ID: 947861944

View in Genome Browser
Species Human (GRCh38)
Location 2:233366704-233366726
Sequence CACTGCTGCTGCATGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947861944_947861956 26 Left 947861944 2:233366704-233366726 CCCCCAGTCATGCAGCAGCAGTG 0: 1
1: 0
2: 0
3: 15
4: 223
Right 947861956 2:233366753-233366775 GAGGACAGTGTGACGGGGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 158
947861944_947861955 21 Left 947861944 2:233366704-233366726 CCCCCAGTCATGCAGCAGCAGTG 0: 1
1: 0
2: 0
3: 15
4: 223
Right 947861955 2:233366748-233366770 AGAGTGAGGACAGTGTGACGGGG 0: 1
1: 0
2: 1
3: 17
4: 255
947861944_947861954 20 Left 947861944 2:233366704-233366726 CCCCCAGTCATGCAGCAGCAGTG 0: 1
1: 0
2: 0
3: 15
4: 223
Right 947861954 2:233366747-233366769 GAGAGTGAGGACAGTGTGACGGG 0: 1
1: 0
2: 0
3: 27
4: 342
947861944_947861953 19 Left 947861944 2:233366704-233366726 CCCCCAGTCATGCAGCAGCAGTG 0: 1
1: 0
2: 0
3: 15
4: 223
Right 947861953 2:233366746-233366768 CGAGAGTGAGGACAGTGTGACGG 0: 1
1: 0
2: 0
3: 16
4: 231
947861944_947861957 27 Left 947861944 2:233366704-233366726 CCCCCAGTCATGCAGCAGCAGTG 0: 1
1: 0
2: 0
3: 15
4: 223
Right 947861957 2:233366754-233366776 AGGACAGTGTGACGGGGTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 180
947861944_947861950 7 Left 947861944 2:233366704-233366726 CCCCCAGTCATGCAGCAGCAGTG 0: 1
1: 0
2: 0
3: 15
4: 223
Right 947861950 2:233366734-233366756 TTCATCTGAGCCCGAGAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947861944 Original CRISPR CACTGCTGCTGCATGACTGG GGG (reversed) Intronic
900655271 1:3753827-3753849 CCCTGCTTCTGCCTGACTGTCGG - Intronic
900967162 1:5966783-5966805 CTCTGCTGCTGCCTGCCTGGAGG - Intronic
901049268 1:6418388-6418410 TACTGCTGCTGCATGCCCAGAGG + Exonic
902613697 1:17612092-17612114 CACTGCTGGAGAATGAATGGAGG - Intronic
902925697 1:19694461-19694483 CCGTGCTGCTGCAGGACAGGAGG - Exonic
904296275 1:29521580-29521602 TTCTGCTGCTGCCTGGCTGGTGG - Intergenic
904324849 1:29721776-29721798 TATTGCTGCCCCATGACTGGAGG + Intergenic
904434171 1:30483456-30483478 TATTGCTGCTCCATGACTGCAGG - Intergenic
904545208 1:31265015-31265037 CACAGCTGCTTCTTGACTTGGGG + Intronic
904751455 1:32743189-32743211 GACTGCTGCTGCAGTGCTGGAGG + Intronic
907267680 1:53272658-53272680 CACAGCAACTCCATGACTGGGGG + Intronic
907414481 1:54304719-54304741 CACTGCTGGTGCAAGGCTGAGGG + Intronic
911291552 1:96062461-96062483 CACACCTTCTGCATCACTGGAGG - Intergenic
911700775 1:100949731-100949753 CAATGCTGCAGCCTGGCTGGGGG - Intronic
912153608 1:106888436-106888458 CTATGCTGCTGCAAGGCTGGAGG + Intergenic
