 ACAGGGCAGGAAAGGGAAGGAGG - Intronic
1172620141 20:36313293-36313315 ACGGAGGGAGAAAGGCAGGCAGG - Intronic
1173005993 20:39140016-39140038 CCGGAGGAAGAAGGGGAAGAGGG - Intergenic
1173297372 20:41771708-41771730 GAGGCTGAAGAAAGGGAAGCAGG + Intergenic
1173456028 20:43202063-43202085 AGGGGGAAAGAAAGGGAAGCGGG - Intergenic
1173563017 20:44019828-44019850 ACAGGTGAAGAAAGTGAGGCCGG - Intronic
1173755512 20:45512203-45512225 ACCAGGGAAGAAAGGGGAGCTGG - Intergenic
1174015017 20:47480902-47480924 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1174581654 20:51576529-51576551 AGGAAGGAAGAAAGGGAAGAAGG - Intergenic
1174589478 20:51633901-51633923 AGGGAGGAAGAAAGGGAGGGAGG + Intronic
1174692042 20:52515979-52516001 AGGGAGGAAGGAAGGGAAGGAGG + Intergenic
1175003922 20:55662165-55662187 AGGGGGGAAGAAAGGGGAAAGGG - Intergenic
1175978441 20:62725288-62725310 AAGGGGGAAGGAAGAGGAGCAGG + Intronic
1176891650 21:14326740-14326762 AGGGAGGAAGAAAGGAAAGGAGG + Intergenic
1177047620 21:16190038-16190060 ACGGGGGAAGAGAGGGAGGGAGG - Intergenic
1177169235 21:17637595-17637617 AGGGAGGAAGAAAGGAAAGGAGG - Intergenic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1177762671 21:25419643-25419665 ACTGTGGAAGAGAGGGAGGCAGG + Intergenic
1177816534 21:25983850-25983872 ACGGGGGAAGGAAGGAAGGAAGG + Intronic
1178083459 21:29089815-29089837 AGGGAGGAAGGGAGGGAAGCAGG + Intronic
1178326037 21:31646264-31646286 AGAGTGGAAGAAAGGGAAGAGGG + Intergenic
1178796882 21:35752935-35752957 AAGGGGAAAGATAGGGAAGGAGG + Intronic
1179137202 21:38690074-38690096 AGGGAGGAAGAGAGGGAAGAAGG - Intergenic
1179614368 21:42572246-42572268 CCGGGGTAAGGAAGGGAACCTGG - Intronic
1179625451 21:42646497-42646519 ACGGAGGGGGAAGGGGAAGCTGG + Intergenic
1179658724 21:42861346-42861368 AGGGGGGAAGGAAGGGAGGGAGG + Intronic
1179768513 21:43594704-43594726 ACGGTGGGAGGAAGGGAAGGAGG + Intronic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180098535 21:45573382-45573404 TCGTGGGAAGAAAGAAAAGCAGG - Intergenic
1181443828 22:22953164-22953186 ACAGGGGAGGCAAGGTAAGCAGG + Intergenic
1181487628 22:23241543-23241565 AAGGGGCAAGACAGGGAAGATGG - Intronic
1181571640 22:23771164-23771186 CTGGGCCAAGAAAGGGAAGCGGG - Intronic
1181844754 22:25698179-25698201 AGGGAGAAAGAAAGGGAAGGAGG + Intronic
1182008314 22:26979677-26979699 AGGAAGGAAGAAAGGGAAGGAGG - Intergenic
1182440919 22:30363308-30363330 ACTGGGGAAGAACGGGAGCCAGG + Intronic
1182931433 22:34178182-34178204 GGGAGGGAAGGAAGGGAAGCAGG - Intergenic
1183417213 22:37689278-37689300 ACTGATGGAGAAAGGGAAGCAGG - Intronic
1183762574 22:39836812-39836834 AAGGAGGAAGAGAGCGAAGCGGG - Intronic
1184103733 22:42355398-42355420 AGGGGGGAAGAAAGGCAAAGTGG - Intergenic
1185151607 22:49167118-49167140 AGGGAGGAAGGAAGGGAAGGAGG - Intergenic
949413673 3:3794156-3794178 AAGGAGGAAGAAAGAGACGCGGG + Intronic
949457096 3:4250274-4250296 AAGGGGGAAGGAAGGGAAGAGGG + Intronic
949563965 3:5228371-5228393 AAGGAGGAAGAAAGGGAAAAAGG - Intergenic
949646853 3:6105480-6105502 AGGGAGGAAGAAAGGAAAGAAGG - Intergenic
950081059 3:10222460-10222482 ACTGGGGAAGAGAGGGCATCAGG - Intronic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951708664 3:25568498-25568520 AAGGGGGAAGAAAGGAAAAAAGG - Intronic
951760452 3:26141753-26141775 GAGAAGGAAGAAAGGGAAGCAGG + Intergenic
951858783 3:27227334-27227356 AAGGGGAAAGACATGGAAGCAGG + Intronic
952405238 3:32999343-32999365 AAGGGGGAAGACAGAGAAGTGGG + Intronic
952674687 3:36013400-36013422 AAGAGAGAAGAAAGGGAAGAAGG + Intergenic
953116076 3:39993711-39993733 AAGGGGGAAGACAGAGAAGTAGG - Intronic
953203643 3:40800472-40800494 GAGGAGAAAGAAAGGGAAGCAGG - Intergenic
953235478 3:41102786-41102808 AGGGGGAAAGAGAGGGAACCAGG - Intergenic
953312186 3:41890841-41890863 AGGGGGGAAGGAAGGGATGCGGG + Intronic
953335695 3:42092073-42092095 AGGGTGGAAGAGAGGGAAACGGG - Intronic
953439295 3:42904305-42904327 ACGAAGGAAGGAAGGGAAGGAGG - Intronic
953903694 3:46857694-46857716 AGGAGGGAAGAAGGGGAAGAAGG + Intergenic
954072235 3:48151409-48151431 AAAGGGGAAAAAAGGGAAGAGGG - Intergenic
954133812 3:48572924-48572946 TCAGGGGGAGACAGGGAAGCCGG - Exonic
954774448 3:53004197-53004219 AGGGAGGAAGGAAGGGAAGAAGG - Intronic
954782779 3:53073242-53073264 ACGGGGGAAGCATGGGATGTGGG - Intronic
954940224 3:54365467-54365489 AGGGAAGAAGAAAGGGAAGGAGG - Intronic
955041186 3:55319218-55319240 CAGAGGGAAGAATGGGAAGCTGG - Intergenic
