ID: 947869233

View in Genome Browser
Species Human (GRCh38)
Location 2:233423755-233423777
Sequence CAGGCCAAGGATCCAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947869233_947869241 -3 Left 947869233 2:233423755-233423777 CCCCTTCCTGGATCCTTGGCCTG 0: 1
1: 1
2: 1
3: 20
4: 323
Right 947869241 2:233423775-233423797 CTGGAAGAGCAGGCTTTTGTTGG 0: 1
1: 0
2: 4
3: 21
4: 246
947869233_947869242 -2 Left 947869233 2:233423755-233423777 CCCCTTCCTGGATCCTTGGCCTG 0: 1
1: 1
2: 1
3: 20
4: 323
Right 947869242 2:233423776-233423798 TGGAAGAGCAGGCTTTTGTTGGG 0: 1
1: 1
2: 3
3: 32
4: 363
947869233_947869243 -1 Left 947869233 2:233423755-233423777 CCCCTTCCTGGATCCTTGGCCTG 0: 1
1: 1
2: 1
3: 20
4: 323
Right 947869243 2:233423777-233423799 GGAAGAGCAGGCTTTTGTTGGGG 0: 1
1: 2
2: 13
3: 69
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947869233 Original CRISPR CAGGCCAAGGATCCAGGAAG GGG (reversed) Intronic
900251782 1:1674740-1674762 GAGGCCGAGGGTCCAGGATGGGG - Intronic
900262190 1:1737596-1737618 GAGGCCGAGGGTCCAGGATGGGG - Intronic
901810751 1:11765769-11765791 CAGGCCTCGGAGCCAGGGAGGGG - Intronic
901890397 1:12258609-12258631 CATGCCAGGGCTCCAGGAGGGGG - Intronic
902439627 1:16421082-16421104 CAGGTCAAAGAACTAGGAAGTGG + Intronic
902632590 1:17714195-17714217 GAGGACCAGGAGCCAGGAAGTGG - Intergenic
902892563 1:19455029-19455051 CAGTCCAAGCAGCCAGGATGCGG + Intronic
903173494 1:21567647-21567669 AAGGCCACAGAGCCAGGAAGTGG - Intronic
903222735 1:21878085-21878107 CTGGCCAAGGATCTATGGAGAGG + Intronic
903445242 1:23418764-23418786 GAGGCCAATGATCCAGGGAGAGG - Intronic
904704201 1:32378090-32378112 CAGGACCAGGGTCTAGGAAGAGG - Intronic
905209112 1:36361265-36361287 AGGGCCAAGGCTCTAGGAAGTGG - Exonic
905772724 1:40648848-40648870 CAGACCCAGCATCCAGCAAGGGG - Intronic
906610924 1:47201813-47201835 CAGGGAAAGCTTCCAGGAAGAGG + Intergenic
907671628 1:56479061-56479083 GAGGCCAATGATCCAGACAGAGG - Intergenic
908082571 1:60597049-60597071 AAGGTCAAGGATCCAGGAAGAGG + Intergenic
908438484 1:64130467-64130489 GAGGGTGAGGATCCAGGAAGGGG - Intronic
908654611 1:66374771-66374793 CAGCTCAATGATGCAGGAAGGGG + Intergenic
909212975 1:72847800-72847822 CAGCCTAAGGATGCAGGAACGGG - Intergenic
911703578 1:100984353-100984375 GAGCCCAGGGAACCAGGAAGTGG + Intergenic
911707158 1:101026652-101026674 AAAGCCAAGGTTCAAGGAAGCGG - Intergenic
915934154 1:160081086-160081108 GAGGCCATGGATCCAGAAGGCGG - Intergenic
916488464 1:165280021-165280043 CAGGCCGTGGCTCCAGAAAGGGG + Intronic
916819790 1:168387115-168387137 CAGGACAGGGAACCAGGGAGGGG - Intergenic
917159619 1:172043044-172043066 CAGGCCCAGGGTCTTGGAAGAGG + Intronic
918202659 1:182281667-182281689 GAGGACAGGGATGCAGGAAGAGG + Intergenic
919737063 1:200959359-200959381 CAAGCCATGGACACAGGAAGGGG - Intergenic
919780695 1:201218851-201218873 CAGGCCCAGAAGCCAGGCAGTGG + Intronic
921597476 1:217070092-217070114 TGGGGCAAGGGTCCAGGAAGTGG + Intronic
922193588 1:223340653-223340675 CAGGCAAAAGATCCAGGTAGAGG + Intronic
922404465 1:225298148-225298170 CAGGCCTAGGATGCAGGCAAAGG + Intronic
922563114 1:226583248-226583270 AAGGCTATGGATACAGGAAGTGG + Intronic
