ID: 947863989

View in Genome Browser
Species Human (GRCh38)
Location 2:233383329-233383351
Sequence CCGCGCCCAGCCCGTTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947863985_947863989 7 Left 947863985 2:233383299-233383321 CCAAAGTGCTGGAATTACAGGCA 0: 4304
1: 100967
2: 237366
3: 242802
4: 214495
Right 947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG 0: 1
1: 0
2: 1
3: 7
4: 114
947863980_947863989 24 Left 947863980 2:233383282-233383304 CCACCTGCTTCGGCCTTCCAAAG 0: 39
1: 2067
2: 36496
3: 129154
4: 169386
Right 947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG 0: 1
1: 0
2: 1
3: 7
4: 114
947863981_947863989 21 Left 947863981 2:233383285-233383307 CCTGCTTCGGCCTTCCAAAGTGC 0: 83
1: 5176
2: 103261
3: 239680
4: 235902
Right 947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG 0: 1
1: 0
2: 1
3: 7
4: 114
947863983_947863989 11 Left 947863983 2:233383295-233383317 CCTTCCAAAGTGCTGGAATTACA 0: 477
1: 22188
2: 319660
3: 260451
4: 143689
Right 947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG 0: 1
1: 0
2: 1
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947863989 Original CRISPR CCGCGCCCAGCCCGTTCCAT GGG Intronic
901669918 1:10850092-10850114 CCACTCCCAGCCCTTTCCAGGGG - Intergenic
902284060 1:15395021-15395043 CCGCACCCAGCCTTTCCCATAGG - Intronic
903755380 1:25657113-25657135 CCGCGCCCAGCCCCAACCTTGGG + Intronic
903971810 1:27123799-27123821 CCGCGCCCAGCCCTTTTATTGGG + Intronic
904161664 1:28526603-28526625 CCGCGCCCAGCCCTATCCTTTGG - Intronic
908209136 1:61881700-61881722 CCGCACCCAGCCCGCTCTTTAGG + Intronic
1064934663 10:20666362-20666384 CCGTGCCCAGCCCCATTCATAGG - Intergenic
1065634408 10:27715849-27715871 CAGCCCCCAGCCCATCCCATAGG - Intronic
1067053423 10:43038139-43038161 CCGAGCCCAGCCCGAGCCACAGG + Intergenic
1069191304 10:65494631-65494653 CCGCGCCCGGCCCGGACCAGTGG + Intergenic
1071086721 10:81874904-81874926 CCGCGCCCAGCCCGCTCCCTGGG - Intergenic
1073357584 10:102869622-102869644 CAGCCCCCAGCCCCTTCCCTGGG + Intronic
1073365205 10:102934569-102934591 CCGCGCCCAGCCTGAGCCACCGG + Intronic
1082077028 11:47981845-47981867 GAGCACCCAGCCCGTGCCATGGG + Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1084018491 11:66402172-66402194 CCGCGCCTGGCCGATTCCATGGG + Intergenic
1086143381 11:83523822-83523844 CCGCCCCCTGCCCCTGCCATTGG - Intronic
1089962080 11:122625162-122625184 CTGTGCCCAGCCCATTCCATAGG - Intergenic
1090369432 11:126238069-126238091 CCGCACCCGGCCTCTTCCATTGG - Intronic
1093302908 12:17476927-17476949 CCGCGCCCAGCCGGCTCAAGTGG + Intergenic
1095739750 12:45593791-45593813 CCCTGCCCAGCCCCTTCCCTTGG + Intergenic
1096297023 12:50392567-50392589 CCGCGCCCAGCCGGTTTCACAGG + Intronic
1096367357 12:51040024-51040046 CCGCGCCCAGCCCTGGCCAAGGG - Intergenic
1097013044 12:55966737-55966759 CCGCCCCCAGGCCTTTCTATTGG - Intronic
1097079628 12:56420664-56420686 CTGCTCCCAGGCCGTTCCATTGG - Exonic
1101895867 12:108756133-108756155 CCATGCCCAGCCCTTTACATGGG - Intergenic
1102973773 12:117191290-117191312 CCGCGCCCAGCCCCTTGTCTTGG + Intergenic
1103321854 12:120096778-120096800 CTGCGGCCAGCCCGTGCCAGTGG - Exonic
1103595790 12:122023548-122023570 TCGCAGCCAGCCCTTTCCATAGG - Intronic
1103856147 12:123972612-123972634 CCGCGCCCCGCCCAGCCCATGGG - Exonic