955889247 3:63632385-63632407 AAGAAGGAAGAAAGGGAAGAAGG + Intergenic
956643371 3:71435198-71435220 AGAAGGGAAGGAAGGGAAGCAGG + Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956816221 3:72910847-72910869 GTGGCGGAACAAAGGGAAGCTGG + Intronic
956873820 3:73442974-73442996 AAGGAGGAAGAAAGGGAGGGAGG - Intronic
957416916 3:79917389-79917411 AGGAAGGAAGGAAGGGAAGCAGG + Intergenic
957555624 3:81761692-81761714 GCGGGGGGAGAAAGGGCAGGAGG - Exonic
957794186 3:84981655-84981677 AAGGAGGAAGAAAGGAAAGAAGG - Intronic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
960051888 3:113247157-113247179 AGGGAGGAAGAAAGGGAAGAAGG - Intronic
960452394 3:117826498-117826520 AGGAAGGAAGAAAGGGAAGAAGG + Intergenic
961003605 3:123390228-123390250 ATGGGGGAAGAAGAGGGAGCTGG + Intronic
961333954 3:126159037-126159059 ATGGAGGAAGAAGGGGAAGAAGG + Intronic
961735624 3:129000926-129000948 ACTGGGAAAGAGAGGGAAACAGG - Intronic
963071425 3:141308446-141308468 ATGGGGGAAGAGAGGGAAACTGG - Intergenic
963154434 3:142080413-142080435 ACGCAGGAAGGAAGGGAAGAAGG + Intronic
963156290 3:142100675-142100697 AGGTGTGAAGAAAGGGAAGGAGG - Intronic
963180914 3:142355077-142355099 ATGGGGGAAGATAGGGAGGAGGG + Intronic
963192308 3:142486444-142486466 AAGGAGGAAGAAAGGAAGGCAGG - Intronic
963638163 3:147825413-147825435 AGGGGGGAAGGAAGGGAGGAAGG - Intergenic
963772899 3:149407101-149407123 AAGAAGGAAGAAAGGGAAGAAGG + Intergenic
964040199 3:152252251-152252273 AGGGAGGAATAAAGGGAAGGAGG - Intronic
964334441 3:155639914-155639936 CAGGAGGAAGAAAGAGAAGCTGG - Intronic
964427615 3:156569715-156569737 ATGAGGGGGGAAAGGGAAGCAGG + Intergenic
965333520 3:167406838-167406860 ATGGGGGAAGAAATGGAAATAGG + Intergenic
965772197 3:172193139-172193161 AGGTGGGAAGGAAGGGAGGCAGG - Intronic
966421552 3:179739285-179739307 GCGGGGGAAGAACAGGCAGCAGG - Intronic
966869164 3:184278715-184278737 AAAGGGGAAGAAAGGGAGGGAGG - Intronic
966985448 3:185175792-185175814 GCGAGAGAAGAAAGCGAAGCAGG - Intergenic
967290536 3:187915355-187915377 TCCAGGTAAGAAAGGGAAGCAGG - Intergenic
967488133 3:190057883-190057905 ACTGAGGAAGAGAGGGAAGAAGG - Intronic
968339255 3:197941303-197941325 AGGAAGGAAGAAAGGGAAGGAGG - Intronic
969094158 4:4719525-4719547 ACGGGGCAAGAGAGAGATGCTGG + Intergenic
969994380 4:11296474-11296496 AGGGAGGAAGAAAGGAAAGAAGG - Intergenic
970023251 4:11592742-11592764 ACAGTGGAAGAAAGTGAAGCTGG - Intergenic
970122161 4:12768178-12768200 AGGGAGGAAGAAAGAGAAGAAGG + Intergenic
970369620 4:15393961-15393983 AAGGGGGAAGTAAGGGCAGAGGG + Intronic
970960456 4:21865346-21865368 AGGGAGGAAGAAAGGAAAGGAGG + Intronic
971055048 4:22903033-22903055 ATGGGAGGTGAAAGGGAAGCAGG + Intergenic
971091024 4:23346056-23346078 ACAGGGGCAGAAAAGGAAGGGGG + Intergenic
971468101 4:26987328-26987350 TGGGGAGAAGAAAGGGAAACTGG + Intronic
972281467 4:37605968-37605990 AGGGAGGAAGGAAGGGAAGAAGG + Intronic
972423587 4:38912286-38912308 ACTAGAGAAGAAAGGGAAGTGGG - Intronic
972682454 4:41319508-41319530 ACAGTGTAAGGAAGGGAAGCTGG - Intergenic
972779998 4:42279239-42279261 ACGTGGGAAGAAGAGGACGCGGG - Intergenic
972829751 4:42801777-42801799 GCGGAAGAAGAAGGGGAAGCAGG + Intergenic
973555441 4:52077196-52077218 AAGGAGGAAGAAAGGGAAGGAGG - Intronic
974020486 4:56688129-56688151 AGGGAGGAAGGAAGGGAAGGAGG + Intergenic
974162813 4:58161864-58161886 TCTTGGGGAGAAAGGGAAGCAGG + Intergenic
974183342 4:58412141-58412163 AAGGGAGAAGAAAGAGAAGAAGG - Intergenic
974782593 4:66572730-66572752 AAGGTGGAGGAAAGGGAAGTAGG - Intergenic
975778657 4:77818399-77818421 GCTGAGGAAGAAAGGGAAACTGG - Intronic
975905326 4:79204530-79204552 ACGGAGGGAGGAAGGGAAGGAGG - Intergenic
976143247 4:82015181-82015203 ACAGAAGAAGAAAGGGAAGGAGG + Intronic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
976479074 4:85518512-85518534 TGGGGGGAAGAATGGGAGGCGGG - Intronic
976546778 4:86344631-86344653 AGGGAGGAAGGAAGGGAAGCAGG + Intronic
976784495 4:88802681-88802703 AGGGGAGAAGAAAGGGATGCAGG - Intronic
977586872 4:98783828-98783850 AGGAGGGTAGAAAGGGAATCTGG + Intergenic
977763575 4:100771108-100771130 AGGAGGGAAGAAAGGGAGGGAGG + Intronic
977865769 4:102025746-102025768 AGGAAGGAAGAAAGGGAAGGAGG - Intronic
978404481 4:108364734-108364756 AGGTGGGAAGATGGGGAAGCAGG - Intergenic
978592883 4:110345199-110345221 AAGGGGGAAGAAAGGAAAGAAGG - Intergenic
