ID: 947866341

View in Genome Browser
Species Human (GRCh38)
Location 2:233400411-233400433
Sequence CACTGGGTGTGAAGGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947866341_947866351 14 Left 947866341 2:233400411-233400433 CCCTTTGCCCTTCACACCCAGTG 0: 1
1: 0
2: 4
3: 29
4: 301
Right 947866351 2:233400448-233400470 TGAGACGCCTCATGCTGTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 88
947866341_947866352 19 Left 947866341 2:233400411-233400433 CCCTTTGCCCTTCACACCCAGTG 0: 1
1: 0
2: 4
3: 29
4: 301
Right 947866352 2:233400453-233400475 CGCCTCATGCTGTCCTGGCCTGG 0: 1
1: 0
2: 0
3: 21
4: 169
947866341_947866353 20 Left 947866341 2:233400411-233400433 CCCTTTGCCCTTCACACCCAGTG 0: 1
1: 0
2: 4
3: 29
4: 301
Right 947866353 2:233400454-233400476 GCCTCATGCTGTCCTGGCCTGGG 0: 1
1: 0
2: 5
3: 30
4: 308
947866341_947866355 29 Left 947866341 2:233400411-233400433 CCCTTTGCCCTTCACACCCAGTG 0: 1
1: 0
2: 4
3: 29
4: 301
Right 947866355 2:233400463-233400485 TGTCCTGGCCTGGGCCTCCCTGG 0: 1
1: 0
2: 6
3: 65
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947866341 Original CRISPR CACTGGGTGTGAAGGGCAAA GGG (reversed) Intronic
900740620 1:4328719-4328741 CAGTGGCTGTGAAGGGCCACAGG + Intergenic
901748652 1:11392026-11392048 CACTGGGTGGGAGGGGCATCTGG + Intergenic
902220343 1:14960663-14960685 CACTAGGGGAGAAGGGCACAGGG - Exonic
902454539 1:16523134-16523156 CCCTGGGTGCGAAGGACATAAGG + Intergenic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
905309082 1:37037196-37037218 CAGTGGGTGTGGAGAGCAAGAGG - Intergenic
906526619 1:46497045-46497067 CCCTGGGTGTCAATGGCAGAGGG - Intergenic
907515010 1:54988337-54988359 CACTGGGAGTGAAGGCCAAGGGG - Intronic
909596710 1:77413864-77413886 CTCTGGGTGAGAAGGGGAAGTGG - Intronic
909775125 1:79474878-79474900 CTCAGGGTATGAAGGTCAAACGG + Intergenic
910072738 1:83238642-83238664 CACTGATTGTGGAAGGCAAAGGG - Intergenic
912442037 1:109706481-109706503 CACTGGGCCTGATGGTCAAAAGG + Intronic
913176565 1:116278107-116278129 GAGTGTGTGGGAAGGGCAAATGG - Intergenic
914390094 1:147213386-147213408 CACTGAATCTGAAGGGAAAAAGG - Exonic
915008787 1:152665145-152665167 CTCTCAGTGTGAAGGGAAAAGGG + Intergenic
915930140 1:160055266-160055288 GACTGGCTGTGTGGGGCAAATGG - Intronic
916552376 1:165861120-165861142 CACTTGATGGAAAGGGCAAAAGG + Intronic
917748586 1:178034702-178034724 CACCAGGTGTGAAGGGAAGATGG + Intergenic
918105810 1:181414085-181414107 CTCTGTTTGTGTAGGGCAAAAGG + Intronic
918431012 1:184460841-184460863 CAATGTGTGTGAAAGGCAAGTGG + Intronic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
921671038 1:217924394-217924416 CACAAGGTGGGAAGGGCACAAGG + Intergenic
922109225 1:222541261-222541283 TACTGGGTGCAAAGGGCAGAAGG + Intronic
922340999 1:224655114-224655136 CCCTGGGTGTGAAGGGGTAAGGG + Intronic
1063091846 10:2872619-2872641 CATAGGGAGTGAAGGGCAAAGGG + Intergenic
1063737677 10:8779069-8779091 CTCTGTGTGTGAAGGGCCATGGG - Intergenic
