ID: 947869996

View in Genome Browser
Species Human (GRCh38)
Location 2:233429749-233429771
Sequence CGGCAAAGGCAGGCCCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947869996 Original CRISPR CGGCAAAGGCAGGCCCGGAG GGG (reversed) Intronic
900592973 1:3468026-3468048 CGGCCAGGGCAGGCCCAGCGTGG + Intronic
900634010 1:3652901-3652923 CGCCAAAGACAGCCCCGCAGGGG + Intronic
900747144 1:4368172-4368194 TGGTAAAGGCAGGCTCAGAGAGG + Intergenic
901144159 1:7053944-7053966 GGGCAAGGGCAGGCCAGGATGGG - Intronic
901791237 1:11654667-11654689 CGGCTAGGGGAGGCACGGAGAGG + Exonic
903736907 1:25535602-25535624 CGGCATAGCCACACCCGGAGGGG + Intergenic
903878212 1:26490800-26490822 GCACAAAGGCAGGCCCGGGGTGG - Intergenic
905361450 1:37423549-37423571 CTGCAAGGGCTGGCCCTGAGAGG + Intergenic
905690662 1:39940504-39940526 GGGCAAAAGGAGGCCCGAAGAGG + Intergenic
906290769 1:44617948-44617970 AGGCAAAGGCAGGGTAGGAGAGG - Intronic
906545094 1:46614867-46614889 CCACAAAGGCAGGCCAGGATGGG + Intronic
907126613 1:52056222-52056244 CGGGATAGGCTGCCCCGGAGAGG + Exonic
911176482 1:94822726-94822748 AGGAAAAGGCAGGGCAGGAGAGG - Intronic
911294215 1:96094145-96094167 GGCCAAAGGCAGGCCAGAAGAGG + Intergenic
912077174 1:105889429-105889451 GGGCAAAGGATGGCCGGGAGCGG - Intergenic
912933727 1:113985240-113985262 CTGCAAAGGCAGACACAGAGAGG - Intergenic
915380831 1:155438630-155438652 CTTCAAAGGCAGGCCAGGACAGG - Exonic
917487151 1:175465767-175465789 CCGCAAAGGCAAGCCCAGTGTGG + Intronic
917922316 1:179760698-179760720 TGGCAAAGGCAGGAGCAGAGGGG + Intronic
919670816 1:200336088-200336110 AAGCAAAGGCAGGCCGGAAGCGG - Intergenic
919816294 1:201442709-201442731 AGGCAAATGCAGGCCTGGTGTGG + Intergenic
921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG + Intergenic
921706129 1:218324114-218324136 CAGCACAGTCAGGCACGGAGGGG - Intronic
922725879 1:227922767-227922789 CTGCAAAGACAGGCCTGGTGGGG + Intronic
923659271 1:235944551-235944573 GAGCAAAAGGAGGCCCGGAGAGG + Intergenic
924289767 1:242524853-242524875 CGGGAAAGGCGGGTGCGGAGCGG - Intergenic
1063010067 10:2012735-2012757 CAGCAAAGGCAGCCCAGGACAGG - Intergenic
1063921692 10:10939662-10939684 CGGAAAAGCCAGGCCGGGCGCGG + Intergenic
1063949864 10:11212337-11212359 CTGTGAAGGCAGGCCCGGGGGGG - Intronic
1067438786 10:46296696-46296718 AGGAAAAGGCAGGGCTGGAGAGG + Intronic
1069836437 10:71311359-71311381 AGGTAAAGTCAGGCCAGGAGAGG - Intergenic
1070596914 10:77838816-77838838 CGGCAAGAGCAGACCAGGAGGGG - Intronic
1073196401 10:101695054-101695076 CGGGAACGGCGGGCCCGGCGAGG - Exonic
1075522352 10:123150524-123150546 CGGCCAAGCCAGGCCCTCAGAGG + Exonic
1076150943 10:128161578-128161600 CAGGAAATGGAGGCCCGGAGAGG - Intergenic
1077073193 11:687150-687172 CTGCAAAGGCAGACCCGTGGTGG - Intronic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077896423 11:6456859-6456881 CGGCACAGGCCTTCCCGGAGCGG - Exonic
1081391142 11:42530232-42530254 CTGAAAAGGCAGGCCCAAAGAGG + Intergenic
1081620942 11:44618894-44618916 CAGCAGAGGGAGGCCCAGAGCGG - Intronic