923107390 1:230865227-230865249 CAGGACAAGAATCCAGGACATGG + Intronic
1063216643 10:3931488-3931510 CAGGCCACGCACCCAGTAAGGGG + Intergenic
1063662459 10:8043821-8043843 TAGGCCGAGGGTCCAGGGAGAGG - Intergenic
1065886202 10:30079564-30079586 CATGACCAGGAACCAGGAAGAGG - Intronic
1067407629 10:46037390-46037412 CAAGCCAAGGCTACATGAAGAGG + Intronic
1067550457 10:47230779-47230801 CAGGGCTCGGAGCCAGGAAGTGG + Intergenic
1068131087 10:52896195-52896217 AAAGCCACGGATTCAGGAAGGGG + Intergenic
1070775757 10:79108852-79108874 CAGCCCCAGGAGCCAGGCAGGGG - Intronic
1071125400 10:82329005-82329027 CAGGCAAAGGATGCAGAAAATGG - Intronic
1072194940 10:93109463-93109485 CAGGCCAAGGACTGAGGGAGGGG - Intergenic
1072449216 10:95526185-95526207 AAGGCCACAGAGCCAGGAAGGGG + Intronic
1074794285 10:116925393-116925415 CAGGCTCAAGACCCAGGAAGTGG - Intronic
1074820013 10:117171071-117171093 ATGGCCCAGGATTCAGGAAGGGG - Intergenic
1076449854 10:130549433-130549455 CAGTCCTAGGAGCCAGGAAGAGG + Intergenic
1076477908 10:130765465-130765487 CAGGCTGAGGGTCAAGGAAGAGG - Intergenic
1077045656 11:544134-544156 CAGCCCAAGGCCCCAGGAAAAGG - Intronic
1077488789 11:2851004-2851026 CGGGCCAGGGAGCCAGGAGGAGG + Intergenic
1077532456 11:3103622-3103644 CAGGCTCAGGAGCCAGGCAGAGG - Intronic
1077893543 11:6437158-6437180 CAGGCCATGGACACAGGAATGGG - Exonic
1078800781 11:14643159-14643181 CAGGCCCAGGATCCTTGCAGTGG - Intronic
1079297321 11:19244825-19244847 CAAGCAAGGGACCCAGGAAGTGG + Intergenic
1081702184 11:45158991-45159013 CAGGCCACAGAACTAGGAAGGGG - Intronic
1081907194 11:46677558-46677580 AAGGACAAGGCTGCAGGAAGAGG + Exonic
1082249165 11:49960586-49960608 CAGGGCAACCCTCCAGGAAGGGG - Intergenic
1083033729 11:59616695-59616717 GGGACCATGGATCCAGGAAGGGG - Intergenic
1083214292 11:61208767-61208789 CGGGCCAAGGATGAGGGAAGTGG - Intronic
1083217176 11:61227596-61227618 CGGGCCAAGGATGAGGGAAGTGG - Intronic
1083280257 11:61622454-61622476 CTGGCCCTGGATCCAGTAAGTGG + Intergenic
1083310360 11:61780726-61780748 CAGGGCCAGGAGACAGGAAGTGG - Exonic
1083398377 11:62406816-62406838 CAGGGAAAGGATAGAGGAAGAGG + Intronic
1083405035 11:62450903-62450925 CAGTTCAAGATTCCAGGAAGAGG + Intronic
1084626359 11:70310874-70310896 CAGGCCAAGGACCCAGTATCGGG + Intronic
1085638697 11:78177711-78177733 CAGGCCTAGGATCTATAAAGTGG + Intronic
1085771536 11:79330351-79330373 GAGGCCAGCGATTCAGGAAGTGG - Intronic
1086855526 11:91860840-91860862 CAGGCCAAGCCTCCAATAAGAGG + Intergenic
1087282481 11:96227410-96227432 CATGCCAAGAATGCAGGGAGTGG + Intronic
1089359077 11:117874560-117874582 CAGGCCAGGGAGGCAGGAAGGGG - Intronic
1089558811 11:119332998-119333020 GAGGCCAAGGGTGGAGGAAGTGG + Intergenic
1089599701 11:119605724-119605746 AAGGCCAAGGAACAGGGAAGGGG - Intergenic
1090267010 11:125359623-125359645 GAAGCCAAGGACCCGGGAAGAGG - Intronic
1090969174 11:131624841-131624863 CATGCCAGGAATCCAGGAGGTGG + Intronic
1091300304 11:134503176-134503198 CAGGCGAAGGGGCCAGGAGGGGG + Intergenic
1091629984 12:2152760-2152782 CAGGACATGGAACCAGGAGGTGG + Intronic
1091885240 12:4012445-4012467 CAGGCCAAGAAACCAGAAATTGG + Intergenic
1092535308 12:9381143-9381165 TAGGACCAGGATTCAGGAAGTGG - Intergenic