1063878780 10:10509432-10509454 CATTTGGTGGAAAGGGCAAATGG - Intergenic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1070440330 10:76436648-76436670 GTCTGGGTGTGAAGAGCACAGGG - Intronic
1070726236 10:78793086-78793108 CACCGGGTAGGAAGGACAAATGG + Intergenic
1071434638 10:85635734-85635756 CACTGTGTGGTAAGGGGAAAGGG + Intronic
1071805435 10:89115326-89115348 CAATGGGGAGGAAGGGCAAAGGG + Intergenic
1071864171 10:89707648-89707670 AATTGGGTGTGAAGGGGGAAAGG - Intronic
1072016486 10:91351949-91351971 GACTGAGTGTCATGGGCAAAAGG + Intergenic
1072526017 10:96272369-96272391 CACTGGGTGTGATGAGCAAGTGG - Intergenic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1073506520 10:103997613-103997635 TACTGGGTGTGAAGCGGTAATGG + Intronic
1074696028 10:116050909-116050931 TTCTGGGGGTGAAGTGCAAATGG + Intergenic
1075118054 10:119643689-119643711 CACTGGGAGAGAAGGGCTACAGG - Intergenic
1076623763 10:131809254-131809276 CACTGGGAATGAATGGCAAATGG - Intergenic
1076623796 10:131809395-131809417 CACTGGGGGTGAATGGCAGATGG - Intergenic
1076911084 10:133389998-133390020 CACCGTCTGAGAAGGGCAAAAGG - Intronic
1077176412 11:1193181-1193203 CACTGGGTGTGTGGGGCCGAAGG + Intronic
1078074955 11:8150152-8150174 CACTTGGAGGGATGGGCAAAGGG - Intronic
1078461663 11:11519532-11519554 GAATGGATGTGGAGGGCAAAGGG + Intronic
1079103929 11:17558603-17558625 AACTGGCTGTGAAGGGCAGAGGG - Exonic
1082175616 11:49055668-49055690 CAGGGGGTGTGATGGGCAGAGGG - Intronic
1084045391 11:66565045-66565067 TTCTGGCTGTGAATGGCAAATGG - Intronic
1084538608 11:69773631-69773653 CACAGGGTGAGAAGGGGACATGG + Intronic
1085471101 11:76758658-76758680 GGCTGAGTGTGAAGGGCATAGGG + Intergenic
1086690131 11:89780401-89780423 CAAGGGGTGTGATGGGCAGAGGG + Intergenic
1086698531 11:89872571-89872593 CAAGGGGTGTGATGGGCAGAGGG - Intronic
1086707635 11:89971925-89971947 CAAGGGGTGTGATGGGCAGAGGG + Intronic
1086715723 11:90059556-90059578 CAAGGGGTGTGATGGGCAGAGGG - Intergenic
1087613498 11:100461929-100461951 CACTGGGTGTGGAGGGTATGAGG + Intergenic
1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG + Intergenic
1089411509 11:118246954-118246976 CCCCAGGTCTGAAGGGCAAAGGG + Intronic
1089610117 11:119664339-119664361 CACTGGGGGTGGAGGGCTCAAGG - Exonic
1090222410 11:125039870-125039892 AACTGAGTGTGAGGTGCAAAAGG - Intronic
1090604292 11:128405594-128405616 CACAGGGCGTGAAAGGCAAGAGG - Intergenic
1091642930 12:2251221-2251243 TCATGGGGGTGAAGGGCAAAGGG + Intronic
1091842292 12:3629817-3629839 GGCTGGGTGTGAAGGACACAAGG + Intronic
1092250006 12:6889165-6889187 CACTTGGGGGCAAGGGCAAAGGG + Intronic
1092569686 12:9708751-9708773 CACTGGGTCTCAGGGACAAAAGG + Intergenic
1092750519 12:11714956-11714978 AACTGGGTGTGATGGGCCCATGG - Intronic
1093347345 12:18054919-18054941 CACTGGATGTGGAGAGGAAATGG - Intergenic
1094272069 12:28628036-28628058 CACTGAGTGTGAAGGACACAAGG + Intergenic
1094623936 12:32105870-32105892 TACAGGGGGTGAAAGGCAAAGGG - Intergenic