978643362 4:110897928-110897950 ACATGTAAAGAAAGGGAAGCAGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979420895 4:120503636-120503658 AAGGAGGAAGAGAGTGAAGCAGG + Intergenic
979548981 4:121969144-121969166 ACAGTGGAAGAAAAGGAAGGAGG - Intergenic
979730605 4:124018595-124018617 AAGGAGGAAGAAAGGAAAGGAGG - Intergenic
980344593 4:131596423-131596445 AGGAAGGAAGAAAGGGAAGAAGG - Intergenic
980940344 4:139268132-139268154 AAGGGGGAAGGAAGGGAGGGTGG + Intronic
981086441 4:140689397-140689419 AGGGGGAAGGGAAGGGAAGCGGG - Intronic
981183241 4:141770084-141770106 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
982282570 4:153700032-153700054 ATGGTGGAAGAAGGGGGAGCAGG + Intergenic
982406695 4:155028603-155028625 AGAGGGAAAGAAAGGGAAGAAGG - Intergenic
982947265 4:161640190-161640212 TCTGGGGAAGAAAGAGAATCTGG + Intronic
983555064 4:169052596-169052618 AGGGAAGGAGAAAGGGAAGCTGG + Intergenic
983575426 4:169256280-169256302 AGGGAGGAAGAAAGGGAGGAAGG + Intronic
984243321 4:177244152-177244174 ACAGGAGAAGAAAGAGAGGCAGG + Intronic
984414917 4:179446068-179446090 AAGGGGGAAAAAAGGGAAACAGG + Intergenic
984485776 4:180367409-180367431 ATGGGGGAAGGCAAGGAAGCAGG + Intergenic
984623909 4:181984069-181984091 AAGGGGACAGAAAGGGAAGTGGG - Intergenic
985179328 4:187239543-187239565 AGGGAGGAAGGAAGGGAAGGAGG - Intergenic
985336894 4:188905597-188905619 CCGGAGGATGAAAGCGAAGCAGG - Intergenic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
985835247 5:2266408-2266430 AATGGGGAAGGCAGGGAAGCAGG + Intergenic
986310572 5:6547820-6547842 ACCTGGGAAGAAAAGGAAGAGGG + Intergenic
986313611 5:6571827-6571849 AAGGAGGAAGAAAGGGAGGGAGG + Intergenic
986522051 5:8630248-8630270 CCAGGGGTAAAAAGGGAAGCTGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
986881846 5:12183921-12183943 ACTGGGGAATGAAGAGAAGCAGG + Intergenic
987074933 5:14372226-14372248 GTGGGGGAAGAAAGAGAGGCGGG + Intronic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
988181407 5:27799009-27799031 GCGGAGGAAGTAAGGGAAGAAGG + Intergenic
988452638 5:31358755-31358777 AGGAGGGAAGAAAGGAAAGAAGG - Intergenic
988659709 5:33252163-33252185 AGGGAGGAAGAAAGGGAAGAAGG + Intergenic
989069622 5:37497166-37497188 AGGGGGGAAGGGAGGGAAGGAGG - Intronic
990350297 5:54909147-54909169 GCTGGGGAGGAAAGGAAAGCAGG - Intergenic
990717722 5:58657230-58657252 TGGGGGGAAGAATGGGAAGGGGG + Intronic
990990992 5:61684047-61684069 ACGGAGGAAGGAAGGGAGGAAGG - Intronic
991036765 5:62135207-62135229 AAGGGTGAAGCCAGGGAAGCGGG + Intergenic
991153625 5:63401935-63401957 ATGGGGAAAGTAAGAGAAGCAGG - Intergenic
991449037 5:66732272-66732294 AAGGTGGAAGAAAGGGCAGTAGG - Intronic
991469421 5:66952165-66952187 TCTGGGGAAGGAAGAGAAGCAGG + Intronic
992116242 5:73540890-73540912 AAGAGGGAAGAAAGGAAAGAGGG + Intergenic
992233197 5:74683663-74683685 TCTGGGGAAGAAAGGGGAGCAGG + Intronic
992523816 5:77585818-77585840 TGGGGGGAAGAAAGGGAGGAGGG + Intronic
994002727 5:94800081-94800103 ACTGGGGAAGAAACGAAAGAGGG - Intronic
994203851 5:97010175-97010197 AGGGAGGAAGAAAGGGAAGAGGG - Intronic
994731052 5:103490693-103490715 AGGGAGGAAGAGAGGGAAGGAGG - Intergenic
994737738 5:103576397-103576419 AGGGAGGAAGAGAGGGAAGGAGG + Intergenic
995217086 5:109607843-109607865 AGGAGGGAAGAAATGGAAGTGGG + Intergenic
995402790 5:111760418-111760440 AGGGAGGAGGAAAGGGAAGTAGG + Intronic
995941536 5:117591836-117591858 AAGGGGAAAGAGAGGGAAGTGGG - Intergenic
996189014 5:120515489-120515511 ACTGGTGAAGAAAGGGATGATGG + Intronic
996571939 5:124940994-124941016 AGGGTGGAAGTAGGGGAAGCAGG + Intergenic
997234476 5:132264864-132264886 AAGAGGGCAGATAGGGAAGCTGG - Intronic
997298124 5:132782354-132782376 CCGGGGGGAGATGGGGAAGCAGG - Intronic
997605485 5:135172994-135173016 AAGGGGGAAAAGAGGGAGGCAGG + Intronic
997629089 5:135353146-135353168 ACGAGGCACAAAAGGGAAGCAGG + Intronic
997981182 5:138468087-138468109 AAGGGGAAAGAAAGGGAAAAGGG + Exonic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998443313 5:142179879-142179901 AGGGAGGAAGAAAGGGGAACCGG + Intergenic
998444416 5:142187603-142187625 AGGGAGGAAGAAAGGGAGGAAGG - Intergenic
998533396 5:142906478-142906500 AGGGAGGAAGAAAGAGGAGCAGG - Intronic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998594577 5:143515559-143515581 ATGGGGAAAGGAAGGGAAGAAGG - Intergenic