1081850682 11:46273201-46273223 GGGCAGAGGCAGGACTGGAGGGG - Intergenic
1082062236 11:47870960-47870982 CGGCAAAGCCAGGCCGGGCTCGG - Intergenic
1085113925 11:73913165-73913187 AGGCAAAGTCAGGCCAGGTGCGG - Intronic
1088505221 11:110520948-110520970 AGGGAAAGGAAGGCCCAGAGAGG + Intergenic
1088713322 11:112527442-112527464 AGGCAGAGGCAGTCCTGGAGAGG + Intergenic
1091434327 12:460878-460900 CGGGAACCGCAAGCCCGGAGCGG - Intronic
1091817101 12:3446813-3446835 GGGCAAAGGGAGGCCCCGCGTGG - Intronic
1096181330 12:49552250-49552272 CAGCAAAGGCATGCTCTGAGAGG - Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096583060 12:52600903-52600925 TGGAAAAGGGAGGCTCGGAGAGG + Intronic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1098534996 12:71584136-71584158 AGGCAAAGGCAGGCAGAGAGGGG - Exonic
1101427351 12:104598996-104599018 CAGCTAAGGGAGGCGCGGAGGGG + Intronic
1101724677 12:107379085-107379107 GGGCAAAGGGAGGCTCAGAGAGG - Intronic
1104874751 12:132026224-132026246 GGGCCAAGGCAGGCACAGAGCGG - Intronic
1105043910 12:132986197-132986219 CGGGAAAGGAAGGCTGGGAGGGG - Intergenic
1105294001 13:19072620-19072642 AGGCAAGGGCAGCCCCAGAGGGG + Intergenic
1105944500 13:25177803-25177825 GGGCAGAGGCAGACCTGGAGCGG - Intergenic
1112503748 13:99961069-99961091 AGGCACAGGCAGGCCGGCAGGGG - Intergenic
1112555225 13:100461708-100461730 CTGCAAAGGCAGGCAGGGACAGG - Intronic
1114458369 14:22871909-22871931 CGGCAAAGTTTGGCCCGAAGAGG + Exonic
1114663778 14:24367153-24367175 CGGGAAAGTCAGGCTTGGAGAGG - Exonic
1116941008 14:50790608-50790630 CTGCAAATAGAGGCCCGGAGAGG - Intronic
1118819610 14:69336448-69336470 CGGCAAGGGCAGGTCCCTAGAGG - Intronic
1121217401 14:92259267-92259289 CTGCATAGGGAGGCCCAGAGAGG + Intergenic
1121774972 14:96584445-96584467 CGGCTGAGGGAGCCCCGGAGCGG + Intergenic
1122155364 14:99747342-99747364 GGAGAAAGGCAGGCCCGGGGTGG + Intronic
1122923931 14:104891298-104891320 CTGCAAAGGCAGTCCCTGAAAGG + Intronic
1123006194 14:105324988-105325010 CGGAACAGCCAGGCCCAGAGCGG - Intronic
1123495133 15:20816598-20816620 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1123551625 15:21385691-21385713 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1124036566 15:26058371-26058393 CGGAACAGGCAGGCCTGAAGAGG - Intergenic
1126824042 15:52531235-52531257 CAGCAAAGGGAAGCCCCGAGGGG + Intergenic
1128986907 15:72228948-72228970 AGACAAAGGCAGGCAAGGAGGGG - Intronic
1129698871 15:77756064-77756086 AGGCTAAGGCAGGGCTGGAGAGG + Intronic
1129852791 15:78804056-78804078 CAGCAAAGGGAGGCTCAGAGAGG + Intronic
1130141245 15:81228101-81228123 CTGCAAAGACAGGCGAGGAGAGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1202959967 15_KI270727v1_random:112933-112955 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1132516812 16:369880-369902 CGGCACAGCCAAGCCCTGAGAGG + Intronic
1132547839 16:541355-541377 CGGCAGAGGCAGGGCCGGGGAGG + Intronic
1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG + Intronic