1095310787 12:40693771-40693793 CACTGAGTGGGCGGGGCAAAAGG + Intronic
1095517941 12:43027813-43027835 CAGTGGTTGTCAAGGGCATAGGG - Intergenic
1096239585 12:49952602-49952624 CACTGGGAGTGAAAGGCCATGGG + Intronic
1096335285 12:50750719-50750741 CACTGGTGGTAAAGGGCAGAAGG - Intergenic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1096505265 12:52088566-52088588 CACTGGCTGTGGAGGGGAATCGG - Intergenic
1100879411 12:98999756-98999778 CACCGCGTGTGAAGGGCATGTGG + Intronic
1102876794 12:116455229-116455251 AATTGGCTGTGAAGGGCAGAGGG - Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1107383530 13:39882567-39882589 GAGTGGGTCTGCAGGGCAAAGGG + Intergenic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1108592333 13:51922978-51923000 CAGAGCCTGTGAAGGGCAAAAGG - Intergenic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1111128222 13:83940111-83940133 CTCTGGGGGTGAGGGGCAAGGGG + Intergenic
1112205016 13:97316209-97316231 CACTGAATGTGAAGTGGAAAAGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114820297 14:26009995-26010017 CACTGGCTGTGAAGGCCAAGGGG + Intergenic
1115736059 14:36331338-36331360 CACAGGGAGTGGAGGGCAAGGGG - Intergenic
1116765808 14:49069689-49069711 CAGTTGGGGTAAAGGGCAAATGG - Intergenic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1118370472 14:65133394-65133416 AATTGGGGGTGAAGGACAAAGGG - Intergenic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1119192002 14:72689284-72689306 CACAGGGTTTGCAGGGCCAAGGG - Intronic
1119365602 14:74089065-74089087 CCGGGGGTGTGAAGGGGAAAGGG + Intronic
1121044177 14:90775805-90775827 GACTGGCTCTGAAGAGCAAATGG - Intronic
1121050805 14:90817706-90817728 CACTGGGTGGGATGGAGAAATGG + Intergenic
1121183587 14:91947740-91947762 CCCTGGGTGGGAAGGTCAAGGGG - Exonic
1121405014 14:93714432-93714454 CACTGGGTGTGAGGGGGGAGAGG - Intergenic
1122135857 14:99632520-99632542 CACTTGGTGATAAGGTCAAATGG - Intergenic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1125907936 15:43410703-43410725 TACTGGGTGTGAAGGGGAAGGGG - Intronic
1127303886 15:57683304-57683326 AACTGAATTTGAAGGGCAAATGG + Intronic
1128818199 15:70629607-70629629 CACTGGTTTTGAAGGGGAAAGGG - Intergenic
1132140068 15:99385037-99385059 CCTTGGGCCTGAAGGGCAAAGGG + Intronic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1132915092 16:2339977-2339999 CACTGTGTGGGAACGGGAAAGGG - Intronic
1135424323 16:22324789-22324811 ATCTGGGTGTGAAGGGCAGGTGG + Intronic
1135505656 16:23033848-23033870 CAGTGGGTCTGAAAGGCACATGG - Intergenic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1138930906 16:61654762-61654784 CACTGGGTGAGAAAGACAGATGG + Intronic
1140126238 16:72121275-72121297 CACTGGGAGTGAGGGGCTACTGG - Intronic
1141580999 16:84998616-84998638 CAGTCGGTGTGATGGGCACAGGG - Intronic
1142938987 17:3365444-3365466 CACTGATTGTAAGGGGCAAAAGG - Intergenic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1145304324 17:21664593-21664615 CACTCTGTGGGAAGGGAAAAGGG + Intergenic