999094105 5:148962917-148962939 AGGGAGGAAGAAAGAGCAGCAGG + Intronic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999658991 5:153839115-153839137 AGGGGAGATGAAAGGAAAGCAGG + Intergenic
1000209833 5:159098794-159098816 AAGGGGGGAGAAAGGAAAGAAGG + Intronic
1000275728 5:159733229-159733251 ATGAGAGAAGAAAGGGAAGGTGG - Intergenic
1000359091 5:160431353-160431375 AGTGGGGAAGAAAGGGAGGCAGG - Intergenic
1000465101 5:161566224-161566246 AAGGAGGAAGAAAGTGAACCAGG - Intronic
1000984902 5:167855872-167855894 AGGGAGGAAGGAAGGGAAGGAGG + Intronic
1001135255 5:169097449-169097471 AAGAAGGAAGAAAGGGAAGGAGG + Intronic
1001296889 5:170504642-170504664 ACAGGGGAACAAAAGGAAGAAGG - Intronic
1001415250 5:171541092-171541114 AAGGGGGAAGAAAGAAAAGAAGG + Intergenic
1001484686 5:172111150-172111172 CCAGGGTAAGAATGGGAAGCTGG + Intronic
1001919282 5:175587714-175587736 AAGAAGGGAGAAAGGGAAGCTGG + Intergenic
1001988099 5:176093065-176093087 ATGCAGGAAGAAAGGGAATCAGG - Intronic
1001989307 5:176103097-176103119 ATGCAGGAAGAAAGGGAATCAGG - Intronic
1002227563 5:177735041-177735063 ATGCAGGAAGAAAGGGAATCAGG + Intronic
1002228769 5:177745075-177745097 ATGCAGGAAGAAAGGGAATCAGG + Intronic
1002266577 5:178038708-178038730 ATGCAGGAAGAAAGGGAATCAGG - Intronic
1002593179 5:180305000-180305022 AGAGGGGAAGAAGGGGAACCAGG + Intronic
1002963398 6:1938926-1938948 AGGGAGGAAGGAAGGGAAGAAGG - Intronic
1002985353 6:2185192-2185214 AGGGAGGAAGAAATGAAAGCTGG + Intronic
1003308666 6:4950111-4950133 AGGGGGGACGAAAGGGAGACAGG + Intronic
1003516297 6:6821600-6821622 ACGGGGGAGGAGGGGGAAGAGGG + Intergenic
1004072261 6:12311319-12311341 ATGGGGTAAGAAAGGGAGCCTGG + Intergenic
1004114298 6:12750550-12750572 AGGGGGGAAGGAAGGGAGGAGGG + Intronic
1004516975 6:16328509-16328531 AAGGGAGGAGAAAGGGAAGGAGG + Intronic
1004581516 6:16958696-16958718 AGTGGGGTAGAAAGGGAAGCAGG + Intergenic
1004682119 6:17906383-17906405 AAGGGGGAAGAAAGGAAGGCAGG - Intronic
1004751261 6:18565304-18565326 AGGGAGGGAGAAAGGGAGGCAGG - Intergenic
1004751465 6:18566148-18566170 AGGGAGGAAGAAAGGGAGGAAGG - Intergenic
1004816030 6:19312548-19312570 AATGGGGATGATAGGGAAGCAGG - Intergenic
1004958428 6:20756924-20756946 AGGAGGGAAGGAAGGGAAGGAGG - Intronic
1005528172 6:26673190-26673212 AAGGAGGAAAAAAGGGAAGAAGG - Intergenic
1005542623 6:26828449-26828471 AAGGAGGAAAAAAGGGAAGAAGG + Intergenic
1005926439 6:30449442-30449464 AGGGGAAATGAAAGGGAAGCAGG + Intergenic
1005928161 6:30462014-30462036 AGGGGAAATGAAAGGGAAGCAGG + Intergenic
1005943276 6:30577413-30577435 AGTGGTGAAGAAAGGGAAGAAGG + Exonic
1006046806 6:31305820-31305842 CCTGGAGAAGAAAGGGAAGCTGG + Intronic
1006443726 6:34067521-34067543 AGGGAGGAAGAAAGGGAGGGAGG - Intronic
1006443746 6:34067585-34067607 AGGGAGGAAGAAAGGGAGGGAGG - Intronic
1006457287 6:34139132-34139154 CGGGGGAAGGAAAGGGAAGCCGG - Intronic
1006591132 6:35158585-35158607 AAGGGGGAAGGAAGGAAAGAAGG - Intergenic
1006862655 6:37183289-37183311 AAGGGAGAAGAAAGGGGACCCGG + Intergenic
1007046751 6:38783521-38783543 ACACAGGAAGGAAGGGAAGCAGG - Intronic
1007104107 6:39271664-39271686 AGGAAGGAAGAAAGGGAAGAAGG - Intergenic
1007134432 6:39507715-39507737 AGGAGGGAAGGAAGGGAGGCAGG - Intronic
1007462004 6:42025771-42025793 AGGGAGGCAGAAAGGGAACCAGG + Intronic
1007608343 6:43132263-43132285 GCAGGGGAAGAAAAGGATGCTGG + Intronic
1007722128 6:43891290-43891312 ACGCTGGAAGAAAGAGAAACAGG - Intergenic
1007923437 6:45631106-45631128 AAGGAGGGAGAAAGGGAAACCGG - Intronic
1008385100 6:50880299-50880321 ACGGGAGAAGAAAGGAAGGGAGG - Intergenic
1009013438 6:57870566-57870588 AAGGAGGAAAAAAGGGAAGAAGG + Intergenic
1009248286 6:61267573-61267595 AGGGAAGAAGAAAGGGAAGGAGG + Intergenic
1009825665 6:68862728-68862750 AGTGGAAAAGAAAGGGAAGCAGG - Intronic
1010357219 6:74948311-74948333 AGGGAGGAAGAAAGGGAGGGAGG + Intergenic
1010991049 6:82480219-82480241 AGGGAGGAAGACAGGGAAGTGGG + Intergenic
1011632321 6:89339516-89339538 AGGGGGGAAGGGAGGGAAGTGGG + Intronic
1011775430 6:90725321-90725343 ACTGGGGAAGAAAAGGGAGAAGG + Intergenic
1012292075 6:97469184-97469206 AGGAAGGAAGAAAGGGAGGCAGG - Intergenic
1012309775 6:97708737-97708759 ACGAGGAGAGAAAGGGAAGCTGG - Intergenic
1012796546 6:103769563-103769585 CCAGAGGAAGGAAGGGAAGCTGG - Intergenic
1013106446 6:107029932-107029954 CTGGGGGAAGAAAGTGGAGCAGG - Intronic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1013916923 6:115351520-115351542 AGGGAGGAAGAGAGGGAGGCAGG + Intergenic