1092863863 12:12743097-12743119 CAGGCAAATGATATAGGAAGTGG - Intronic
1093788532 12:23219785-23219807 CAACCCAAGGTTTCAGGAAGGGG - Intergenic
1096385008 12:51189577-51189599 CCCGCAAAGGAACCAGGAAGAGG + Exonic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096570635 12:52521146-52521168 CAGGCCAAAGAGCAAGGAAAAGG - Intergenic
1096695555 12:53345991-53346013 CAGGAAAATGTTCCAGGAAGCGG - Intergenic
1096839612 12:54372073-54372095 CTGGGCAAGACTCCAGGAAGGGG - Intronic
1096896130 12:54821937-54821959 CAGCCTAAGGATCCTGGAGGTGG - Intergenic
1097154772 12:57004725-57004747 CAAGCCCAGTATTCAGGAAGAGG + Exonic
1098786056 12:74757009-74757031 AAGGACACGGATCCAGGAGGCGG + Intergenic
1100012643 12:89972162-89972184 CAGGCCAAGAAGTCAGGGAGTGG - Intergenic
1100894317 12:99162524-99162546 CAGGACAAGAATGGAGGAAGGGG - Intronic
1101627729 12:106461988-106462010 CAAGACAGGGATCCAGGAGGAGG - Intronic
1102244201 12:111344715-111344737 CAGGCCCAGGATCCTGGGATGGG + Intronic
1103457829 12:121080106-121080128 CAGGACAGGGGTCCAGGATGGGG - Intergenic
1104519612 12:129461267-129461289 CAGGAGAAGGACCCAGAAAGGGG + Intronic
1104979965 12:132569361-132569383 CTGCCCAAGTTTCCAGGAAGTGG + Intronic
1105439871 13:20405987-20406009 CAGGGCCGGGATCCTGGAAGAGG + Intronic
1106467745 13:30027856-30027878 CAGACCAAGGAGTCAGGAAACGG + Intergenic
1107437095 13:40389754-40389776 CAGGCTAAGGATGCAGGAACTGG - Intergenic
1109817768 13:67609220-67609242 CAGCCAAAGGCTTCAGGAAGAGG - Intergenic
1110614338 13:77524298-77524320 CAGGCAAATGGTACAGGAAGAGG - Intergenic
1113792330 13:113035543-113035565 CAGGCGAAGGAGCCAGGGAGGGG - Intronic
1113794484 13:113049176-113049198 AAGGCCAAGGAGGCAGGAGGCGG + Intronic
1113895488 13:113761400-113761422 CTGGGGAAGGAGCCAGGAAGGGG + Intronic
1113969857 13:114180526-114180548 CAGGCCCAGGAACCAGAGAGCGG - Intergenic
1115364069 14:32536441-32536463 AAGCCCAAGGAACCAGGAGGCGG + Intronic
1118328586 14:64798519-64798541 CAGGTCAAGGATGCAGAAATGGG - Intronic
1121294596 14:92808158-92808180 CAGACCCAGGACCCAGGAGGTGG + Intronic
1122196540 14:100091578-100091600 AGGGCAAAGGATGCAGGAAGAGG - Intronic
1202861958 14_GL000225v1_random:89014-89036 CCGGCCAAGGTACCAGCAAGTGG - Intergenic
1125353599 15:38792965-38792987 CAGGCCAATAATCTAAGAAGTGG - Intergenic
1125384809 15:39125987-39126009 CAGTCCATGGACACAGGAAGGGG - Intergenic
1127747610 15:61996015-61996037 CCGGCCAAGGAACCAGTAAATGG + Intronic
1129884822 15:79030779-79030801 CAGGAAGAGGTTCCAGGAAGAGG - Intronic
1131222229 15:90594598-90594620 CAAGCCTAGAAACCAGGAAGTGG + Intronic
1131497366 15:92924379-92924401 CAGGGAAGTGATCCAGGAAGTGG + Exonic
1132397154 15:101482372-101482394 CAGTCCCAGGAGCCAGGAGGAGG + Intronic
1132437273 15:101818623-101818645 AAGGCCAATGATAGAGGAAGTGG - Exonic
1132489806 16:221362-221384 CAGTCCAAGGATTCAGTAAATGG + Intronic
1132543708 16:523407-523429 CTGGTCCAGCATCCAGGAAGCGG + Intergenic
1132569623 16:638438-638460 CAGGCCAGGGAGGCAGGACGGGG - Intronic
1132811426 16:1799993-1800015 GGGGCCAAGAATCCAGAAAGGGG - Intronic
1133007316 16:2891301-2891323 CAGGTCAAGGACCAAGGATGTGG + Intronic