1146172074 17:30642006-30642028 CCCTGGGGCTGAGGGGCAAAGGG - Intergenic
1146584686 17:34071992-34072014 CACAGGGTGGGAAGTGCAGAAGG + Intronic
1146691220 17:34877547-34877569 CCCTGGGTGTGAAGTACTAATGG + Intergenic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1150779343 17:68107560-68107582 CACTGGGTATGAGTGGCAAGAGG + Intergenic
1151965221 17:77427678-77427700 CACAGAGTGTGGATGGCAAAAGG - Intronic
1152179942 17:78813143-78813165 CACTGTGGTTGAAAGGCAAAGGG - Intronic
1152296172 17:79468130-79468152 TTCAGGGTGGGAAGGGCAAATGG - Intronic
1152684501 17:81687422-81687444 CACTGGGTGGGCAGGGCAGGTGG + Intronic
1153524096 18:5978767-5978789 CACTGGTTGTGAGGAGCTAATGG + Intronic
1155087424 18:22471934-22471956 CACTGTGTCTGAAGGGCACTGGG - Intergenic
1155696262 18:28690568-28690590 TACTTGGAGGGAAGGGCAAAGGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1157043057 18:44062187-44062209 GAGTGGTGGTGAAGGGCAAAAGG + Intergenic
1160265669 18:77339407-77339429 CACAGGCTGTGCAGGGCTAAGGG + Intergenic
1162373068 19:10290363-10290385 CACTGGGTCTCCAGGGCGAAGGG - Intronic
1163034373 19:14562731-14562753 CCCTGGGTGTGGCGGGGAAATGG + Intronic
1165362018 19:35342566-35342588 CAAGGGGTGTGAATGGGAAAGGG - Intronic
1165455553 19:35908419-35908441 AACTAGACGTGAAGGGCAAAGGG + Intergenic
1167776101 19:51557814-51557836 CAGTGGGTGTGAACAGCCAATGG - Intergenic
1168443509 19:56392031-56392053 CACTGGATGTTTAGGGGAAATGG - Intronic
927131142 2:20061830-20061852 CATGTGATGTGAAGGGCAAAAGG - Intergenic
927186723 2:20487405-20487427 CACTGGCAGTGCAGGGAAAAGGG + Intergenic
927405420 2:22761082-22761104 CACAGGGTGGGAAGGGGCAAAGG - Intergenic
928908850 2:36398026-36398048 CAATGGGTGTGGGGAGCAAAGGG - Intronic
929204459 2:39275239-39275261 CACTGGGTGGGTAAGGCAGAAGG + Intronic
931743704 2:65273135-65273157 CACTTGCTGTGAATGGCAAAGGG - Intergenic
932430654 2:71672013-71672035 CACTGGGAGGGAAGGCCAGAGGG + Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
934728017 2:96637826-96637848 CACTGGGGGTGAGGGTGAAAGGG - Intronic
936501894 2:113073181-113073203 CACTGGGAGTAAAGGCCACAGGG - Intronic
937639573 2:124196218-124196240 CCCTAGGTGAGAAGGGCTAAGGG + Intronic
940000913 2:148965373-148965395 CACTGGTTGTGATGGGAGAAGGG + Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940861478 2:158774433-158774455 CACTGGATTTGAAAGGAAAACGG + Intergenic
941853342 2:170206232-170206254 CAATGAGTTTGAAGGACAAATGG - Intronic
942643193 2:178082529-178082551 CACTTTGAGGGAAGGGCAAAGGG + Intronic
943984648 2:194603947-194603969 CCCTTGGTCTGAAGGGCACATGG + Intergenic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
944747338 2:202671595-202671617 CACTGGCTGTGAATGGAAATGGG + Intronic
944944891 2:204672388-204672410 CACTGGACATGAAGGGCAGATGG + Intronic
946316207 2:218914782-218914804 CAAAGAGTGTGAAGGGTAAAAGG - Intergenic
947348009 2:229213283-229213305 CATTGGATGTGGAGGGCAAGGGG - Intronic
947529401 2:230899213-230899235 TCCTGGGGGTGAAGGGGAAAGGG - Intergenic