1132660974 16:1061452-1061474 CAGCAGAGCCAGGCCCTGAGGGG - Intergenic
1133272315 16:4616250-4616272 CGGCAGAGCCAGTTCCGGAGCGG + Intergenic
1135846613 16:25924659-25924681 ATGCAAAGGCAAGCCAGGAGAGG - Intronic
1136019749 16:27432492-27432514 AGGCAACGGCAGCCCCTGAGTGG - Intronic
1137248745 16:46727815-46727837 CCCCAATGGCAGGCCCGGCGGGG - Intronic
1139922875 16:70470818-70470840 GGGCCAAGGCAGGTCCAGAGAGG + Intronic
1140888046 16:79261686-79261708 CGGCAAAGGCTGGCCAGAAGAGG - Intergenic
1141266876 16:82505767-82505789 AGGCAAAGGCAGGCTCTGAGCGG + Intergenic
1141772730 16:86101004-86101026 AGCCACAGGCAGGCCCGGGGAGG + Intergenic
1142432297 16:90036165-90036187 TGGCAAAGGCAGGCCGACAGTGG + Intronic
1142505077 17:358040-358062 AGGCAGAGGCAGACCTGGAGGGG - Intronic
1143105892 17:4530448-4530470 GGGCAAACTGAGGCCCGGAGTGG + Intronic
1145265909 17:21379520-21379542 CTCCAAGGGCAGGCCCGGGGAGG - Intronic
1146275048 17:31511257-31511279 CGGCAAAAGGAGGCGCGGGGTGG - Intronic
1146661763 17:34669637-34669659 AGCCAAAGGCAGGCATGGAGGGG + Intergenic
1146947261 17:36882396-36882418 GGGGAAAGGCAGGCCTGAAGAGG - Intergenic
1147970901 17:44218869-44218891 CGGCGAAGGGAGCCCGGGAGGGG - Intronic
1148565244 17:48628735-48628757 CTGCAAAGTCAGGGCAGGAGAGG - Intronic
1148851535 17:50557881-50557903 GGGTAAAGGCAGGGCTGGAGGGG + Intergenic
1149963282 17:61136058-61136080 CGGGGAAGGCAGGCGCGAAGGGG - Intronic
1151733241 17:75923215-75923237 CGCCAAATGCAGGCCCTCAGAGG + Exonic
1152644587 17:81462970-81462992 CGGCAAGGTGAGGCCCGGACAGG + Exonic
1152702556 17:81826197-81826219 AGGCAAAGGGAGCCCCGGAAGGG - Exonic
1152796623 17:82310766-82310788 TGGCAAAGGAAGGCCCAGAAGGG + Intergenic
1152880357 17:82811222-82811244 AGGCACAGGCAGGCCCGGCCTGG - Intronic
1152930931 17:83109549-83109571 AGGCCAGGCCAGGCCCGGAGAGG - Intergenic
1154452532 18:14489072-14489094 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1155325216 18:24657898-24657920 CGTCAAAGGCAGGGGCTGAGTGG - Intergenic
1160500527 18:79399522-79399544 CGGGAGAGGCAGGCCCAGGGCGG + Intronic
1160947199 19:1649135-1649157 CGGAGCAGGCAGGCCCGGTGGGG - Intronic
1160967877 19:1754466-1754488 CGGCACAGGCAGCGGCGGAGCGG + Exonic
1160968433 19:1756838-1756860 CGTCAGAGGGAGGCCCGGCGGGG - Intronic
1161040433 19:2108303-2108325 CAGGAGAGGGAGGCCCGGAGCGG + Intronic
1161041058 19:2110998-2111020 AGGCACAGGAAGGCACGGAGAGG + Intronic
1161280188 19:3441688-3441710 GGGCACAGGAAGGGCCGGAGGGG + Intronic
1162043100 19:7982142-7982164 GGGCAAGGGCAGGACCAGAGGGG + Intronic
1162043321 19:7983469-7983491 TGGCAAGGGCAGGACCAGAGGGG + Intronic
1162567109 19:11450692-11450714 AGCCACAGGCAGGCCCAGAGGGG - Exonic
1162851702 19:13436113-13436135 AGGCAAAGGCAGGCCAGGCACGG - Intronic
1163785316 19:19272132-19272154 GGGCAAATCCAGGCCCAGAGAGG + Intronic
1165110204 19:33497901-33497923 GGGGAAAGGGAGGCCTGGAGGGG + Intronic
1166103152 19:40583249-40583271 GGACAAAGGCAGGCCTGGGGTGG + Intronic
1166546536 19:43637421-43637443 CGGGAAAGTAAGGCCCAGAGAGG + Intronic