1013974758 6:116064471-116064493 AATGGGGAGGAAATGGAAGCAGG + Intergenic
1014023299 6:116616072-116616094 ACGGAGGAAGGAAGGGAGGGAGG - Intergenic
1015099706 6:129462111-129462133 AGGGAGGAAGAGTGGGAAGCCGG + Intronic
1015149477 6:130020716-130020738 GAGGGGGAGGAAAAGGAAGCGGG - Intronic
1015414648 6:132934557-132934579 AGGGGAGAAGACAGGGAAGAAGG + Intergenic
1015486818 6:133780998-133781020 AGGGAAGAAGAAAGGGAAGTGGG + Intergenic
1016532617 6:145075207-145075229 AGGGAGGAAGGAAGGGAAGAAGG + Intergenic
1016532628 6:145075251-145075273 AGGGAGGAAGAGAGGGAAGAAGG + Intergenic
1016988647 6:149913554-149913576 AGGAGGGAAGACAGGGAAGGAGG + Intergenic
1017007957 6:150041447-150041469 AGGAGGGAAGATAGGGAAGGAGG + Intergenic
1017013885 6:150084441-150084463 ATGGAGGAAGAAAGGAAGGCAGG - Intergenic
1017586394 6:155929782-155929804 ATGGGAGAAGAAAGGGAAAAAGG - Intergenic
1017755072 6:157522736-157522758 AGGGAGGAAGAAAGGGAGGGAGG - Intronic
1017931918 6:158963417-158963439 AAGGGGGAGGGAAGGGAAGGGGG - Intergenic
1018017408 6:159724897-159724919 AGGGGGGAAGAGAGGGAGGGAGG + Intronic
1018137414 6:160790667-160790689 TTGGGAGAAGAAAGGGAAACGGG + Intergenic
1018839758 6:167508698-167508720 ACAGGGGAAGGAAGGGAACAGGG - Intergenic
1019409868 7:901747-901769 GCGGGGGAAGGAGGGGAGGCGGG - Intronic
1019699936 7:2469844-2469866 ACGAAGGAAAAAAGGGAAGAGGG + Intergenic
1019717067 7:2543974-2543996 ATGGGGGAAGAGAGGGAAAAGGG + Intronic
1019887285 7:3916236-3916258 ACATGTGAAGAAAGGGAATCAGG + Intronic
1020026837 7:4905424-4905446 GAAGGGGAAGAAAGGGAAGAAGG + Intergenic
1020331161 7:7018150-7018172 ATGCGGGGAGAAAGGGAATCAGG + Intergenic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021324627 7:19251328-19251350 AAGGGGAAAGAAATGTAAGCAGG - Intergenic
1021470871 7:21001339-21001361 AGGGGAGAAGAAAGGGAAGAAGG + Intergenic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1022421079 7:30224001-30224023 ACTGTGGAAGAAAGGGAGGATGG - Intergenic
1022466993 7:30658639-30658661 TCGGGGGCAGACAAGGAAGCAGG - Intronic
1022498316 7:30866854-30866876 AAGGAGGAAGAAGGGAAAGCAGG - Intronic
1022903276 7:34831469-34831491 AGGGGGGAAGAAAGGGAGGGAGG + Intronic
1023032454 7:36102392-36102414 AGGGGGGAAGGAAGGAAAGAAGG + Intergenic
1023287160 7:38631589-38631611 GCGGGGGAAGAAAGAGAAAGAGG + Intergenic
1024004008 7:45212190-45212212 ACTGGGGAAGAAAGGGGAGAAGG - Intergenic
1024037894 7:45524096-45524118 TGGGGAGAAGAAAGGCAAGCAGG - Intergenic
1024250648 7:47503353-47503375 AAGGGGGAGGAAAGGGTGGCAGG - Intronic
1024669872 7:51584738-51584760 ACAGGGCAGGGAAGGGAAGCAGG - Intergenic
1024737755 7:52323569-52323591 AGGGGGGAGGAAAGGGAAGGGGG - Intergenic
1025078544 7:55963773-55963795 AAGGAGGAAGGAAGGGAGGCAGG - Intronic
1025284033 7:57648437-57648459 ACTGGGACAGAAAAGGAAGCTGG - Intergenic
1025321606 7:58100272-58100294 ATGAGGGAAGGAAGGGAAGGAGG + Intergenic
1026145703 7:67744630-67744652 AGGGAGGAAGAAAGGGACCCTGG - Intergenic
1026510716 7:71025221-71025243 AAGGGGGAAAAAAGGGAATGTGG + Intergenic
1026638880 7:72106908-72106930 AGGAGGGAAGAAAGGAACGCAGG + Intronic
1026871030 7:73852018-73852040 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1026949724 7:74339034-74339056 GCAGGGGAGGGAAGGGAAGCTGG - Intronic
1028309189 7:89309132-89309154 AGTGGGGAAGGAAGGGAAGGGGG - Intronic
1028637145 7:93002050-93002072 ACTTGGGGAGAAAGGGAAGAAGG - Intergenic
1029412836 7:100426830-100426852 GAGGGGGAGGAAAGGGAAGGAGG - Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1030109715 7:106016550-106016572 AGGGAGGCAGAAAGTGAAGCTGG - Intronic
1030229185 7:107187901-107187923 ACTGGTGAAGAAAGTGAAGGGGG - Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030623810 7:111821337-111821359 AAAGAGGAAGAAGGGGAAGCAGG + Intronic
1030645097 7:112052443-112052465 GGGGGGGAAGAAGGGGAAACAGG - Intronic
1030762132 7:113364972-113364994 AAGGAGGAAGAGAGAGAAGCGGG - Intergenic
1031350312 7:120722834-120722856 CCAGGGGAAGACAGAGAAGCTGG - Intronic
1031474995 7:122210499-122210521 GCGGGGGCTGAAAGGGAAGTGGG + Intergenic
1031854638 7:126907321-126907343 GAGGGGGAAGAAGGGGAAGGAGG + Intronic
1031957135 7:127954146-127954168 AGGGGGGAAGGAAGGAAAGCAGG - Intronic
1032194114 7:129779975-129779997 GCGGGGGAACAAAGGGGAGCCGG + Intergenic