1133097537 16:3457868-3457890 CAGGCCCAGGATCCCGTATGCGG - Intronic
1133428418 16:5713758-5713780 CAAGCCAATGTTCCAGGGAGGGG - Intergenic
1134190805 16:12119769-12119791 CAGGCCACACAGCCAGGAAGTGG - Intronic
1134297794 16:12962206-12962228 CAGCCCTAGGAGGCAGGAAGGGG + Intronic
1137536969 16:49334624-49334646 AAGGGCACGGAGCCAGGAAGAGG - Intergenic
1137767096 16:50986212-50986234 AAGGGCATGGATGCAGGAAGAGG - Intergenic
1138216165 16:55207210-55207232 CAGGCCAAGGATCCAGCCTAAGG + Intergenic
1138297257 16:55897410-55897432 GTGGCCCAGGCTCCAGGAAGGGG + Intronic
1138382244 16:56610732-56610754 CAGGCCACACAGCCAGGAAGTGG - Intergenic
1138555886 16:57771026-57771048 CTGGCCCTGGATACAGGAAGGGG + Intronic
1138969894 16:62131712-62131734 CAGGCAAAGGAGAGAGGAAGGGG - Intergenic
1139391076 16:66606338-66606360 CAGGCATAGGAGACAGGAAGGGG + Intronic
1139946916 16:70647967-70647989 GAGGCCCATGTTCCAGGAAGAGG + Intronic
1140277489 16:73523545-73523567 TATGCCAAGGATCCAGGGTGAGG - Intergenic
1140566525 16:76049155-76049177 CAGGCCAAGGAGCTATGATGAGG + Intergenic
1141125041 16:81395191-81395213 CAGAGCATGGATCCAGGAGGTGG + Intergenic
1141329467 16:83096012-83096034 CAAGACAAAGGTCCAGGAAGAGG + Intronic
1142142877 16:88480331-88480353 CACGCCAAGGGCTCAGGAAGGGG + Intronic
1143362667 17:6384457-6384479 CAGCCCAAGGATCCAGGGGTTGG + Intergenic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1144787619 17:17840618-17840640 CAGGACAAGCGTCCTGGAAGAGG - Intergenic
1144844314 17:18208216-18208238 CAGGCCACGGATCCTGGAGATGG + Exonic
1145197598 17:20908468-20908490 CAGGCCAGGGAGCCACGAGGCGG + Intergenic
1146660181 17:34660350-34660372 CAGGGCAAGGATCCAGGGAATGG - Intergenic
1147741082 17:42671264-42671286 CAAACCTAGGGTCCAGGAAGAGG + Intronic
1147863978 17:43541066-43541088 CAGGCCCGGAATCCAGGAGGAGG + Intronic
1148894843 17:50833614-50833636 CAGGACAAGTATCCAAGGAGAGG - Intergenic
1150210044 17:63436858-63436880 CAGGCCAGGGATCCAGGAAGCGG - Intronic
1151511965 17:74566254-74566276 CAGGCTTAGGAGCAAGGAAGGGG + Intergenic
1152775387 17:82198273-82198295 CAGGGAAAGCACCCAGGAAGGGG + Intronic
1152927089 17:83092326-83092348 GAGGCCAAGATTCCAGGAAGGGG - Intronic
1153207236 18:2716681-2716703 CATGCCAAAGATCCAGCATGGGG + Intronic
1155550856 18:26963280-26963302 CAGCCCATGGTTCCAGGAAATGG - Intronic
1155743211 18:29316298-29316320 AAAGCCAAGGATCCTTGAAGAGG + Intergenic
1157533027 18:48438349-48438371 GAAGGCAAGGAGCCAGGAAGTGG + Intergenic
1157929981 18:51811253-51811275 GAGGCCAGGGTTCCAGGGAGAGG - Intergenic
1158769130 18:60493428-60493450 AAGGCCACTGAACCAGGAAGTGG - Intergenic
1162510217 19:11113460-11113482 CGGGCCAAGGCTGCAGGCAGGGG - Intronic
1163167440 19:15508020-15508042 TAGGCCCAGGATCCAGAGAGAGG + Intergenic
1163544358 19:17932351-17932373 CAGGTCAGCAATCCAGGAAGAGG + Intergenic
1165042872 19:33081303-33081325 CAGGCCAAGGGCCCAGGATTCGG + Intronic
1165479121 19:36051552-36051574 CAGGAGCAGGATGCAGGAAGAGG + Intronic
1165886987 19:39085276-39085298 CAGGACCAGTAGCCAGGAAGGGG - Exonic
1167566978 19:50262735-50262757 CAGGCAGAGGATCCAGGCAAGGG + Intronic
1168351882 19:55680675-55680697 CAGGGCAGGGGTCCAGGAGGGGG + Intronic