1166785465 19:45364352-45364374 CGGCTCAGGCAGGCCTGCAGGGG + Intronic
1167037183 19:47001451-47001473 CGGCAGAGGCGGGCACAGAGTGG - Exonic
1167439629 19:49500760-49500782 CGGCACCGGCAGGCCCCAAGGGG - Intergenic
1168259427 19:55185282-55185304 ATGAAAAGGCAGGCCAGGAGCGG - Intronic
925346721 2:3176845-3176867 CTGCACAGGAAGGCCCAGAGGGG + Intergenic
926726089 2:15999104-15999126 CTGCAAAAACAGGCTCGGAGGGG - Intergenic
927926879 2:27019718-27019740 AGGCAAAGGGAGGCCAGGCGGGG - Intronic
928195070 2:29209744-29209766 TGGAAGAGACAGGCCCGGAGGGG + Intronic
928239989 2:29577934-29577956 CGGCACTGGCAGGCCCAGGGTGG + Intronic
929570848 2:43022049-43022071 TGGCCAAGGGAGGCCCAGAGGGG - Intergenic
929603805 2:43221387-43221409 CGGCTAAGGCAGGGCCCGGGAGG + Intergenic
932246099 2:70197897-70197919 AGGCAGAGGCAGGCCGGGTGCGG - Intronic
932278271 2:70467964-70467986 CTGCAGAGGCAGGCTAGGAGAGG - Intronic
932700443 2:73987721-73987743 AGGAAAAGACAGGCCCAGAGAGG - Intronic
934054218 2:88238591-88238613 AGGCAAGGGAAGGCCCAGAGAGG + Intergenic
936090495 2:109498834-109498856 GGGAAAGGGCAGGCCCGGCGTGG + Intronic
938023760 2:127927096-127927118 AGCCAGAGGCAGGCCCGGAGCGG + Intergenic
941563463 2:167078544-167078566 CGGCAAAAACTGGCCGGGAGTGG + Intronic
947501971 2:230677422-230677444 GGGCAAATGCAGGCAGGGAGAGG + Intergenic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948365200 2:237450235-237450257 AGGGAAAGGCAGGCCCAGGGAGG + Intergenic
949049697 2:241890897-241890919 CGGCACCGACAGGCCCGGGGGGG + Intergenic
949049719 2:241890963-241890985 CGGCACCGACAGGCCCGGCGGGG + Intergenic
1171492689 20:25532401-25532423 CTGCAAAGACAGGGCCAGAGGGG - Intronic
1171880996 20:30617247-30617269 CGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1172022760 20:31925879-31925901 CGGTAGAGCCAGGCCCGCAGCGG - Intronic
1172104450 20:32508254-32508276 CAGCAAAGGCAGGCCAGGGTGGG - Intronic
1172118326 20:32584207-32584229 CGGGACAGGCAGCCCCGGGGCGG + Intronic
1172444954 20:34988027-34988049 GGGGAAAGGGAGGCCCGGGGAGG - Intronic
1172884444 20:38221948-38221970 CGGGAAAGGCAGGGCCGGGTAGG + Intronic
1174185047 20:48700657-48700679 CAGGAAAGGGAGGCCCAGAGAGG + Intronic
1174419586 20:50390975-50390997 GAGCAAAGGGAGGCCCAGAGAGG + Intergenic
1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG + Intergenic
1175774531 20:61644657-61644679 GGGCAAAGCCAGGGCCAGAGGGG + Intronic
1176160949 20:63648349-63648371 TGGCAGAGTCAGGCCTGGAGGGG - Intronic
1176295381 21:5069459-5069481 ATGCAAAGGCAGGCAGGGAGGGG - Intergenic
1176551405 21:8224040-8224062 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1176570314 21:8407039-8407061 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1176578223 21:8451226-8451248 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1176821663 21:13664259-13664281 CCCAAAATGCAGGCCCGGAGTGG + Intergenic
1179580265 21:42338922-42338944 TGGCAAGGGCAGGCCCCCAGGGG + Intergenic
1179635056 21:42703458-42703480 AGGCAAAGGCTGGCCGGGTGTGG + Intronic
1179861668 21:44192665-44192687 ATGCAAAGGCAGGCAGGGAGGGG + Intergenic
1179951673 21:44711988-44712010 CGACCATGGCAGGCCGGGAGCGG + Intergenic
1180179745 21:46112637-46112659 GGGTAAAGTGAGGCCCGGAGTGG - Intronic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1181466652 22:23113996-23114018 CCACAAAGGGAGGCCCAGAGGGG + Intronic
1183281833 22:36936375-36936397 CAGCAAAGTGAGGCCCAGAGAGG - Intronic
1183464801 22:37974122-37974144 CGGGCAAGGCAGACCCGAAGCGG - Exonic
1183583223 22:38737878-38737900 CAGGAAAGGAAGGCCGGGAGAGG - Intronic
1184074694 22:42168799-42168821 GGGCAAAGGGAGGACAGGAGTGG + Intronic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
1184711185 22:46250336-46250358 CCGCAGACGCAGGCGCGGAGCGG + Exonic
950316406 3:12004970-12004992 CGGCAGCCGCAGGCCAGGAGAGG + Intronic
953881517 3:46693661-46693683 CCGCACAGGCAGTCCCGGCGCGG - Exonic
954457509 3:50607823-50607845 AGGCATAGGCAGGGCCGGGGTGG + Exonic
954684395 3:52362500-52362522 AGGCAAGTGCAGGCCCAGAGTGG + Exonic
961481358 3:127183051-127183073 CGCCTAAGGCAGCCCTGGAGAGG + Intergenic
963939681 3:151086281-151086303 AGGCAGAGGCAGGTCTGGAGGGG - Intronic
965603794 3:170480364-170480386 TGGCAAAGGCAGGCACAAAGGGG + Exonic
966891313 3:184409485-184409507 CTGGACAGGCAGGCCCGGGGCGG + Intronic
967834045 3:193945883-193945905 TGGGAAACGGAGGCCCGGAGAGG + Intergenic
968001722 3:195211101-195211123 GGGCAAAGGCAGGCCGGGCATGG + Intronic
968281605 3:197481340-197481362 TGGCAAAGGAAGGTGCGGAGTGG + Intergenic
968759773 4:2436778-2436800 GGGCAAAGGCAGGGGTGGAGCGG - Intronic
969410632 4:7025713-7025735 CAACAAAGGGAGGCCCAGAGAGG + Intronic
972266541 4:37465466-37465488 CGGCAAAGGGAGCCCCAGAGAGG + Intronic
972296709 4:37746018-37746040 CAGCAAATGCAGGCCCAGATGGG - Intergenic
972532205 4:39971444-39971466 CCTTAAAGGCAGGCCCGGTGCGG - Intronic
976129828 4:81871910-81871932 AGGCAAAGGCAGGCTGGGTGTGG + Intronic
978195888 4:105971350-105971372 TGGTAAAGGCAGGGCTGGAGGGG + Intronic
985513019 5:322479-322501 TGGCAAGGGCAGGCGGGGAGGGG + Intronic
985775270 5:1837937-1837959 AGGAAAAGCCAGGCCAGGAGTGG - Intergenic
986343292 5:6811174-6811196 CAGCAAAGGCAGGGCCAGACCGG + Intergenic
988796524 5:34657075-34657097 GGGCAGGGGCAGGCCCAGAGGGG - Intronic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
999723962 5:154419514-154419536 TGGGAAAGGCAGGCCCGGGACGG - Exonic
1001403842 5:171462131-171462153 CAGCAAAGGCAGGGATGGAGAGG - Intergenic
1002789496 6:426946-426968 CTGCCAAGGCAGGCCTGGGGTGG + Intergenic
1003095969 6:3143917-3143939 AGGCAAAGGCAGGAGCTGAGGGG - Intronic
1003498707 6:6686952-6686974 CGGTAATGGGAGGCCTGGAGGGG - Intergenic
1005510635 6:26508956-26508978 AGGCAAAAGAAGGGCCGGAGGGG - Exonic
1010941015 6:81917633-81917655 TGGCACAGGCAGTCCCTGAGGGG + Intergenic
1014376464 6:120680979-120681001 CTACAAAGTCAGGCCCGGCGGGG - Intergenic
1015792087 6:136973918-136973940 CTGCTAAGGCCGGCCCGGCGCGG - Intergenic
1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG + Intronic
1017807918 6:157962387-157962409 AGACAAAGTCAGGCCCGGTGCGG + Intergenic