1032231649 7:130079857-130079879 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032231659 7:130079885-130079907 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032231678 7:130079945-130079967 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032525785 7:132577391-132577413 AGGGAGGGAGGAAGGGAAGCAGG - Intronic
1032539922 7:132694421-132694443 ATGGGTGGAGAAAGGGAGGCTGG - Intronic
1032948696 7:136882367-136882389 AGGGGAGAAGAAAGGGGAGGAGG - Intronic
1033096252 7:138433892-138433914 AGGGAGGAAGGAAGGGAAGAAGG + Intergenic
1033245642 7:139714491-139714513 AGGGAGCAAGAAGGGGAAGCTGG + Intronic
1033275287 7:139967140-139967162 ACTGGGGAAGGCATGGAAGCTGG - Intronic
1034061223 7:148092442-148092464 ATGGATGAAGAAATGGAAGCAGG + Intronic
1034459423 7:151190324-151190346 GCGGGGGCAGGATGGGAAGCAGG - Intergenic
1034532149 7:151702505-151702527 ATAGGGGAAGGAAGGCAAGCGGG - Intronic
1034877977 7:154742088-154742110 AAAGAGGAAGAAAGGGAGGCAGG + Intronic
1035110245 7:156475793-156475815 ACGTGGGAAGCAAGGGAAATGGG - Intergenic
1035289107 7:157825986-157826008 ACGGGGGAACAAAGTGAAAGTGG - Intronic
1035316752 7:158001376-158001398 ACGTGCAAAGAATGGGAAGCTGG + Intronic
1035707031 8:1683628-1683650 GGGGAGGAAGAGAGGGAAGCAGG + Intronic
1036385903 8:8281395-8281417 ACGAAGGAAGAAAGGGAGGGAGG + Intergenic
1036530118 8:9577492-9577514 ACGGGAGGTGAAGGGGAAGCAGG + Intronic
1036652275 8:10652767-10652789 ACGGGAGGAGATAGGGAATCAGG - Intronic
1036688172 8:10925246-10925268 AGGAGGAAAGGAAGGGAAGCGGG + Intronic
1036978962 8:13446974-13446996 ACGGAAGAAGGAAGGGAAGAAGG + Intronic
1037456701 8:19071399-19071421 AGGCAGGAAGAAAGGGGAGCTGG - Intronic
1037461010 8:19109623-19109645 AGGAGGGAAAAAAGGGAAGGAGG - Intergenic
1037604064 8:20422667-20422689 ACGAGGGCAGAAAGGGGACCTGG - Intergenic
1037743862 8:21628139-21628161 TCTGGGGAAGACAGGGAAGCAGG - Intergenic
1038231902 8:25708356-25708378 AGGGAGGAGGAAAGGAAAGCAGG + Intergenic
1038250276 8:25897507-25897529 GCAGGGAAAGAAAGGGAAGGAGG - Intronic
1038275511 8:26117712-26117734 CACAGGGAAGAAAGGGAAGCAGG - Intergenic
1038512989 8:28158017-28158039 ACTGTGGAAGAAAGGAAAGGAGG - Intronic
1039294554 8:36135746-36135768 AGGGCGGAAGAAAGGGCAGTGGG + Intergenic
1039321237 8:36434393-36434415 AAGGAGGAAGAAAGGGAGGGTGG + Intergenic
1039779546 8:40770509-40770531 AGGGAGGAAGAAAGGGAGGGAGG - Intronic
1040009713 8:42651248-42651270 AGGGAGGAAGAAAGGCAGGCAGG - Intergenic
1040795678 8:51288222-51288244 AAGAGGGGAGAAAGGGAAGGGGG - Intergenic
1041097180 8:54361641-54361663 AGGAAGGAAGAAAGGGAAGAAGG - Intergenic
1041273205 8:56129937-56129959 AGAGGAGGAGAAAGGGAAGCAGG + Intergenic
1042130417 8:65582437-65582459 AGAGGAGAAGAAAGGGAAGAAGG + Intergenic
1043869265 8:85413111-85413133 ATGCAGGAAGAAAGGGAAGAAGG - Intronic
1044253202 8:90028696-90028718 AGGGAGGAAGGAAGGGAAGGAGG - Intronic
1044417671 8:91954460-91954482 AAGGGGTCAGAAAGGGAAGATGG - Intergenic
1044866483 8:96575953-96575975 AAGGGGGAAGACAGAAAAGCAGG - Intronic
1044891752 8:96843330-96843352 AAGGAGGAAGGGAGGGAAGCAGG + Intronic
1045170266 8:99658431-99658453 ACAGGGGAAAAAAAGCAAGCAGG - Intronic
1045412089 8:101929554-101929576 AGGGAGGAAGGAAGGGAAGGAGG + Intronic
1045564574 8:103299673-103299695 ATGGAGGAAAAAAGGAAAGCTGG - Intronic
1045850775 8:106696119-106696141 TCAGGGAAAGAAAGGGAAGGAGG - Intronic
1046220793 8:111211584-111211606 AAGGAGAAAGAAAGGGAAGAGGG - Intergenic
1046320186 8:112564314-112564336 AGGGGAGAAGGAAGGGAAGAAGG - Intronic
1046369764 8:113286883-113286905 AAAGGGAGAGAAAGGGAAGCAGG + Intronic
1046552566 8:115734904-115734926 AAGGGGAAAGAAAGAGAATCAGG - Intronic
1046831928 8:118755847-118755869 AAGGGGGAATGAAGGAAAGCCGG + Intergenic
1046910489 8:119621022-119621044 ATGTCGGAGGAAAGGGAAGCAGG - Intronic
1047023610 8:120804219-120804241 AGGGAGGGAGAAAGGGAAGGAGG - Intronic
1047207155 8:122811700-122811722 AGGGGGGAAGAGAAGGAAGGTGG + Intronic
1047629564 8:126692215-126692237 AGGGAGGAAGAAAGGGAAGGAGG - Intergenic
1048007661 8:130432085-130432107 AAGGGGGAGGAAAGGGAAGAGGG + Intronic
1048150355 8:131887714-131887736 ACCTGGGAAGAAAGGCAGGCAGG - Intergenic
1048237108 8:132701597-132701619 AGGGAGGAAGAAAAGGAAGGTGG + Intronic
1048522153 8:135166415-135166437 AGGGAGGGAGAGAGGGAAGCTGG - Intergenic
1048894441 8:138977355-138977377 ATGGGGGAAGGAAGAGAGGCAGG + Intergenic
1049705328 8:144039562-144039584 ACGGTTGAGGAAAGGGCAGCGGG + Intronic
1049896550 9:115285-115307 AAGAGGGAAGAATTGGAAGCTGG + Intergenic