912205227 1:107501047-107501069 CACTGCTGCAGGATGCTTGGGGG + Intergenic
913125930 1:115790349-115790371 CACTGGTGCAGCATGGCTGCTGG - Intergenic
913439986 1:118887032-118887054 CACTGCTGCTTCCTGACTTTGGG - Intronic
915491709 1:156253628-156253650 CACTGCTGCTGAATGAGGGGAGG + Intronic
915623381 1:157099498-157099520 CACTGCAGCTGCTTGGCTGAGGG - Exonic
916576253 1:166069798-166069820 GACTCCTGCTGTCTGACTGGAGG - Intronic
916589221 1:166174276-166174298 CAGTGCTGGTGCATGTCTGCAGG + Intergenic
917081109 1:171257865-171257887 CACTGGTGCTGCATGAGGGGCGG + Intronic
918037792 1:180892760-180892782 AACTGGTGCTTCATCACTGGTGG + Intergenic
918077974 1:181184791-181184813 CACTGCTTTTGCATGAATAGGGG - Intergenic
918338477 1:183546104-183546126 GGCTGCTGCTGCATTACAGGAGG - Exonic
918930518 1:190849718-190849740 CACAGCTGCTGCAGGACTTTGGG + Intergenic
919765494 1:201124670-201124692 GACTGCAGCTGCAGGGCTGGAGG + Intronic
924442378 1:244096919-244096941 CACGTCTGCTGCAGGACAGGGGG - Intergenic
1062895571 10:1100858-1100880 CCCTGCTGCAGCCTGTCTGGGGG + Intronic
1067590253 10:47502772-47502794 TACTGCTCTTGCATGACTGCAGG + Exonic
1076608145 10:131702653-131702675 CAGTGCTGCTCCAGGACTGCTGG + Intergenic
1077837133 11:5935299-5935321 CTCTGCTGTTTCATGAGTGGTGG - Intronic
1080445425 11:32333593-32333615 CACCGCTCCTGCGTGGCTGGGGG - Intergenic
1080562662 11:33478219-33478241 AGCTGCTGCTGCAGGACTGCAGG - Intergenic
1084565837 11:69928315-69928337 CACTGAGGCTGAATGTCTGGCGG - Intergenic
1086298231 11:85395680-85395702 CAATGCTGCAGCTTGACAGGGGG + Intronic
1087614676 11:100474327-100474349 CACTGCAACTGCATGACTTTGGG - Intergenic
1089730269 11:120514743-120514765 CACCCCGGCTGCATGCCTGGGGG - Intronic
1091725853 12:2845988-2846010 CACTGCACCTGCCTGGCTGGGGG + Intronic
1093004527 12:14036663-14036685 CTCTGCTGCTGCAGGTCTGCTGG - Intergenic
1094348606 12:29498461-29498483 AACTGGTGCTGAAGGACTGGTGG - Intergenic
1095897950 12:47299673-47299695 CACTGCTGCAGCATTGCTGGGGG + Intergenic
1098991900 12:77072852-77072874 CACTGCTGATGCATGACATCAGG + Intergenic
1100900806 12:99238323-99238345 CAATGCTGCAGCTTGACGGGGGG + Intronic
1101904544 12:108814895-108814917 CTCCGCTGCTGCCTGGCTGGAGG - Intronic
1103008353 12:117439293-117439315 CCCTGCGGCTGCGTGACTGGAGG + Intronic
1103040222 12:117688784-117688806 CACTGCTGCTGTAAGTTTGGAGG + Intronic
1103413240 12:120727230-120727252 CTCTGCTACTGGATGAATGGTGG + Intronic
1105291899 13:19058651-19058673 CACTTCTGCTGCATGACCTCAGG - Intergenic
1105600441 13:21881838-21881860 CAAGGCTGCAGCATGACTGAGGG - Intergenic
1106462175 13:29980819-29980841 CACTGCTGCTGCTTTACAGGAGG - Intergenic