1018995842 6:168709916-168709938 CAGGAAAGGCAGGCAGGGAGGGG + Intergenic
1019341271 7:510231-510253 CGGGAAAGGCAGGGCCGGCCGGG - Intronic
1019399548 7:844397-844419 GGGCAATGCCAGGCTCGGAGTGG - Intronic
1019595113 7:1854805-1854827 AGACAAAGGCAGGACAGGAGGGG + Intronic
1019686013 7:2382661-2382683 CGCCAAAGCCAGGCCGGGCGTGG - Intergenic
1020252938 7:6483939-6483961 CGGCGGGGGAAGGCCCGGAGAGG - Intronic
1024257308 7:47548593-47548615 AGGCAAAGGCAGGACCAGTGAGG - Intronic
1025251361 7:57353506-57353528 GAGCAAAGGGAGGCCCAGAGAGG - Intergenic
1026000652 7:66557470-66557492 CAGCCCAGGCAGTCCCGGAGTGG + Intergenic
1031836909 7:126690270-126690292 AGGGCAAGGCAGGCACGGAGTGG + Intronic
1033351400 7:140565214-140565236 TGGCAAAGGGAGTCCCTGAGTGG + Intronic
1037245625 8:16831323-16831345 CGACAAAGGCAGGATCTGAGAGG - Intergenic
1037911010 8:22743570-22743592 AGGAAAAGGCAGCTCCGGAGGGG - Intronic
1038352108 8:26786161-26786183 AGTGAAAGGCAGGCCAGGAGCGG - Intronic
1038760869 8:30383991-30384013 CTGAAAAAGCCGGCCCGGAGTGG + Intergenic
1041098544 8:54373498-54373520 CTGGAAAGGCAGGCCTGGGGAGG + Intergenic
1041673601 8:60516815-60516837 CGGGCAAGGCAGGCGCGGGGCGG + Intergenic
1042937094 8:74070379-74070401 TGGCAAAGGGAGGCCGGGCGCGG - Intergenic
1049330096 8:142045852-142045874 GGGCAGAGGGAGGCCCGAAGTGG + Intergenic
1053420113 9:37972089-37972111 AGGCAAGGGCAGCCCCTGAGAGG + Intronic
1055985760 9:82055832-82055854 AGGCAAAGGAAGGGCCAGAGTGG + Intergenic
1056611301 9:88127657-88127679 AGGCAAAGGAAGGGCCAGAGTGG + Intergenic
1057265874 9:93617386-93617408 AGGCAAGGGCAGCCCCAGAGGGG - Intronic
1059695190 9:116723908-116723930 CGGCAAAGCCAGGTCTTGAGGGG + Intronic
1059695924 9:116730503-116730525 CTGCAAAGGAAGGCCAGGAGAGG - Intronic
1060180738 9:121531895-121531917 AGGTAAAGGCAGGCCGGGCGCGG + Intergenic
1060667270 9:125439380-125439402 AGGGAAAGGCAGGCTCAGAGAGG - Intronic
1061089916 9:128420774-128420796 GGGCCGAGGCAGACCCGGAGAGG - Exonic
1061961370 9:133990910-133990932 TGACAAAGGCAAGCCCAGAGGGG - Intronic
1062209080 9:135353514-135353536 CAGCAGAGGCTGGCCTGGAGTGG + Intergenic
1203525706 Un_GL000213v1:85315-85337 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1203472584 Un_GL000220v1:122684-122706 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1186071220 X:5822735-5822757 AGCCAAAGGCAGGCCGGGCGTGG - Intergenic
1187775966 X:22757612-22757634 AGGCAAAGGAAGGACAGGAGTGG + Intergenic
1189185191 X:39048839-39048861 AGCCAGAGGAAGGCCCGGAGAGG + Intergenic
1190213823 X:48467434-48467456 GGAGAAAGGCAGGCCGGGAGGGG + Intronic
1190815392 X:53924739-53924761 AGGGAAAGGCAGGCCGGGTGCGG - Intergenic
1191678462 X:63816262-63816284 CGGCAAGGGCAGGCCCAGACTGG - Intergenic
1192213948 X:69144942-69144964 CTGGAAAGGGAGGCCCAGAGAGG - Intergenic
1195894675 X:109733322-109733344 CGGAAAAGACGCGCCCGGAGGGG + Exonic
1197732557 X:129823699-129823721 CTGCAATGGGAGGCCCGGGGAGG + Exonic
1200036358 X:153334213-153334235 CGGCCCAGGCAGGCCTGGCGTGG - Exonic