ID: 947868719

View in Genome Browser
Species Human (GRCh38)
Location 2:233420082-233420104
Sequence CGTGGCAGTCGGCAGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947868719 Original CRISPR CGTGGCAGTCGGCAGGGGCC TGG Intronic