1050274890 9:3986493-3986515 ACTGGGGAAGAAAGGTCAGAGGG - Intronic
1050301294 9:4261364-4261386 AGGAGGGAAGAAAGGGAGACAGG + Intronic
1050770092 9:9187585-9187607 AGAGGGAAAGAGAGGGAAGCAGG - Intronic
1051047461 9:12891615-12891637 AGGCAGGAAGAAAGGGAAGAAGG + Intergenic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1051410501 9:16785339-16785361 ACGGGGAAAGTAAGGGGATCAGG + Intronic
1052410968 9:28120574-28120596 TGGGGTGAAGAAAGGGAGGCGGG - Intronic
1052753896 9:32521340-32521362 TGGGGGGAAGAAAAGGAAGAGGG + Intronic
1052994649 9:34545431-34545453 ACGATGGAAGAAAGGAAAGGAGG - Intergenic
1053415131 9:37942697-37942719 GCGGGGAAAGAGATGGAAGCAGG + Intronic
1053436852 9:38081444-38081466 ACGTGGGGAGAAAGGAAATCAGG + Intergenic
1053599316 9:39594053-39594075 AGGGTGGAAGAAAGGGAGGAAGG - Intergenic
1053739656 9:41125521-41125543 AAGAGGGAAGAATTGGAAGCTGG + Intergenic
1053857021 9:42348239-42348261 AGGGTGGAAGAAAGGGAGGAAGG - Intergenic
1054254208 9:62748333-62748355 AGGGTGGAAGAAAGGGAGGAAGG + Intergenic
1054688696 9:68305799-68305821 AAGAGGGAAGAATTGGAAGCTGG - Intergenic
1055393809 9:75851958-75851980 TGGGGGGAAGAAAGGGGAGGGGG - Intergenic
1055500334 9:76896604-76896626 AAAGGGGAAGAAAGGAAAGAAGG - Intronic
1055552172 9:77441370-77441392 ACCGTGGCAGAAGGGGAAGCAGG - Intronic
1055723492 9:79201624-79201646 AAGAGGGAAGAAAAAGAAGCTGG + Intergenic
1055730281 9:79273829-79273851 GGGAGGGAAGAAAGGGAGGCAGG + Intergenic
1056281429 9:85044770-85044792 ATAAGGAAAGAAAGGGAAGCAGG + Intergenic
1056545156 9:87606817-87606839 AAGGGGGGAGAAAGGGAGGAAGG - Intronic
1057292914 9:93818610-93818632 AAGAGGGAAGAAAGGGAAAGAGG + Intergenic
1057686187 9:97237317-97237339 ATGGGGGCAGAATGGGGAGCTGG - Intergenic
1057942344 9:99296357-99296379 TCTGGGGAGGAAAGGGAAGGCGG - Intergenic
1058426088 9:104876291-104876313 AACGGGGAACAGAGGGAAGCTGG + Intronic
1058665768 9:107313949-107313971 TGAGGGGAAGAAAGGGAAGGAGG - Intronic
1059392123 9:114005880-114005902 ATGGGGGAAAACAAGGAAGCAGG + Intronic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1059965450 9:119609387-119609409 AGGGGGGAAAGAAGGAAAGCGGG + Intergenic
1060011950 9:120051564-120051586 GCTGAGGAGGAAAGGGAAGCTGG - Intergenic
1060732922 9:126049464-126049486 ACAGGGGAGGAAAGCGAGGCTGG - Intergenic
1061237531 9:129351479-129351501 AAGGGGGAGGAAAAGGAAGGGGG + Intergenic
1061431611 9:130534817-130534839 ATGAACGAAGAAAGGGAAGCAGG + Intergenic
1062359675 9:136181829-136181851 AGGAGGGAAGGAAGGGAAGGAGG + Intergenic
1203444728 Un_GL000219v1:44749-44771 AAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1203567918 Un_KI270744v1:107545-107567 AGGGAGGAAGGAAGGGAAGAAGG + Intergenic
1203568978 Un_KI270744v1:114532-114554 AGGGAGGAAGGAAGGGAAGAAGG + Intergenic
1185665220 X:1760157-1760179 AGGGGGGAAGGAAGGAAAGAAGG - Intergenic
1185698387 X:2213166-2213188 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698407 X:2213236-2213258 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698431 X:2213313-2213335 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698440 X:2213341-2213363 AGGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698464 X:2213431-2213453 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698469 X:2213447-2213469 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698474 X:2213463-2213485 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698491 X:2213524-2213546 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698504 X:2213570-2213592 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698509 X:2213586-2213608 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698514 X:2213602-2213624 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698527 X:2213648-2213670 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698532 X:2213664-2213686 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698541 X:2213692-2213714 AGGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698571 X:2213803-2213825 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698576 X:2213819-2213841 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698581 X:2213835-2213857 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698589 X:2213862-2213884 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698594 X:2213878-2213900 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698599 