947824558 2:233096212-233096234 CACTGGGTGAGAAGGTCACTCGG - Intronic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
948368382 2:237473117-237473139 CCCTCGGTGTGGAAGGCAAAGGG + Intergenic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
948666780 2:239539824-239539846 CACGGGGTGTGAGGGGAACAAGG - Intergenic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
948881455 2:240859594-240859616 CAGAGAGTGTGATGGGCAAAAGG - Intergenic
1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG + Exonic
1169212537 20:3775418-3775440 CAGTGTGTGTGAAGGGCTAACGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171046439 20:21812415-21812437 GCCTGGCTGTGAGGGGCAAATGG - Intergenic
1171521851 20:25782132-25782154 CACTCTGTGGGAAGGGAAAAGGG + Intronic
1171554974 20:26073751-26073773 CACTCTGTGGGAAGGGAAAAGGG - Intergenic
1171823563 20:29876019-29876041 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1171896527 20:30814326-30814348 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1172755335 20:37279929-37279951 AACTGGGTGTGATGGCCAACAGG - Intergenic
1175327714 20:58141313-58141335 CACTTGGTGTGCAAGGGAAAAGG + Intergenic
1176655651 21:9587068-9587090 CACTCTGTGGGAAGGGAAAAGGG + Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178858114 21:36266939-36266961 GGCAGGGTGTGAAGGGCACAAGG - Intronic
1180143814 21:45908914-45908936 GACTGGGTGTGGAGGGCACGGGG - Intronic
1180338301 22:11598945-11598967 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1180560704 22:16612334-16612356 CACTAAGTGTGAAGGGGAAGGGG - Intergenic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1181551320 22:23640425-23640447 TGCTGGGTGTGAGGGGCACAGGG + Intergenic
1181796942 22:25318236-25318258 TGCTGGGTGTGAGGGGCACAGGG - Intergenic
1183150865 22:36036435-36036457 CACATTATGTGAAGGGCAAAAGG - Intergenic
1185028466 22:48428907-48428929 CACTCGGTGTGAGGTGAAAAAGG + Intergenic
1185079633 22:48702538-48702560 CACGGGGCGTAAAGGGCACAGGG - Intronic
1185344135 22:50304080-50304102 CTCTGGGTGTGAAGGGCTCCAGG + Intronic
949339678 3:3015713-3015735 CACTGTGTGTGAATGGCACTTGG + Intronic
951856879 3:27206982-27207004 GACTAGGTTTGAAGTGCAAATGG - Intronic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953338661 3:42115741-42115763 CACTTGCTGTGAACAGCAAAGGG - Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
954393189 3:50278231-50278253 CACTGGGAAGGAAGGGCACAGGG + Intergenic
954948339 3:54446401-54446423 CACAGGTGGTGAAGGGCAGAGGG + Intronic
956455655 3:69418360-69418382 CACAGGGTGTGGAGGTCATAGGG - Intronic
956770293 3:72520228-72520250 CACTGGGAGGGAATGGCAAATGG - Intergenic
961871027 3:129988410-129988432 GAATGGGTCTGGAGGGCAAATGG - Intergenic
961871278 3:129990085-129990107 AAATGGGTCTGGAGGGCAAATGG + Intergenic
961872140 3:129996327-129996349 CAGAGGGTGTGAGGGGCAAATGG + Intergenic
962363063 3:134757684-134757706 CACTGGGAGTGAGGGGCTAGGGG + Intronic