925350052 2:3194713-3194735 AAGGCCATGGAAGCAGGAAGGGG + Intronic
925543800 2:4995915-4995937 CATGGTAAGGTTCCAGGAAGGGG - Intergenic
925650726 2:6086456-6086478 CTGGCCCAGGAGCCAGGCAGAGG + Intergenic
926099243 2:10103486-10103508 CAAGACAATGTTCCAGGAAGTGG - Intergenic
926136579 2:10340821-10340843 CAGGACAGGGATTCAGGAACAGG - Intronic
926427300 2:12750695-12750717 CAGGCCAAGGAGCCAGTGTGGGG + Intergenic
926693109 2:15750999-15751021 CAGACCCAGTATCCAGGACGAGG + Intergenic
927001084 2:18794569-18794591 CAGTCCAAGGAGCCATGTAGTGG + Intergenic
928091365 2:28377101-28377123 GAGGAAAAGGATCCAGAAAGTGG - Intergenic
928364775 2:30692220-30692242 CAGGGGAAAGATCCATGAAGAGG + Intergenic
928648698 2:33382730-33382752 CAGACCAAGAAACTAGGAAGTGG + Intronic
930104952 2:47632289-47632311 AAGCCCAAGGATACAGCAAGAGG - Intergenic
931731177 2:65154824-65154846 CAGAGCAAGACTCCAGGAAGTGG - Intergenic
932443374 2:71753493-71753515 GAGGCCAAGCATAGAGGAAGTGG + Intergenic
932562861 2:72887928-72887950 CTGGCCAATTTTCCAGGAAGTGG - Intronic
934851185 2:97702270-97702292 CATGCCAAGGCTCCTGGAACTGG + Intergenic
938077393 2:128346963-128346985 CAGGGCTCGGATCCGGGAAGAGG + Intergenic
938103638 2:128514777-128514799 CAGGCCGAGGGCCCAGGGAGAGG - Intergenic
938178958 2:129162635-129162657 CAGCCCCAGGATGCAGGAGGAGG + Intergenic
938228623 2:129638831-129638853 CAGGCCCATGATTGAGGAAGAGG - Intergenic
940285845 2:152032284-152032306 CAGGCCACACAGCCAGGAAGGGG + Intronic
941674537 2:168329329-168329351 CAGCCCTGGGATCCAGGAACAGG + Intergenic
944159706 2:196645279-196645301 CAGGGCAAGAATTCATGAAGTGG - Intronic
944220775 2:197302135-197302157 GGAGCCAAGGAGCCAGGAAGAGG + Intronic
946164928 2:217858067-217858089 CAGGCCAAAGATGCAGGGAGGGG + Intronic
946188928 2:217996951-217996973 CAGGGCAGGGAGCCGGGAAGTGG - Intronic
946910567 2:224456948-224456970 CAAGCCAAGGCTCCAAGAAGAGG - Intergenic
947751741 2:232536151-232536173 AAGGCCAAGGCTGCAGGAATTGG + Intronic
947869233 2:233423755-233423777 CAGGCCAAGGATCCAGGAAGGGG - Intronic
948328978 2:237150366-237150388 CAGGCCTAGGAGCCAGGACAGGG - Intergenic
948529527 2:238595489-238595511 CAGGCTCAGGTCCCAGGAAGAGG - Intergenic
1168890674 20:1293782-1293804 CAGGCCAGGGAGGAAGGAAGAGG + Intronic
1168925379 20:1574827-1574849 CAGGTCACAGAGCCAGGAAGTGG + Intronic
1168929257 20:1607855-1607877 CAGGTCACAGAGCCAGGAAGTGG + Intronic
1168955731 20:1832967-1832989 CTGGCCAAGGATAGAGGAATCGG + Intergenic
1169264967 20:4162041-4162063 CCGCCCAAGGCACCAGGAAGGGG - Intronic
1170546023 20:17436555-17436577 CAGTCCAGGGATCAAGAAAGAGG - Intronic
1172014428 20:31864484-31864506 CAGGTCAAGGATCTAGGATAGGG - Intronic
1174057845 20:47810712-47810734 CTGGCCAGGGGTCCTGGAAGTGG + Intergenic
1174135618 20:48376846-48376868 CTGGCCAAGGATTAAGGCAGCGG - Intergenic
1174180345 20:48670432-48670454 CAGGCCAAGGAGCCAGGTGTGGG - Intronic
1174511196 20:51054110-51054132 CAGGGCAGGCATCCTGGAAGAGG - Intergenic
1175364625 20:58444026-58444048 CAAGCCAAGGCACCAGAAAGGGG - Intronic
1175371514 20:58495946-58495968 CAGGCCAAGGATGGGGGATGTGG - Intronic
1175662181 20:60823202-60823224 CAGGCCAGGGAGCCAGGGTGGGG - Intergenic