1103941190 12:124502173-124502195 CCTCGCCCAGCCCAGTCCAGAGG + Intronic
1104250263 12:127086838-127086860 CCGGGCCCAGCCCAGTCAATGGG - Intergenic
1104895317 12:132161040-132161062 CCCCGCCCTTCCCGTTCCCTGGG + Intergenic
1106178002 13:27347638-27347660 CCGCTCCCTGCCTGGTCCATTGG - Intergenic
1109816844 13:67596007-67596029 CCGCGCCCAGCCTACCCCATTGG - Intergenic
1116060676 14:39920734-39920756 CTGAGCCCAGCCCTTTTCATTGG + Intergenic
1136061233 16:27728117-27728139 CAGCGCCCAGACCCTGCCATGGG - Intronic
1138652063 16:58466304-58466326 CCGCACCCAGCCCCCACCATGGG + Intronic
1139447475 16:67006735-67006757 CTGCCCCCAGGCCTTTCCATGGG + Intronic
1139527804 16:67527584-67527606 CCGCGCCCAGCCTGTTTGGTCGG - Intronic
1140479325 16:75253881-75253903 CTGCGCCCAGCCAGTGCCAGGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143247901 17:5501134-5501156 CCGCCCCCAGCCTGTTGCAGAGG + Intronic
1143422889 17:6809520-6809542 CCGCGCCCAGCCGATTCTATGGG + Intronic
1144681533 17:17199084-17199106 CCACGCTCAGCCAGTTCTATAGG - Intronic
1146356741 17:32140886-32140908 CCGCGCCCAGCCTAATCCACAGG - Intergenic
1147342482 17:39761993-39762015 TCGCGCCCGGCCCTTTGCATGGG + Intergenic
1148129101 17:45252393-45252415 CCACACCCGGCCCGTTCTATGGG - Intergenic
1148419435 17:47532363-47532385 CCGCGCCCAGCCAGCTTCTTGGG - Intronic
1148685138 17:49496672-49496694 CCGCGCCCACCGCGCTCCGTGGG + Intronic
1150260634 17:63787533-63787555 CCACGCCCAGCCTGTTTCAATGG - Intronic
1151292567 17:73161166-73161188 CAGTGTCCAGCCCCTTCCATGGG - Intergenic
1152451576 17:80384728-80384750 CCGTACCCAGCCAGTTACATGGG + Intronic
1152552076 17:81034968-81034990 CCCCGCACCGCCCTTTCCATTGG - Intergenic
1152620584 17:81362548-81362570 CCACGCCCAGCCTGTTTCCTTGG + Intergenic
1156350569 18:36298087-36298109 CCGCGCCCAGCCCAGCCCAGGGG - Intronic
1158416717 18:57255205-57255227 CCGCACCCAGCCAGTTTCAGAGG - Intergenic
1160725519 19:616374-616396 CCGCGCCCAGCCCGGACCGCAGG + Exonic
1160733933 19:653288-653310 CCGCACACAGCCCGTTCCCCTGG + Intronic
1160736652 19:665750-665772 CCGCGCCCGGCCCTTTCCCCTGG + Intergenic
1160777275 19:862051-862073 ACGCGCCCCGCCCCTTCCCTGGG - Intronic
1162312386 19:9914668-9914690 CCGCTCCCGGCCCGCTCCCTCGG + Intronic
1162417485 19:10546893-10546915 CCTCTCCCAGCCGGTACCATGGG + Exonic
1163899156 19:20085548-20085570 CCGCGCCCGGCCAGTTGCATTGG + Intronic
1165542803 19:36506222-36506244 CCGCGCCCAGCCACTTACAAGGG - Intergenic
1166294860 19:41883986-41884008 CCACCCCCAGCCCCTTCCTTTGG - Intronic
1167260847 19:48456769-48456791 CCATGCCCAGCCCTTTCCTTTGG + Exonic
1167946633 19:52993630-52993652 CCGCCCCCTGCCGGTTCTATAGG - Intergenic
1167946648 19:52993676-52993698 CCGCCCCCTGCCGGTTCTATAGG - Intergenic
928964980 2:36966809-36966831 CCGCGCCCAGCCGGCCCCAGAGG - Intergenic
931778062 2:65556812-65556834 CCTCCCCCAGCCGGTTCCTTGGG - Intergenic
932738158 2:74270381-74270403 CCGCGCCCAGCCCCAGGCATTGG - Intronic
938857987 2:135335399-135335421 CAGCGCCCAGCCTCTTCCAATGG - Intronic
941927989 2:170915296-170915318 CCGCGCCAAGCCAGCACCATGGG + Intergenic
942278242 2:174337651-174337673 TCGCGCCCAGCCCGGGCCCTGGG - Exonic
946409234 2:219508184-219508206 CCTCTCCCAGCCCCTTCCTTGGG - Intergenic
947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG + Intronic