962697534 3:137965170-137965192 AAATGGGTGTCAATGGCAAATGG + Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964640298 3:158902594-158902616 CAATGGGTGGAAAGGGCAAATGG + Intergenic
968065420 3:195756272-195756294 CCCTGGGTCTGAAGGGGAAGTGG + Intronic
968561654 4:1286345-1286367 CTCTGCTGGTGAAGGGCAAAGGG + Intergenic
968948932 4:3680242-3680264 CAGTGGGTGTGCAGGGCGCAAGG + Intergenic
969690787 4:8703026-8703048 CACTGGGTGAGAAGCGCTACTGG + Intergenic
971615212 4:28780570-28780592 CAATGGGTGAGAGGGGCCAAAGG + Intergenic
972337711 4:38122396-38122418 CACTGGTTGTGCAGGGCAGAAGG - Intronic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
972798715 4:42449411-42449433 CACTGTTTGTGGATGGCAAAAGG + Intronic
977011460 4:91639806-91639828 CACTGGATGAGAAGGGAAATAGG + Intergenic
980422411 4:132580618-132580640 AAATGGCTGTGAAGGACAAAGGG - Intergenic
980774908 4:137425179-137425201 CACTTGGTGTGCTGGGCTAATGG - Intergenic
982105412 4:152007785-152007807 CACAGGGTGGGAAGAGCAAGGGG + Intergenic
983845646 4:172514581-172514603 ATCTGGGGGTGGAGGGCAAATGG - Intronic
983910432 4:173232895-173232917 CAGTGGCTGGGAAGGGGAAAGGG - Intronic
985445035 4:190017207-190017229 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
986490202 5:8281278-8281300 CACTGGGTGGGAGGGGCAAGGGG + Intergenic
989017157 5:36951102-36951124 CACTGGGAGTAAAGGGGAAAGGG - Intronic
989376382 5:40766751-40766773 CACTGGGAGGGAAAGGCACAAGG + Intronic
993987793 5:94618351-94618373 CACTGGGTGTCAAGCGCCACGGG + Exonic
994282405 5:97921438-97921460 CACAGGGTGAGAAGGGCACGTGG - Intergenic
994723167 5:103403717-103403739 CAATGGGTATGAAAGGCAAAGGG + Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
997622050 5:135305415-135305437 CTCTGGGTGCTAAGGACAAAGGG - Intronic
998214523 5:140227250-140227272 CACCTGGTGTGAAGGGCCAGGGG + Intronic
998385606 5:141755482-141755504 CACTGGGTGGGAAGGTGAACTGG - Intergenic
998585034 5:143418626-143418648 CACAGGGTGTGAAGGGGCACAGG + Intronic
998796193 5:145821691-145821713 CACTGGATGAGATGGCCAAAGGG - Intronic
998894573 5:146785864-146785886 CAGTGGTTGGGAAGGGCATAGGG + Intronic
998958872 5:147464299-147464321 CCCTGGGAGTGAAGGTAAAAGGG - Intronic
999366103 5:151024517-151024539 CACAGGGAGTTAATGGCAAAGGG + Intronic
999510472 5:152245477-152245499 AACTGGATGTGAAGGGTTAAAGG + Intergenic
999728361 5:154455724-154455746 CCCTGGGGAGGAAGGGCAAAGGG + Intronic
999923378 5:156347257-156347279 CACTGGGACTTAAGGCCAAATGG - Intronic
1000552100 5:162679729-162679751 CACCAGGGGTGAAGGACAAAGGG - Intergenic
1001308858 5:170596281-170596303 CTATGGGTGTGATGGGCACAGGG - Intronic
1002441725 5:179267735-179267757 CACTGGGTGTGCAGGGCCCAGGG + Intronic
1002507500 5:179690105-179690127 CACTGGGTGTGAATGTCAGTGGG + Intronic
1002596150 5:180324923-180324945 CACTGGGCGTCAAAGGCAATGGG - Intronic
1002648311 5:180673359-180673381 CTCGGGGTGTGCAGGGCTAATGG - Intergenic
1004634285 6:17452101-17452123 GACTGTGTGTGTAGGGCAAGTGG + Intronic