1175996071 20:62812887-62812909 CAGGACGGGGACCCAGGAAGTGG + Exonic
1179720610 21:43314190-43314212 CAGGCCAGGGTTCCTGGAGGGGG - Intergenic
1181824299 22:25501851-25501873 CAGGCAAAGGACCAAGAAAGAGG - Intergenic
1182153493 22:28047924-28047946 CCAGGAAAGGATCCAGGAAGAGG - Intronic
1183020566 22:35023009-35023031 CAAGGCAAGGTTCCAGGAAACGG + Intergenic
1183345770 22:37306951-37306973 CAGCCCCAGGCTCCAGGAGGGGG - Intronic
1183501590 22:38182864-38182886 CAGACCCATCATCCAGGAAGTGG + Intronic
1183747516 22:39700117-39700139 CAGGCCAAGGCTCCAGGGCCTGG - Intergenic
1184102704 22:42349120-42349142 CAGGCCAAGGAGCCAGGCCCTGG - Intergenic
1184111843 22:42400077-42400099 GAGGCCACGCAGCCAGGAAGTGG + Intronic
1185161125 22:49230398-49230420 CAGGGCAGGATTCCAGGAAGGGG + Intergenic
952413382 3:33068989-33069011 TCTGCCAAGTATCCAGGAAGGGG - Intronic
952512549 3:34071779-34071801 CAGGACAAGGAAACAGGAAAGGG + Intergenic
954325602 3:49861690-49861712 GACGCCAAGGGTCCAGAAAGGGG + Intronic
955403906 3:58613395-58613417 CAGGCCAAGGATCTTGGCACGGG - Intronic
956573744 3:70727532-70727554 CAGGCCAAGAATTAAAGAAGGGG - Intergenic
957492269 3:80943812-80943834 CATGCAAAGGATCCAGGGGGTGG + Intergenic
960724195 3:120653780-120653802 GAGGGCAAGGATCTAGGAAATGG + Intronic
961096484 3:124160801-124160823 AAGACCAAGAATCCAAGAAGGGG - Intronic
961662909 3:128479861-128479883 CAGGACCAGGACCCAGGGAGAGG - Exonic
962196453 3:133367778-133367800 GTGGCCAAGTGTCCAGGAAGAGG - Intronic
967359212 3:188610392-188610414 GTGGCCAAGGACCCAGGAAATGG + Intronic
967913293 3:194559444-194559466 TAAGCCTAGAATCCAGGAAGGGG - Intergenic
968651084 4:1760610-1760632 CAGGCGGAGGATCCGGGCAGGGG - Intergenic
968817805 4:2830790-2830812 CAGGCAAAGGGTCCAGGAACTGG + Intronic
970031795 4:11684529-11684551 CAGGACAAACTTCCAGGAAGTGG + Intergenic
970243106 4:14030014-14030036 GAAACCAAGGACCCAGGAAGAGG + Intergenic
970526619 4:16938979-16939001 TAGGGCAAGATTCCAGGAAGAGG - Intergenic
970774858 4:19661693-19661715 CAGGGCCAGGATTCAGGAAAAGG + Intergenic
970822768 4:20238117-20238139 CAGGCTACAGATCCAGGAAGAGG - Intergenic
973604264 4:52571011-52571033 CAGGCCAAGAAACCAGAAGGCGG - Intergenic
973723636 4:53750683-53750705 CAGCCCGAGGTTCCAGGGAGGGG + Intronic
975315540 4:72948154-72948176 CAGGCTGGAGATCCAGGAAGCGG - Intergenic
975842044 4:78485090-78485112 AAGGCCAAAGACCTAGGAAGTGG - Intronic
976333177 4:83855214-83855236 TAGGCAAAGGAACGAGGAAGTGG - Intergenic
981399445 4:144296180-144296202 CTGGCCCAGGAAGCAGGAAGAGG - Intergenic
982317733 4:154048305-154048327 CAGCCAAAGGATACAGGAGGAGG + Intergenic
985562998 5:601331-601353 CACCCCAGGGATCCAGGAAGGGG + Intergenic
985964114 5:3326604-3326626 TATGCCAAGGATCCGGGAAACGG + Intergenic
986172370 5:5325165-5325187 CAGGCCATGGAGCCAGTAAATGG + Intergenic
986326196 5:6676570-6676592 CAAGACAAGGATCAAGGACGAGG + Intergenic
988609459 5:32711300-32711322 CGGGCTATGGATCCAGGAACCGG + Intronic
989125678 5:38050404-38050426 TAGGCCCAGGAAGCAGGAAGTGG + Intergenic
990148618 5:52790538-52790560 CAGGCCAAGAATGCAGGTGGTGG - Intronic
992157309 5:73968091-73968113 CACGACAAGGATTCATGAAGAGG + Intergenic
992470909 5:77052280-77052302 GAGGTCAAGGCTGCAGGAAGCGG + Intronic
993735425 5:91470773-91470795 TAGGTCAAGGGTCAAGGAAGAGG + Intergenic
994163566 5:96584204-96584226 CATGCCAAGGATCTAGGTTGTGG - Intronic
996329235 5:122311650-122311672 GAGGCCAAGAAGCAAGGAAGGGG + Intronic
996588500 5:125118632-125118654 CAAGCCCAGGCTCCAGGAAATGG + Intergenic
996628404 5:125598654-125598676 AAGGCCAAGGATCCAATATGGGG + Intergenic
997345933 5:133192048-133192070 GATGCCTAGGAACCAGGAAGTGG + Intergenic
997842850 5:137257752-137257774 CAGGAAAAGGATCCTAGAAGAGG - Intronic
998052969 5:139051696-139051718 CAAGCCAAGGAGGCAGGGAGTGG + Intronic
999866099 5:155702086-155702108 CAGGCCAAGGAACCAGTGGGAGG + Intergenic
1001051572 5:168418458-168418480 CAGGCAGAGGATCCAGAAGGTGG - Intronic
1001797632 5:174515344-174515366 CAGGCCCAGCAGCCAGGAGGCGG - Intergenic
1003258033 6:4490845-4490867 CAGGCCAAGGTACAAAGAAGAGG + Intergenic
1004049683 6:12064031-12064053 CCTGGCAAGAATCCAGGAAGAGG - Intronic
1004403247 6:15308127-15308149 CAGGTAAAGGATTAAGGAAGAGG - Intronic
1004916967 6:20341334-20341356 CAGGCCCAGCCTCCAGGAAGAGG + Intergenic
1005402153 6:25445842-25445864 CAGCCCATGGATCCAGGAATAGG - Intronic
1005680031 6:28197422-28197444 CAGCCCAAGGATCAAGAAAGGGG - Intergenic
1007450788 6:41939525-41939547 CAGCCCAAGTTTCCAGCAAGAGG + Intronic
1007813806 6:44505918-44505940 CAGGGCATGGAGCCATGAAGGGG - Intergenic
1007816940 6:44531377-44531399 CACTCCCAGAATCCAGGAAGCGG - Intergenic
1008769059 6:54956702-54956724 CAGGACAAGGAGCTAGTAAGTGG + Intergenic
1009545834 6:65019315-65019337 CAGGACAAGGATTTTGGAAGTGG - Intronic
1009741146 6:67747750-67747772 CAGGTCCAGGATTCAGGCAGTGG + Intergenic
1010036438 6:71330853-71330875 CAGTCCAGGGATGCAGGGAGGGG + Intergenic
1012488343 6:99747600-99747622 GAGGCCAAGGTTGCAGGGAGTGG + Intergenic
1012523733 6:100152104-100152126 CAGGCCAAGGCCCCTGTAAGGGG + Intergenic
1014080463 6:117281030-117281052 CAGGCCAAAGATTCAGTGAGGGG + Intergenic
1016191469 6:141271936-141271958 CAAGCCAGAGATTCAGGAAGTGG - Intergenic
1016953933 6:149608432-149608454 TAGGCAAAGGACCAAGGAAGGGG + Intronic
1017118999 6:151006240-151006262 CAGGACAAGCTTCCAGGAAATGG + Intronic
1019362291 7:611133-611155 AAGGTCAAGAAGCCAGGAAGAGG + Intronic
1020414907 7:7934487-7934509 CAAGCCAAAGAACCAGGAAAGGG - Intronic
1022441625 7:30437772-30437794 CAGGCCACAGATCCAGGGACTGG - Intronic
1023120356 7:36902883-36902905 TAGGGCAAGGGTCCAGGGAGAGG - Intronic
1024253585 7:47523691-47523713 CAGGAGAAGGAACCAGGAACTGG - Intronic
1024604854 7:51014805-51014827 CAGGCCAAGTTCCCAGGAAAAGG - Intergenic
1026655656 7:72254429-72254451 CAGACGATGGATCCAGGCAGGGG - Intronic
1027199464 7:76054082-76054104 CAGGACTAGGCTCCTGGAAGCGG - Intronic
1029342333 7:99955357-99955379 CAGCTCAAGGATACAGGAATTGG + Intergenic
1029470458 7:100751275-100751297 AAAGCCCAGGCTCCAGGAAGGGG + Intronic
1030139086 7:106286384-106286406 CAGGGCAAAGATCATGGAAGTGG + Intergenic
1031927150 7:127649896-127649918 CTAGCCAAGGATCCAGGAGAAGG + Intergenic
1032532936 7:132636897-132636919 CATGCAAAGGATGCAGGAGGTGG + Intronic
1033728502 7:144147472-144147494 CAGACCCAGGTTCCAGGAACTGG + Intergenic
1034394778 7:150813932-150813954 TAGGTCAAGGAGCTAGGAAGTGG - Intergenic
1034558887 7:151867123-151867145 GTGGCCAAGGCCCCAGGAAGGGG - Intronic
1034566842 7:151922144-151922166 GAGGCCAAGAAACCAAGAAGAGG + Intergenic
1035219321 7:157396528-157396550 CAGCCCAAGGCTGCAGGGAGAGG + Intronic
1037620057 8:20555784-20555806 CAGGCCCAGCTTCCAGGAGGAGG - Intergenic
1037909285 8:22734084-22734106 GTGGCAAAGGATCCAGGAAAAGG + Intronic
1038328322 8:26588951-26588973 CAGGGCCAAAATCCAGGAAGAGG - Intronic
1039231995 8:35458626-35458648 CAGCCCAGGGATACTGGAAGTGG + Intronic
1039489969 8:37940126-37940148 GCTGCCAAGGTTCCAGGAAGAGG - Exonic
1041122464 8:54600767-54600789 CTGGCCAAGGGTCCAGGAAAGGG - Intergenic
1042949385 8:74185279-74185301 AAGGAAAGGGATCCAGGAAGAGG - Intergenic
1042978018 8:74492473-74492495 CAGAGCAAGGAACCAGGCAGCGG - Intergenic
1045690971 8:104759443-104759465 CTGGCTAAGGACCGAGGAAGAGG + Intronic
1047940315 8:129822853-129822875 AGGGCCCAGGATCCAGGCAGAGG - Intergenic
1048042647 8:130746184-130746206 AAGGCCATGTAGCCAGGAAGAGG - Intergenic
1049167267 8:141134088-141134110 CAGTTCCAGGATCCAGGAGGAGG + Intronic
1049429335 8:142551912-142551934 CAGGCCATGGGTCCAGGCTGAGG + Intergenic
1050702977 9:8362030-8362052 CAGGCAAAGAATTCAGCAAGAGG + Intronic
1053298627 9:36933326-36933348 CAGGGCAGGGCACCAGGAAGAGG - Intronic
1053877914 9:42562284-42562306 CTGGCCATGTAACCAGGAAGAGG + Intergenic
1054233781 9:62539410-62539432 CTGGCCATGTAACCAGGAAGAGG - Intergenic
1054842239 9:69755570-69755592 CAGTCCAAGGATTCAGGAAATGG + Intronic
1055744385 9:79426907-79426929 CAGGCCCAGGCTCCAAGAAGTGG + Intergenic
1056168008 9:83957021-83957043 GAGGCCAAGGAGCCCGGATGCGG - Intergenic
1056843574 9:90018435-90018457 CAGGTCTAGGATCCAAGAAGTGG + Intergenic
1057147477 9:92767924-92767946 CAGCCCAAGGCTGCAGGAATAGG + Intergenic
1059773094 9:117446445-117446467 CAGGGAAAGGAAACAGGAAGGGG - Intergenic
1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG + Intronic
1061438947 9:130586274-130586296 CTGGCCCAGCATCCAGCAAGGGG - Intronic
1061976345 9:134069783-134069805 CAGGGCAAGGCTCTAGGACGAGG + Intergenic
1062480599 9:136749128-136749150 CAGGCCAGGGTCCCAGGGAGGGG - Intergenic
1062511269 9:136907491-136907513 CAGGCCAAGGTGCCAGGAGCTGG - Intronic
1062629880 9:137458869-137458891 CAGGGCAGGGGACCAGGAAGAGG + Intronic
1062696965 9:137880496-137880518 CAGGCCCAGGAGCCAGGCCGGGG + Intronic
1186573944 X:10745365-10745387 CATGCCCAGGATGCAGGAAAGGG + Intronic
1187946140 X:24427915-24427937 CAGGCACAGCCTCCAGGAAGGGG + Intergenic
1188824802 X:34818548-34818570 CAGGCCAAGGTTCTAAGTAGGGG - Intergenic
1190511676 X:51179364-51179386 AAGGCCAAGGATCCTGGAGATGG + Intergenic
1192239874 X:69320423-69320445 GAGGCCAAATAGCCAGGAAGGGG - Intergenic
1195744778 X:108105753-108105775 CTGCTCAAGGAACCAGGAAGAGG - Intronic
1196903146 X:120406382-120406404 CAGGCCATGGCACAAGGAAGAGG - Intergenic
1197405356 X:126041644-126041666 CAGGTCCAGGATTCAAGAAGTGG + Intergenic
1197753294 X:129980089-129980111 CAGCCCCTGGCTCCAGGAAGGGG - Intergenic
1197819276 X:130529365-130529387 ACTGCCCAGGATCCAGGAAGTGG - Intergenic
1198024343 X:132690524-132690546 CAGGCTAAGGAGAAAGGAAGAGG - Intronic