1107658880 13:42618880-42618902 GAGTGCTGCTGCATTGCTGGTGG + Intergenic
1108818835 13:54321266-54321288 CACTGGGGCTGCATGACTGATGG - Intergenic
1111022591 13:82472500-82472522 GACTGCTCCTGCATGACCAGGGG - Intergenic
1113384865 13:109839355-109839377 CACTGCAGGTGCATGGCAGGTGG - Intergenic
1113571634 13:111362215-111362237 CAGTGCTGCTGCATGGGTGCAGG + Intergenic
1115647282 14:35377804-35377826 GACTGCTGCTGCAGGGCAGGTGG - Intergenic
1115942765 14:38627673-38627695 CAGTGCTGGTGCAAGAGTGGGGG - Intergenic
1119375360 14:74186844-74186866 CAAGGCTGTTGCATCACTGGAGG + Intronic
1120759472 14:88272809-88272831 CTCTGCTGCTGCCTGAGTTGAGG - Intronic
1121464041 14:94102751-94102773 CAGCGCTGCTGCAGGACTGCTGG + Intronic
1122264366 14:100539758-100539780 CGCTCCAGCAGCATGACTGGGGG - Intronic
1122292727 14:100688254-100688276 CACGGCTGCCACATGACTGGAGG - Intergenic
1124344566 15:28913582-28913604 CACTGCTGTGGAAAGACTGGAGG - Intronic
1124614279 15:31230407-31230429 CACTGCTGCTGCATAACCTATGG + Intergenic
1125285387 15:38087399-38087421 CACTGCTGCTGAATCAATGTGGG - Intergenic
1125676962 15:41507275-41507297 CACTTCTTCTGCTTCACTGGGGG + Exonic
1125779236 15:42249541-42249563 AACTGCTTCTGAATGACTGCTGG - Intronic
1128332173 15:66763080-66763102 CCCTGCTGCTGCTTGCCTTGAGG - Intronic
1128390027 15:67176452-67176474 CACTGCTGCTGCAAGACGAAAGG - Intronic
1129742284 15:77995106-77995128 CACTGCTGCTGGGCAACTGGAGG - Exonic
1129839246 15:78733658-78733680 CACTGCAGCTCGAGGACTGGAGG - Intergenic
1129969597 15:79766479-79766501 CCATGCTGGTGCAGGACTGGGGG - Intergenic
1132484872 16:185608-185630 CACTGATGCTGCATCCCAGGAGG + Intergenic
1133138434 16:3728304-3728326 TGCTGCTGCTGCATGGCCGGTGG + Exonic
1133687511 16:8180047-8180069 CACGCCAGCTGGATGACTGGGGG - Intergenic
1135521531 16:23182309-23182331 CACTGAAGCTGCAGGTCTGGAGG + Intergenic
1137480362 16:48847479-48847501 TTCTGCTGCTGCAGGACAGGAGG - Intergenic
1137876794 16:52004754-52004776 CACTGCTCCAGCAGGTCTGGGGG + Intergenic
1138547442 16:57728315-57728337 CACTGCTGATGCAGAGCTGGTGG + Intronic
1139548221 16:67659732-67659754 TGCTGCTGCTGCAGGACTGCGGG - Exonic
1142281537 16:89150729-89150751 CAGGGCTCCTGCAGGACTGGCGG - Intronic
1143647226 17:8238556-8238578 CACTACTGCTCCACGACAGGTGG + Exonic
1145288598 17:21524516-21524538 CACTGCAGCTGCGGGACTGAGGG - Intergenic
1146655553 17:34632697-34632719 CACAGCTGCTGGATACCTGGGGG - Exonic
1147219708 17:38921102-38921124 CACTGGTGCTGAGTGACCGGGGG + Exonic
1147423590 17:40334658-40334680 CACTGCTCCTGCAGGAATGGAGG - Intronic
1147886779 17:43689663-43689685 CACTGCTGCTGCTGGGCTTGTGG - Intergenic