949008246 2:241662943-241662965 CCGCGCCCGGCCCGCTTTATTGG - Intronic
1170231061 20:14047154-14047176 CCGCGCCCAGCCCATTTCCATGG - Intronic
1172904247 20:38357143-38357165 CCACACCCAGCCAGTCCCATTGG + Intronic
1174646620 20:52091695-52091717 CCGCGCCCAGCCACGGCCATAGG - Intronic
1175521512 20:59605128-59605150 CCCCGCCCAGCCCGTTACCTGGG - Exonic
1175937561 20:62521106-62521128 CCGCGCCCGGCCCATTCGGTGGG + Intergenic
1178916726 21:36709112-36709134 CAGCGCCCAGCCCGATGCCTGGG - Intronic
1180137736 21:45871957-45871979 CGGAGCCCAGCCCGTCCCCTGGG - Intronic
1183416714 22:37686741-37686763 CCTAGCCCAGCCCAGTCCATCGG + Intronic
1183657740 22:39198993-39199015 CCGCGCCCGGCCAATTCCTTGGG - Intergenic
1183987333 22:41576698-41576720 CCACCCCCAGCCCCTTCCTTGGG - Intronic
1184179512 22:42810707-42810729 CCGTGCCCAGCCCCTTACAAGGG + Intronic
960048319 3:113218158-113218180 CCACGGCCAGCCGGTTCCACAGG - Intronic
962060608 3:131923412-131923434 CTGCGCCCAGCCAGTTCTGTTGG - Intronic
968117004 3:196098204-196098226 CCACACCCAGCCAGTTCTATGGG - Intergenic
968733163 4:2281205-2281227 CCAAGCCCAGCCGGTTCCCTTGG - Intronic
969414440 4:7049552-7049574 CTGCCCCCAGCCTGTTCCAGTGG - Intronic
974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG + Intergenic
981454439 4:144937381-144937403 CCGCGCCTAGCCACTTCCAGGGG - Intergenic
981753608 4:148117868-148117890 CTGTGCCCAGCCCTTGCCATGGG - Intronic
990423220 5:55658442-55658464 CCGCGCCCAGCCCAATTTATAGG + Intronic
996086611 5:119311399-119311421 CCACGCCCAGCCCATTCATTGGG - Intronic
996870046 5:128180258-128180280 CCACGCCCAGCCCATTCTTTTGG + Intronic
1001455291 5:171855481-171855503 CTGCGACCAGCCCATTCCTTGGG + Intergenic
1003098415 6:3159117-3159139 CCGCGCCCAGCCCATCACCTTGG - Intergenic
1006077281 6:31541883-31541905 CCGCACCCATCCCGTCACATGGG - Intronic
1012509236 6:99983259-99983281 CCATGCCCAGCCCCTGCCATGGG + Intronic
1013145308 6:107384348-107384370 CCGCGCCCAGCCAGTTTAGTGGG - Intronic
1013146704 6:107400995-107401017 CATAGCCCAGCCCGTTGCATGGG + Intronic
1015570529 6:134617130-134617152 CAGCGCCAGGCCTGTTCCATTGG - Intergenic
1017952800 6:159150406-159150428 CTGCGCCCAGCCTATTACATAGG + Intergenic
1022459388 7:30590566-30590588 CCGCGCCCGGCCGATTCCTTAGG - Intergenic
1024344048 7:48294734-48294756 CCGCGCCCGGCCCGTTTCTATGG + Intronic
1025143266 7:56483365-56483387 CCTCGCCCCGCCCCTTCCCTCGG - Intergenic
1030656634 7:112175151-112175173 CCGCGCCCAGCCCCGTCCCCTGG + Intronic
1033661976 7:143408670-143408692 CCGCGCCCCGCCCCTTCCCGGGG - Intronic
1034536475 7:151728818-151728840 CAGCGCCCAGCCCCGTCCACAGG + Intronic
1036364812 8:8111026-8111048 CCCCTCCCAGCTCCTTCCATGGG - Intergenic
1049792999 8:144481177-144481199 CCGCGCCCGGCCTGTTTGATGGG + Intronic
1052006884 9:23360093-23360115 CCACCCCCAGCCCCTCCCATTGG + Intergenic
1052862226 9:33444107-33444129 CTGCTTCCAGCCCTTTCCATAGG - Intronic
1058155698 9:101512261-101512283 CCCCGCCCTGCCCGTCCCAAAGG + Intronic
1062423184 9:136493850-136493872 CCTCGCTCAGCCAGTTCCTTAGG + Intergenic
1187339775 X:18410884-18410906 CCGCGCCCGGCCAGTTCAAAGGG - Intergenic
1200119330 X:153783097-153783119 CCGCCCCCCTCCCGCTCCATAGG + Exonic
1202199738 Y:22333745-22333767 CCGCGCCCAGCTCATGGCATGGG - Intronic