1004798353 6:19115352-19115374 CACTGGGTGGGTAGGGCCAGAGG + Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1006923013 6:37638548-37638570 CACTGGGGCTGATGGGCACATGG + Exonic
1007825989 6:44600929-44600951 TGCTGGGTGTGAAGGGCTCAGGG + Intergenic
1008103175 6:47414697-47414719 CAATGGGTGTCAAGGATAAAAGG + Intergenic
1008588495 6:52970326-52970348 CACTGAGAGTGAAGGCCCAAGGG - Intergenic
1008595829 6:53040732-53040754 CTCAGGTTGTGAAGGGCAAGGGG + Intronic
1010285924 6:74077693-74077715 TACTGAGTGTGAAGGGCAGATGG + Intergenic
1010341028 6:74752740-74752762 CACTGGGTGTTAAGGGAAGAAGG - Intergenic
1010492530 6:76492801-76492823 CACTGGCCCTGATGGGCAAAAGG - Intergenic
1011537087 6:88387647-88387669 CACAGGCTGTGAAAGGCAATTGG + Intergenic
1011768664 6:90652096-90652118 CCCAGGCTGTGAAGGCCAAAGGG - Intergenic
1012885285 6:104839507-104839529 CATGGGATGTGAAGGACAAAGGG + Intronic
1015471168 6:133607903-133607925 TCCTGTGTGTGAAGAGCAAAAGG - Intergenic
1016027819 6:139306462-139306484 AACTGGGCTTGAATGGCAAATGG + Intergenic
1019645873 7:2128723-2128745 CCCAGGGTGAGAAGGGCAGAGGG - Intronic
1021452667 7:20797554-20797576 CACTGGGGGTGAAGGTGAAGGGG - Intergenic
1022950082 7:35330300-35330322 CACTGGGAGAGAGGGGGAAATGG - Intergenic
1023057425 7:36301200-36301222 CCCTGGGCGTGAAAAGCAAAAGG - Exonic
1023585875 7:41729280-41729302 TACTGGGGGTGGAGGGGAAATGG - Intergenic
1024260602 7:47571383-47571405 CCCTGGGGGTGAAGCGGAAAGGG - Intronic
1024547795 7:50537084-50537106 CACTGGGGTTGCAGGACAAATGG - Intronic
1025282338 7:57637207-57637229 CACTCTGTGGGAAGGGAAAATGG + Intergenic
1025302392 7:57828312-57828334 CACTCTGTGGGAAGGGAAAATGG - Intergenic
1026608631 7:71837500-71837522 CACTGAGTTTTTAGGGCAAAGGG + Intronic
1026740460 7:72975717-72975739 CACTGGGTGTCCAGGGCCAGTGG + Intergenic
1026797762 7:73377202-73377224 CACTGGGTGTCCAGGGCCAGTGG + Intergenic
1027103271 7:75389353-75389375 CACTGGGTGTCCAGGGCCAGTGG - Intergenic
1027290466 7:76703796-76703818 CACTGATTGTGGAAGGCAAAGGG - Intergenic
1028114342 7:86980914-86980936 GACTGGATCTGAAGAGCAAATGG - Intronic
1028143009 7:87292067-87292089 CACAGGGTGTCCAGGGCAACAGG - Intergenic
1028297890 7:89158372-89158394 GAATGGGTGTGGAGGGCTAAGGG - Intronic
1028333259 7:89622630-89622652 GACTGGGTGTGGAGTGGAAAGGG - Intergenic
1028989006 7:97029611-97029633 AAGTGGGTGTGAAGGGTAACAGG + Intergenic
1029351646 7:100017186-100017208 AAATGAGTGTAAAGGGCAAAGGG + Intronic
1034002012 7:147424860-147424882 GACTGGATGTGAAGGTCAAAAGG - Intronic
1034161037 7:148994522-148994544 AGCTGGGTGTGAAGGTCAGAGGG - Intergenic
1035766531 8:2110599-2110621 CACTGGGCATTAAGGGAAAAAGG - Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1037318046 8:17617453-17617475 CACTGGCTCTGAAGGGCTCAGGG + Intronic
1037712051 8:21362551-21362573 AAGTGGGAGTGAAGAGCAAAGGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038311587 8:26449584-26449606 GACTGGGTGTGGAGAGAAAACGG + Intronic