X:2213894-2213916 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698608 X:2213925-2213947 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698622 X:2213972-2213994 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698631 X:2214003-2214025 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698636 X:2214019-2214041 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698641 X:2214035-2214057 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698646 X:2214051-2214073 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698651 X:2214067-2214089 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698666 X:2214115-2214137 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698674 X:2214142-2214164 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698679 X:2214158-2214180 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698684 X:2214174-2214196 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698693 X:2214205-2214227 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698698 X:2214221-2214243 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698703 X:2214237-2214259 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698713 X:2214269-2214291 AGGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698722 X:2214300-2214322 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698727 X:2214316-2214338 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185698738 X:2214352-2214374 AAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1185711681 X:2308846-2308868 AGGAGGGAAGAAAGGGAAGGAGG + Intronic
1185915003 X:4025686-4025708 AGGAGGGAAGGAAGGGAAGAAGG - Intergenic
1185933312 X:4227722-4227744 AAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1185954604 X:4475699-4475721 ACGGGGGAAGGAAGGAAAGAAGG + Intergenic
1185999151 X:4989062-4989084 AGGAAGGAAGAAAGGGAAGGGGG - Intergenic
1186019172 X:5235016-5235038 ACAGAGGAAGAAAGGGAGGAAGG - Intergenic
1186019184 X:5235069-5235091 AAGGAGGAAGGAAGGGAAGAAGG - Intergenic
1186058823 X:5681518-5681540 AGGAAGGAAGAAAGGGAAGCAGG + Intergenic
1186990567 X:15062782-15062804 ACAAGGGAAGTAAGGGAAGCAGG + Intergenic
1187119147 X:16386800-16386822 GTGGGGGAGGTAAGGGAAGCAGG - Intergenic
1187323010 X:18257948-18257970 AGGGGAGAGGAAAGGGAAGGGGG + Intronic
1187570499 X:20496162-20496184 AGGGGTGAAGAGAGGGAAGTGGG - Intergenic
1188630640 X:32355093-32355115 AGGGAGGAAGAAATGGAAGAAGG - Intronic
1188762846 X:34053867-34053889 AAAGGGGAAAAAAGGGAAACAGG - Intergenic
1189294618 X:39909742-39909764 AAGGGAGATGAAAGGGAAACAGG + Intergenic
1190406245 X:50090575-50090597 ATGGGGGAAGACAGGGAAGGGGG + Intronic
1190456935 X:50635790-50635812 AAGGGGGAAGAAAGGGAAACAGG + Intronic
1190739546 X:53280194-53280216 AGGGGGGATGAAAGAGAAGGGGG + Intronic
1191871341 X:65748376-65748398 TCGGGGAAAGAATGGGAAGGGGG - Intergenic
1192809040 X:74533507-74533529 AGGTGGGGAGAAATGGAAGCAGG - Exonic
1195030507 X:100923009-100923031 ACTGTGGAAGAAAGAGGAGCAGG - Exonic
1195428947 X:104766398-104766420 AGGAGGGAAGAAAGGCAGGCAGG - Intronic
1195682687 X:107560739-107560761 AGGGGGGAAGAAAGGGTTCCAGG - Exonic
1195755417 X:108194569-108194591 ACAGGGCAAGAAAGGGACCCTGG - Exonic
1196904129 X:120415650-120415672 AGGGGGGAAGAAAGGAAGGAAGG - Intergenic
1197006029 X:121499406-121499428 ATGGGGGAAGACCGGGAAACAGG + Intergenic
1197659468 X:129154582-129154604 GCTGGGGAACAAAGGGAGGCAGG + Intergenic
1197837046 X:130705888-130705910 AAGGGGTAAAAAAGGGAAACGGG - Intronic
1197996218 X:132377594-132377616 AAGGAGGAACAATGGGAAGCAGG + Intronic
1198368415 X:135967052-135967074 AGGGGGGAAGAAAGGGAGCAAGG + Intronic
1199283862 X:146034759-146034781 AGGGGGAAAGGAAGGGAAGCAGG - Intergenic
1199637931 X:149830683-149830705 TCGGGAAAAGAAAGGGAAACAGG + Intergenic
1199827377 X:151514088-151514110 TCAGGAGAAGAAAGGGAAGTAGG + Intergenic
1199856123 X:151759967-151759989 ACGGAGGGGGAAAGGGATGCGGG - Intergenic
1199895637 X:152125085-152125107 AGGGAGGGAGAAAGGGAAGGAGG - Intergenic
1201228896 Y:11844854-11844876 ACAGGGGAAGACACAGAAGCTGG + Intergenic
1202273874 Y:23096166-23096188 AGGAGGGAAGAAAGGAAAGAAGG + Intergenic
1202292152 Y:23324511-23324533 AGGAGGGAAGAAAGGAAAGAAGG - Intergenic
1202426870 Y:24729911-24729933 AGGAGGGAAGAAAGGAAAGAAGG + Intergenic
1202443921 Y:24940183-24940205 AGGAGGGAAGAAAGGAAAGAAGG - Intergenic