1152525351 17:80885158-80885180 CCCTGCTGCTGCCGGGCTGGGGG - Intronic
1154324484 18:13380079-13380101 CATTGCCGCTGCTTGGCTGGTGG + Intronic
1155823621 18:30409771-30409793 CACTGCAGGTGCATTTCTGGTGG + Intergenic
1156049241 18:32912119-32912141 CTTTCCTGCTGAATGACTGGAGG + Intergenic
1157271052 18:46276583-46276605 CACTGCTGCAGCAGATCTGGAGG + Intergenic
1158588866 18:58763041-58763063 CACTTCTGCTGCAAGGCTGGGGG + Intergenic
1160264259 18:77325569-77325591 CAGAGCTGCTACATCACTGGTGG - Intergenic
1160438135 18:78867031-78867053 CACTGCTGCTGGCTGCCTGCGGG - Intergenic
1161390682 19:4018892-4018914 CCCTGATGCAGCATGGCTGGTGG + Intronic
1165983205 19:39743866-39743888 CCCTGCTCCTGAATGACTGTTGG - Intergenic
1166749680 19:45158941-45158963 CGCTGCTGCTGCAGGACGGAGGG + Exonic
1167661035 19:50796347-50796369 GCCTGCTGCTGCATGAGTGTGGG - Intergenic
1167969969 19:53183190-53183212 CACTGCTGCAGCCTGTGTGGGGG - Intronic
926139076 2:10357799-10357821 CACTGCTGCTTCCTAACAGGAGG - Intronic
926369265 2:12163768-12163790 CCCAGCTACTGCATGGCTGGAGG - Intergenic
926990646 2:18676514-18676536 CACTGAGGCTGCCTGACTGTTGG + Intergenic
927223369 2:20736494-20736516 CACTGCTGCAAAATGACTGTAGG + Intronic
927502538 2:23592169-23592191 CACTGCTGCTGCAGGCCAGCTGG - Intronic
931563538 2:63589300-63589322 TAATCCTGCTGCATGACGGGAGG + Exonic
933241178 2:79922020-79922042 CAAGGCTGGTGCAGGACTGGAGG - Intronic
933372156 2:81428335-81428357 CACTGGTGCTGCATGCCTACAGG + Intergenic
933707456 2:85302638-85302660 CAGTGCTGCTGCAGGGCAGGCGG + Intronic
935215144 2:100970124-100970146 CACTGCTGCTGCACGCCCAGTGG - Intronic
936953233 2:117999283-117999305 CTCAGCAGCTGCATGAATGGTGG + Intronic
937116168 2:119406561-119406583 CCCTGCTGCTGCTTGTGTGGTGG - Intergenic
937315641 2:120930595-120930617 CACTGCTGCTGCTTGGCCAGGGG - Intronic
941847067 2:170143699-170143721 CACTGCTGTTTCCTGACTAGTGG - Intergenic
942398531 2:175577081-175577103 CTCTGCTGCTGAATCAGTGGGGG - Intergenic
942910786 2:181241965-181241987 CACTGATGATGGCTGACTGGAGG - Intergenic
943233615 2:185290243-185290265 CAATGCTGCAGCCTGGCTGGGGG + Intergenic
947094117 2:226546355-226546377 GACTGCTGCTGAATGAGTAGAGG - Intergenic
947861944 2:233366704-233366726 CACTGCTGCTGCATGACTGGGGG - Intronic
1171333302 20:24360309-24360331 CACTGCTTCTCCAGGGCTGGAGG - Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172473372 20:35218018-35218040 AACTGCTCCTGCACCACTGGTGG + Intergenic
1172516863 20:35541220-35541242 CATTGCAGCTGCATTACTGTGGG + Intergenic
1173600191 20:44289379-44289401 CATTGCTACTGAATGACTGGGGG + Intergenic
1173822532 20:46028809-46028831 CGCAGCGGCTGCTTGACTGGGGG - Intronic
1174560495 20:51427626-51427648 CACTGCTGCTGAAAGCCTGCGGG + Intronic
1174561226 20:51432186-51432208 TTCTGCTGCTGAATGACTGTGGG + Exonic
1175082031 20:56428821-56428843 ACCTGCTGCTGCATGACCAGAGG + Intronic
1176151014 20:63590714-63590736 CACTGCTGCTCCAGGGCTGCAGG + Exonic
1179393669 21:41017370-41017392 CATGTCTGCTGCATGAGTGGTGG - Intergenic
1180156765 21:45981876-45981898 CCCTGCTGCTGCAGGCCTGCTGG + Exonic
1181009516 22:20032298-20032320 GACTGCTTCTGCAAGCCTGGTGG + Intronic
1183122830 22:35743770-35743792 ATCTGGTGCTGAATGACTGGGGG - Intronic
1183632943 22:39044561-39044583 CACTGCTGCTCCATGCCACGGGG + Intronic
1183638706 22:39080555-39080577 CACTGCTGCTCCGTGACATGGGG + Intronic
1183665966 22:39245803-39245825 CACAGCAGCTCCCTGACTGGGGG - Intergenic
1183727266 22:39596691-39596713 CACTGCTGCTGCAGGAAGGGTGG + Intronic
1184454944 22:44604446-44604468 CCCGGCTGCTGCATTTCTGGGGG - Intergenic
1185178500 22:49345882-49345904 CACTGATGCTGCATCCCTGCTGG + Intergenic
954618286 3:51981488-51981510 TACTGCTGCTGCATGACCACAGG + Intronic
954809349 3:53238563-53238585 CACTTCTGCTGCAGGAGTGGAGG + Intronic
955405646 3:58624093-58624115 CACTGCTGCCGCAGGACCTGTGG + Intronic
956852664 3:73245158-73245180 CACCCCTGCTGAATGACTGAGGG + Intergenic
956979959 3:74624795-74624817 CACTGGTGCTGTATGTGTGGAGG - Intergenic
959303819 3:104635129-104635151 CACTGCTGCTGCATGGAGTGGGG - Intergenic
961592305 3:127990218-127990240 CTCTGCTGCTTCACGGCTGGTGG - Intergenic
961649033 3:128408357-128408379 GGCTGCTGCTGCAGGACTGCAGG - Exonic
961653190 3:128427609-128427631 CCCTGCTGCTGACTGGCTGGTGG + Intergenic
962274203 3:134000021-134000043 CACTGCCACCGCCTGACTGGAGG - Intronic
962639868 3:137374557-137374579 CCCTGCTCCTGAATGACTGCTGG - Intergenic
964041699 3:152268937-152268959 CACTGCAGCTGAATGAGTTGTGG + Exonic
964602201 3:158514376-158514398 AACTGCTCCTGAATGACTGCTGG - Intronic
965017246 3:163173911-163173933 CCCTTCTGCTGCATGTCTGCAGG + Intergenic
966753473 3:183345301-183345323 AACTGCTCCTGAATGACTAGTGG + Intronic
967361465 3:188636456-188636478 CAAGGCTGCAGCAAGACTGGGGG + Intronic
968932144 4:3586811-3586833 CACTGCTGCTTTATAACTGTGGG + Intronic
969323204 4:6425463-6425485 CAGTGCTGCTGGAAGTCTGGGGG + Intronic
969454085 4:7291305-7291327 CACAGCAGCTTCATGACTGCAGG + Intronic
970613561 4:17747159-17747181 CACTGATGCTGCATGGTGGGGGG + Intronic
971265407 4:25092416-25092438 AACTGCTGCTGCAAGGCTGAAGG - Intergenic
976552572 4:86413635-86413657 CAATGCTGCAGCTTGACAGGGGG - Intronic
978029904 4:103928288-103928310 GACTAGTACTGCATGACTGGAGG - Intergenic
979457881 4:120946950-120946972 AACTGCTCCTGAATGACTGCTGG + Intergenic
980196080 4:129590604-129590626 ACCTGCTGCTGCATGACTACTGG + Intergenic
983632948 4:169868070-169868092 TACTACTGAGGCATGACTGGGGG - Intergenic
986398839 5:7359211-7359233 AGCTGCTGCTGGATGACTCGGGG + Intergenic
986656364 5:10016763-10016785 CAATGCTGCTGCTTGGCGGGGGG - Intergenic
987596990 5:20014435-20014457 CTATGCTGCTGCATGAAGGGTGG + Intronic
988327576 5:29789614-29789636 CACTCCTGCTGCAAGACATGAGG + Intergenic
988469606 5:31526442-31526464 ACCTGCTGCGGCATGACTGGAGG + Exonic
988852464 5:35193194-35193216 CACTGCTGTTGCATAACTACGGG - Intronic
991151753 5:63378695-63378717 AACTGCTGCTGAATGACTACTGG + Intergenic
991315919 5:65306214-65306236 CATTACTGCTGCATGAATGCTGG - Intronic
992665687 5:79006799-79006821 CCCTGCTGCTGCTTCTCTGGAGG - Intronic
992960388 5:81952701-81952723 CACTGCTCCTGCCTTATTGGAGG - Intergenic
994730497 5:103485524-103485546 CTCTGCTGCTGCATAAATCGAGG - Intergenic
995180707 5:109227913-109227935 CACTGGTGGGGCAGGACTGGTGG + Intergenic
997339073 5:133128439-133128461 CAGTGCAGCTGGATGAATGGTGG + Intergenic
999629490 5:153555478-153555500 CACTGCTCCTGCTGCACTGGAGG + Intronic
1001980582 5:176035024-176035046 TACTCCTGCTCCATGCCTGGAGG + Intergenic
1002236877 5:177809041-177809063 TACTCCTGCTCCATGCCTGGGGG - Intergenic
1002428411 5:179189054-179189076 CAATCCTGCTGCGTGACTTGGGG + Intronic
1006378796 6:33685933-33685955 CACTGCTGCTTTGTGGCTGGTGG + Intronic
1006527340 6:34618266-34618288 TACTGCTGCTGCATGACCTTGGG - Intronic
1007230299 6:40343540-40343562 GTCTGCTGCTCAATGACTGGGGG - Intergenic
1008905959 6:56678022-56678044 CACTGGTTTTGCATCACTGGAGG - Intronic
1009245719 6:61234849-61234871 ACATGCTGCTGGATGACTGGTGG + Intergenic
1009523393 6:64713186-64713208 CAATGCTGCTGCATGTTTGAAGG - Intronic
1010456645 6:76063995-76064017 CACTGAGGCTGCCTGACTGCTGG - Intronic
1014930343 6:127328227-127328249 CATTGTTGGTGCATGACTGTAGG - Intronic
1016265920 6:142232563-142232585 CAATGCTGCAGCTTGACAGGGGG + Intergenic
1017523752 6:155224873-155224895 CACAAATGCTGCATGCCTGGAGG + Intronic
1017727538 6:157285920-157285942 CAATGCTGCTCCCTGATTGGAGG + Intergenic
1022962199 7:35438121-35438143 CACTGCAGCTGCTCGACAGGAGG + Intergenic
1026468606 7:70675629-70675651 CTCTGCTCCACCATGACTGGTGG + Intronic
1027574751 7:79917950-79917972 ACCTGCTGCTGAATGACTAGTGG + Intergenic
1028867196 7:95727062-95727084 CCATGCTGCTGCATGACTTCAGG - Intergenic
1032751418 7:134845683-134845705 CACTGCTGCTTCCTGCCTGTAGG - Intronic
1033929444 7:146505207-146505229 CCCTGCTGCTGCTTGAAGGGTGG + Intronic
1034686654 7:152977748-152977770 CACTGCTGGTGCATGTTTTGAGG + Intergenic
1035095143 7:156348106-156348128 CACTGCGGCTGCATGGCTCTCGG + Intergenic
1035260251 7:157656544-157656566 CACAGCTCCTGCAGGACAGGGGG + Exonic
1035654207 8:1293293-1293315 GCCTGCTGCTGCCTGGCTGGGGG - Intergenic
1036938248 8:13026142-13026164 GACTGCAGCTGCTTGTCTGGTGG - Exonic
1037812937 8:22097519-22097541 ACCTGCTGCCGCATGCCTGGGGG - Exonic
1038933426 8:32220657-32220679 CACATCTGCAGCATGGCTGGTGG - Intronic
1039831719 8:41220827-41220849 CCCTGCTGCTGCTTGCCTCGCGG + Intergenic
1039938471 8:42068424-42068446 CACTGATGAAGCAAGACTGGGGG + Intergenic
1044534984 8:93348186-93348208 CACTCTTGCAGCATCACTGGAGG + Intergenic
1044723420 8:95172295-95172317 CACTGCCTCTGCATGACTTCGGG - Intergenic
1047559033 8:125966346-125966368 CACGGATGCTTCAGGACTGGAGG + Intergenic
1048898040 8:139012254-139012276 CCCTGCTTCTGCATGCCTGTCGG - Intergenic
1049097359 8:140556953-140556975 CTCTGCTGCTGCAGGAATGCGGG - Intronic
1049392196 8:142377630-142377652 TAGTGCTGGTGCATAACTGGGGG + Intronic
1049674957 8:143885246-143885268 CACTGCTGCAGCAGGCCTGGGGG + Intergenic
1054457991 9:65445117-65445139 CACTGCTGCTTTATAACTGTGGG - Intergenic
1055330830 9:75181812-75181834 CACTGCTGCTGGATTGCAGGAGG + Intergenic
1055508376 9:76970797-76970819 CACTGCTGTTGACTGCCTGGGGG - Intergenic
1055552496 9:77444620-77444642 TATTGCTGCTGCATGTCTGAGGG - Intronic
1056816959 9:89808856-89808878 CATTGCAGAGGCATGACTGGGGG + Intergenic
1057268460 9:93633938-93633960 CACTGCTGCTGCATAACCACGGG + Intronic
1060519259 9:124284754-124284776 CTCTGCTCTTGCATGTCTGGTGG + Intronic
1060845391 9:126832926-126832948 TACTGCTGCTTGGTGACTGGTGG - Exonic
1062181806 9:135194995-135195017 CTCACCTGCTGCATGGCTGGAGG + Intergenic
1186631107 X:11349873-11349895 CACTGATTCTGGATGCCTGGTGG - Intronic
1186654849 X:11601313-11601335 CAGTGGTGGTGCATGCCTGGTGG + Intronic
1187093505 X:16122265-16122287 GACTGATGCTGCATGGCTAGAGG - Intergenic
1187848246 X:23563913-23563935 GACTGCTCCTGAATGACTAGTGG - Intergenic
1191008541 X:55737499-55737521 CACTGGAGCTGCCTGACTGCTGG + Intronic
1191076417 X:56458462-56458484 CACTGCTTCTGAATGACTACTGG - Intergenic
1191119992 X:56893536-56893558 ACCTGCTCCTGCATGACTAGTGG + Intergenic
1193496494 X:82219611-82219633 CACTGCAGCTGCAATGCTGGAGG + Intergenic
1194558337 X:95389594-95389616 CACTGCTGCTACGGGAGTGGGGG + Intergenic
1195622313 X:106969207-106969229 ACCTGCTCCTGAATGACTGGTGG + Intronic
1196099376 X:111831623-111831645 CACAGCTGCTGGATGGCTTGGGG - Intronic
1196371332 X:114982803-114982825 CACTGCTGCTGCTTCAGTGAAGG + Intergenic
1199173770 X:144760508-144760530 CAAAGCTCCTGAATGACTGGCGG + Intergenic