1038328092 8:26587680-26587702 CACTGGGTGGAAAGGGCAAAGGG - Intronic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1039220171 8:35321504-35321526 CAATCGGTGTGGAAGGCAAAGGG - Intronic
1039968409 8:42300294-42300316 CACTGAGTGAGAAAGGCAACAGG - Intronic
1041798046 8:61767668-61767690 CACCTGGTGGGAAGGGCAGATGG + Intergenic
1041923897 8:63215656-63215678 CAAAGGGTATGAAGGACAAATGG - Intergenic
1046541272 8:115586951-115586973 CATTTGTTTTGAAGGGCAAAAGG - Intronic
1046801999 8:118438944-118438966 CACTGTTTGTGCAGGGAAAAGGG + Intronic
1047480612 8:125278515-125278537 CCCTGAGTGTGAAGGGCAAGTGG - Intronic
1048710352 8:137203216-137203238 CAGTGGGTGTGAAGCCCAACTGG + Intergenic
1049025112 8:139983135-139983157 CACATGGTGGGAGGGGCAAAGGG - Intronic
1049030864 8:140036427-140036449 CGCTGAGTGGGAAGGGAAAAGGG + Intronic
1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG + Intronic
1051801877 9:20944006-20944028 CACTGGGTCAGAAGAGAAAATGG - Intronic
1053423769 9:37997844-37997866 CACTGTGTGACAAGGGCAAGTGG + Intronic
1053749164 9:41235639-41235661 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1054254601 9:62800492-62800514 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1054336702 9:63815110-63815132 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1055392493 9:75838025-75838047 GACTGAGTTTGAAGGACAAAGGG - Intergenic
1056173639 9:84012885-84012907 GATTGGGGGTGAAGGGCAGATGG + Intergenic
1060015370 9:120081987-120082009 CACAGGGTGTTGAGGGCTAAGGG + Intergenic
1060548095 9:124472311-124472333 CAGAGGGTGAGAAGGGCACAGGG - Intronic
1061506695 9:131035740-131035762 CAATAGGTGTGGAAGGCAAAGGG - Intronic
1062396471 9:136354849-136354871 CACAGGGTGTGGTGGGCACAGGG + Intronic
1062444184 9:136586830-136586852 CTCTGTGTGTGCAGGGCAAGAGG + Intergenic
1203376634 Un_KI270442v1:382535-382557 CTCTGGGTGTGTGGGGCAACAGG + Intergenic
1203633364 Un_KI270750v1:90483-90505 CACTCTGTGGGAAGGGAAAAGGG + Intergenic
1188182691 X:27075311-27075333 AAGTGGATGGGAAGGGCAAATGG - Intergenic
1188872538 X:35390677-35390699 CACTGAGAGTAAAGGGTAAATGG - Intergenic
1189081226 X:37974818-37974840 CACTGAAGGTGAAGGGCAGAAGG + Intronic
1189097393 X:38154988-38155010 GATTGGGTGTGGAGGGCATAGGG - Intronic
1191105827 X:56771573-56771595 ATCTGAGTGTGAAGGGAAAAAGG - Intergenic
1191106820 X:56776975-56776997 ATCTGAGTGTGAAGGGAAAAAGG - Intergenic
1192829323 X:74734410-74734432 CACTGGGAGTGAAAAACAAAAGG + Exonic
1193473546 X:81935373-81935395 CACTGGTGGTGAAGGGCAAAGGG - Intergenic
1195387475 X:104326567-104326589 AACTGGCTGTGAAGGGGAAGAGG - Intergenic
1196782989 X:119399572-119399594 CACCGGGTGTGGCGGGCAGAGGG + Exonic
1196988652 X:121303034-121303056 TACTGGCTGTGAAAGGCAAAAGG - Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1199736028 X:150687554-150687576 CACAGGTTGTGAAGTGCACAAGG + Intergenic
1200101860 X:153692322-153692344 CAGTGGGGGTGATGGGCACAGGG - Intronic
1201073418 Y:10169952-10169974 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic