ID: 947872095

View in Genome Browser
Species Human (GRCh38)
Location 2:233444881-233444903
Sequence CAGAGTGACCAGGGCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 352}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947872095_947872103 15 Left 947872095 2:233444881-233444903 CCTTCATGGCCCTGGTCACTCTG 0: 1
1: 0
2: 4
3: 28
4: 352
Right 947872103 2:233444919-233444941 GCTGGTGAGCTCTGGGCAGTGGG 0: 1
1: 0
2: 1
3: 50
4: 321
947872095_947872100 7 Left 947872095 2:233444881-233444903 CCTTCATGGCCCTGGTCACTCTG 0: 1
1: 0
2: 4
3: 28
4: 352
Right 947872100 2:233444911-233444933 AGTCAAAGGCTGGTGAGCTCTGG 0: 1
1: 0
2: 3
3: 23
4: 195
947872095_947872098 -7 Left 947872095 2:233444881-233444903 CCTTCATGGCCCTGGTCACTCTG 0: 1
1: 0
2: 4
3: 28
4: 352
Right 947872098 2:233444897-233444919 CACTCTGTTGTCAGAGTCAAAGG 0: 1
1: 0
2: 2
3: 19
4: 197
947872095_947872102 14 Left 947872095 2:233444881-233444903 CCTTCATGGCCCTGGTCACTCTG 0: 1
1: 0
2: 4
3: 28
4: 352
Right 947872102 2:233444918-233444940 GGCTGGTGAGCTCTGGGCAGTGG 0: 1
1: 0
2: 5
3: 79
4: 513
947872095_947872101 8 Left 947872095 2:233444881-233444903 CCTTCATGGCCCTGGTCACTCTG 0: 1
1: 0
2: 4
3: 28
4: 352
Right 947872101 2:233444912-233444934 GTCAAAGGCTGGTGAGCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 185
947872095_947872104 27 Left 947872095 2:233444881-233444903 CCTTCATGGCCCTGGTCACTCTG 0: 1
1: 0
2: 4
3: 28
4: 352
Right 947872104 2:233444931-233444953 TGGGCAGTGGGCATTTTAAGAGG 0: 1
1: 0
2: 2
3: 16
4: 205
947872095_947872099 -3 Left 947872095 2:233444881-233444903 CCTTCATGGCCCTGGTCACTCTG 0: 1
1: 0
2: 4
3: 28
4: 352
Right 947872099 2:233444901-233444923 CTGTTGTCAGAGTCAAAGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947872095 Original CRISPR CAGAGTGACCAGGGCCATGA AGG (reversed) Intronic
900200171 1:1401119-1401141 CACAGTGACAAGGGCCAGGAGGG + Intronic
900565675 1:3330844-3330866 CAGAGGGAGGAGGGCCCTGAGGG - Intronic
900924109 1:5692320-5692342 CCGAGTGCCCAGGGCCAGGCAGG + Intergenic
901024685 1:6272911-6272933 CAGAGTGAGCACTGCCAGGAGGG - Intronic
902459897 1:16566399-16566421 CAAAGTTACCTGGGGCATGATGG + Exonic
903541445 1:24098630-24098652 CTGAGTGACCAGGGGCAAAAAGG - Intronic
903662235 1:24985180-24985202 CAGAGTCTGCAGAGCCATGAGGG - Intergenic
904921414 1:34011084-34011106 CACAGTGACCAAGGCTGTGAAGG - Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905853434 1:41291007-41291029 CTGAGTGACAAGGTCCAGGAAGG - Intergenic
906531999 1:46529122-46529144 CAGAGTGGCGAGGGGCAAGAGGG - Intergenic
909522643 1:76587498-76587520 CACACTGCCCAGGGCCAGGACGG - Intronic
912273515 1:108233151-108233173 CAGAGTTACCTGGGGCATGGTGG + Exonic
912294705 1:108461171-108461193 CAGAGTTACCTGGGGCATGGTGG - Exonic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
912508225 1:110171193-110171215 CCCAGTCACCAGGGCCCTGATGG - Intronic
913605510 1:120462184-120462206 CAAAGTTACCTGGGGCATGATGG - Intergenic
913642376 1:120824904-120824926 CAAAGTTACCTGGGGCATGATGG - Exonic
913642555 1:120826444-120826466 CAAAGTTACCTGGGGCATGATGG - Intronic
913642735 1:120827984-120828006 CAAAGTTACCTGGGGCATGATGG - Intronic
913642851 1:120829031-120829053 CAAAGTTACCTGGGGCATGATGG - Intronic
913642927 1:120829802-120829824 CAAAGTTACCTGGGGCATGATGG - Intronic
913643695 1:120836555-120836577 CAAAGTTACCTGGGGCATGATGG - Intronic
913989498 1:143597581-143597603 CAAAGTTACCTGGGGCATGATGG + Intergenic
914083032 1:144427038-144427060 CAAAGTTACCTGGGGCATGATGG + Exonic
914177954 1:145295558-145295580 CAAAGTTACCTGGGGCATGATGG + Exonic
914178499 1:145300320-145300342 CAAAGTTACCTGGGGCATGATGG + Exonic
914179797 1:145311428-145311450 CAAAGTTACCTGGGGCATGATGG + Exonic
914180341 1:145316198-145316220 CAAAGTTACCTGGGGCATGATGG + Exonic
914180885 1:145320960-145320982 CAAAGTTACCTGGGGCATGATGG + Exonic
914181428 1:145325710-145325732 CAAAGTTACCTGGGGCATGATGG + Exonic
914181973 1:145330477-145330499 CAAAGTTACCTGGGGCATGATGG + Exonic
914182517 1:145335233-145335255 CAAAGTTACCTGGGGCATGATGG + Exonic
914183063 1:145339987-145340009 CAAAGTTACCTGGGGCATGATGG + Exonic
914183608 1:145344741-145344763 CAAAGTTACCTGGGGCATGATGG + Exonic
914184151 1:145349511-145349533 CAAAGTTACCTGGGGCATGATGG + Exonic
914184695 1:145354275-145354297 CAAAGTTACCTGGGGCATGATGG + Exonic
914185240 1:145359022-145359044 CAAAGTTACCTGGGGCATGATGG + Exonic
914185785 1:145363776-145363798 CAAAGTTACCTGGGGCATGATGG + Exonic
914186331 1:145368536-145368558 CAAAGTTACCTGGGGCATGATGG + Exonic
914186876 1:145373284-145373306 CAAAGTTACCTGGGGCATGATGG + Exonic
914187420 1:145378034-145378056 CAAAGTTACCTGGGGCATGATGG + Exonic
914187964 1:145382790-145382812 CAAAGTTACCTGGGGCATGATGG + Exonic
914188507 1:145387538-145387560 CAAAGTTACCTGGGGCATGATGG + Exonic
914189050 1:145392294-145392316 CAAAGTTACCTGGGGCATGATGG + Exonic
914210904 1:145578003-145578025 CAAAGTTACCTGGGGCATGATGG + Intergenic
914269664 1:146068763-146068785 CAAAGTTACCTGGGGCATGATGG + Exonic
914270203 1:146073491-146073513 CAAAGTTACCTGGGGCATGATGG + Exonic
914270741 1:146078227-146078249 CAAAGTTACCTGGGGCATGATGG + Exonic
914271278 1:146082957-146082979 CAAAGTTACCTGGGGCATGATGG + Exonic
914271812 1:146087684-146087706 CAAAGTTACCTGGGGCATGATGG + Exonic
914272350 1:146092402-146092424 CAAAGTTACCTGGGGCATGATGG + Exonic
914272888 1:146097124-146097146 CAAAGTTACCTGGGGCATGATGG + Exonic
914273426 1:146101846-146101868 CAAAGTTACCTGGGGCATGATGG + Exonic
914273965 1:146106564-146106586 CAAAGTTACCTGGGGCATGATGG + Exonic
914274502 1:146111272-146111294 CATAGTTACCTGGGGCATGATGG + Exonic
914275035 1:146115990-146116012 CATAGTTACCTGGGGCATGATGG + Exonic
914275573 1:146120716-146120738 CAAAGTTACCTGGGGCATGATGG + Exonic
914276107 1:146125456-146125478 CAAAGTTACCTGGGGCATGATGG + Exonic
914366717 1:146985743-146985765 CAAAGTTACCTGGGGCATGATGG - Exonic
914367253 1:146990504-146990526 CAAAGTTACCTGGGGCATGATGG - Exonic
914485730 1:148107702-148107724 CAAAGTTACCTGGGGCATGATGG + Exonic
914532501 1:148535444-148535466 CAAAGTTACCTGGGGCATGATGG + Exonic
914533040 1:148540170-148540192 CAAAGTTACCTGGGGCATGATGG + Exonic
914533575 1:148544884-148544906 CAAAGTTACCTGGGGCATGATGG + Exonic
914534110 1:148549592-148549614 CAAAGTTACCTGGGGCATGATGG + Exonic
914534645 1:148554300-148554322 CAAAGTTACCTGGGGCATGATGG + Exonic
914535180 1:148559012-148559034 CAAAGTTACCTGGGGCATGATGG + Exonic
914535716 1:148563757-148563779 CAAAGTTACCTGGGGCATGATGG + Exonic
914536251 1:148568473-148568495 CAAAGTTACCTGGGGCATGATGG + Exonic
914537147 1:148576401-148576423 CAAAGTTACCTGGGGCATGATGG + Exonic
914586061 1:149062853-149062875 CAAAGTTACCTGGGGCATGATGG + Exonic
914628775 1:149488943-149488965 CAAAGTTACCTGGGGCATGATGG - Intergenic
914629309 1:149493698-149493720 CAAAGTTACCTGGGGCATGATGG - Intergenic
914629843 1:149498455-149498477 CAAAGTTACCTGGGGCATGATGG - Intergenic
914630377 1:149503216-149503238 CAAAGTTACCTGGGGCATGATGG - Intergenic
914630911 1:149507977-149507999 CAAAGTTACCTGGGGCATGATGG - Intergenic
914631442 1:149512738-149512760 CAAAGTTACCTGGGGCATGATGG - Intergenic
914631976 1:149517494-149517516 CAAAGTTACCTGGGGCATGATGG - Intergenic
914632513 1:149522249-149522271 CAAAGTTACCTGGGGCATGATGG - Intergenic
914633048 1:149527000-149527022 CAAAGTTACCTGGGGCATGATGG - Intergenic
914633583 1:149531729-149531751 CAAAGTTACCTGGGGCATGATGG - Intergenic
914634119 1:149536484-149536506 CAAAGTTACCTGGGGCATGATGG - Intergenic
914634652 1:149541231-149541253 CAAAGTTACCTGGGGCATGATGG - Intergenic
914635187 1:149545968-149545990 CAAAGTTACCTGGGGCATGATGG - Intergenic
914635722 1:149550705-149550727 CAAAGTTACCTGGGGCATGATGG - Intergenic
915018580 1:152759531-152759553 CAAAGAGACCAGGGTCAGGAGGG - Intronic
915742274 1:158127949-158127971 TAGAGTGACCAGAGTCATCAGGG + Intergenic
916564619 1:165962873-165962895 CAGGGTCACCAGGTCCAAGAGGG - Intergenic
918139585 1:181709265-181709287 AAGAGTGACCAGGGCCAGTGAGG - Intronic
919097864 1:193059254-193059276 GTGTGTGGCCAGGGCCATGACGG - Exonic
920743192 1:208600638-208600660 CAGGGTGACCAGTGCTCTGATGG + Intergenic
923271548 1:232359403-232359425 CAAAGTGACCAGTGCCAAGAAGG - Intergenic
1062946063 10:1463085-1463107 CATAGTAACCAGGGTCATGGTGG + Intronic
1064030246 10:11879040-11879062 CCGAGTTCCCAGGGCCATGTAGG - Intergenic
1065123760 10:22553297-22553319 CAGAGTGCTCAGGGGCACGAAGG + Intronic
1067251898 10:44593649-44593671 CAGAGTTCCCAGGGCCCAGAAGG - Intergenic
1067693648 10:48520238-48520260 CACAGTCATCAGGGCCTTGAGGG + Intronic
1067879279 10:50029665-50029687 CCAAGTGGCCAGGGCCTTGAGGG + Intergenic
1067892618 10:50149766-50149788 CCAAGTGGCCAGGGCCTTGAGGG - Intergenic
1069333257 10:67318579-67318601 CAGAGTGAACATGGAGATGAAGG - Intronic
1070602070 10:77872970-77872992 CAGAGTGCCCAGGGCTAAGGGGG + Intronic
1072303452 10:94084560-94084582 CAGACTTACAAGGGCCCTGAGGG - Intronic
1072632349 10:97155083-97155105 CTGAGTTATCAGGGGCATGATGG + Intronic
1072736335 10:97881969-97881991 CAGTGTGATCAGGGCCCAGATGG - Intronic
1074366358 10:112860617-112860639 CAGAGAGAACAGGGACATGCTGG - Intergenic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1074544425 10:114391645-114391667 CACAATGACCACGGCCATGAGGG + Intronic
1076830403 10:132991582-132991604 CACACTGACCAGTGCCACGAGGG + Intergenic
1076885000 10:133258179-133258201 CAGGATGACCAGGGCCCTGGTGG - Intergenic
1077444645 11:2585316-2585338 GACAGTGACCAGGGCCTTGCAGG - Intronic
1077910436 11:6567884-6567906 CAGAGTGACCAGGCTCCTGTGGG + Intronic
1078361798 11:10675012-10675034 CAGAGTGACCCGGAGCAGGAAGG + Intronic
1081589337 11:44410093-44410115 CTGTGTGACCTGGGTCATGATGG + Intergenic
1082814836 11:57500998-57501020 CCGGGAGGCCAGGGCCATGAGGG + Exonic
1083296063 11:61716259-61716281 CAGTGTGACCAGGGCCATGCTGG + Intronic
1083299704 11:61733993-61734015 CAGAGAGACCAGAGCCAGGTGGG + Intronic
1084322967 11:68383840-68383862 CTGTGTGACCTGGGCCTTGAAGG + Intronic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084607222 11:70179420-70179442 CACAGCGCCCAGGGCCATGCTGG - Intronic
1084965551 11:72742564-72742586 CAGACTGAGAAGGGCCTTGAAGG + Intronic
1085286341 11:75364101-75364123 CAGAGTGGGCAGGGATATGATGG - Intergenic
1085347261 11:75776170-75776192 CTGACTGACCTGTGCCATGATGG - Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1086767611 11:90717710-90717732 CAGAGTTTCCAGGGCAAGGATGG + Intergenic
1088818904 11:113440532-113440554 CAGCTTGACATGGGCCATGATGG + Intronic
1089003218 11:115069168-115069190 CAGAGGGACCATGGCCCTGCTGG + Intergenic
1090399083 11:126436786-126436808 GAGAGCTGCCAGGGCCATGAGGG - Intronic
1090593781 11:128298721-128298743 CAGAGTGGTCAGGGAGATGATGG - Intergenic
1091302538 11:134516542-134516564 CTGAGTGACCAGTGCCCTCAAGG - Intergenic
1092153715 12:6268619-6268641 CAGAGGGGACAGGGCCATGTGGG + Intergenic
1094488414 12:30943100-30943122 CTGAGTCAGCAGTGCCATGACGG - Intronic
1095117498 12:38372436-38372458 AAGAGTGACCAAGGCTATAAGGG - Intergenic
1096634572 12:52950000-52950022 CAGAGTGACCAGGTGCACTAGGG + Intronic
1098979709 12:76943046-76943068 CAGAGTGTCCAGAGCACTGAGGG - Intergenic
1100397669 12:94199020-94199042 CAGAGTAAACAGGGCTGTGAAGG + Intronic
1102574142 12:113845215-113845237 CAGAGTCACCAGGGCAGTGAAGG - Intronic
1102999533 12:117374952-117374974 CAGCGTGTTCAGGGCCATGATGG + Intronic
1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG + Intergenic
1104800858 12:131554517-131554539 CAGGGTGGCCACGGCCCTGATGG + Intergenic
1105351909 13:19623556-19623578 CAAGGTGACCAGGGCCATCATGG - Intergenic
1105509263 13:21037790-21037812 CAGAGTGGGCAGGGCCAGGGTGG + Intronic
1107022497 13:35766040-35766062 CAGCATGACCAGGGTCGTGAAGG - Intergenic
1107559552 13:41547254-41547276 CAGAGAGGACAGGGCCATGGAGG - Intergenic
1111560019 13:89932655-89932677 CAGCCTGCCCAGTGCCATGAGGG - Intergenic
1112492593 13:99880784-99880806 CTCAGAGGCCAGGGCCATGAGGG - Intronic
1113672074 13:112182368-112182390 CAGACTGCCCAGGGCTGTGAGGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114663528 14:24366110-24366132 CAGAGTCATCAGGGGAATGAGGG + Intronic
1122293684 14:100693289-100693311 CCGAGTGCCCAGGGCCTTGCTGG + Intergenic
1122407489 14:101509019-101509041 CAGAGTGACCCAGGCCAAGGTGG - Intergenic
1122412135 14:101531040-101531062 CAGAGGGACCAGGGGCAGGGCGG - Intergenic
1122817036 14:104318980-104319002 CAGAGCCAGCAGGGCCAGGACGG - Intergenic
1123088927 14:105733183-105733205 CAGCGTGAACAGGGTGATGATGG - Intergenic
1125523631 15:40361952-40361974 CAGAGTGCCCAGGGCCATGGGGG - Intronic
1126881694 15:53105823-53105845 CAGTGTGACCAGGGACACCATGG + Intergenic
1128105598 15:65042429-65042451 CTGTGTGACAAGTGCCATGAAGG - Intergenic
1128997542 15:72307742-72307764 CAGAGGGACCAGGGCCTCGGGGG + Intronic
1129270396 15:74416556-74416578 CAGGGTGAGCAGGGGCGTGAGGG - Exonic
1129673495 15:77620108-77620130 CAGAATGAACAGTGCCAGGATGG - Intronic
1130847034 15:87757228-87757250 CAAAGGGACCACGGGCATGAAGG - Intergenic
1130992931 15:88887309-88887331 CAGGGTGACCCGGGCCAGGCTGG + Exonic
1132645962 16:999410-999432 GACAGTGACCATGGCCTTGAAGG - Intergenic
1132893345 16:2215173-2215195 CGGAGTGACCCGGGCCAGGCCGG + Intergenic
1134241453 16:12509873-12509895 CAGGGAGAACAGGGACATGAGGG - Intronic
1135375615 16:21944374-21944396 CAGAGGGACCTGATCCATGATGG - Intergenic
1135399950 16:22159834-22159856 CAGAGGGAGCATGGCCCTGAGGG - Intergenic
1138472817 16:57251661-57251683 AAGAATGACCAGGGCCAGGCTGG + Intronic
1139506061 16:67398640-67398662 CAGGGCGGCCAGGGCCAGGATGG + Exonic
1139556928 16:67718471-67718493 AAGAGTGGACAGGGACATGAGGG - Intronic
1139607890 16:68032940-68032962 CAGGGTGGCCAGGGCCGAGAGGG + Intronic
1139853513 16:69964105-69964127 GAGAGTGTCCTGGACCATGAAGG - Exonic
1139882484 16:70187014-70187036 GAGAGTGTCCTGGACCATGAAGG - Exonic
1139950326 16:70665178-70665200 CAGGGTGTCCAGGGCTATCAGGG + Intronic
1140057681 16:71539644-71539666 CAGAGTGAAGAGGGCCATTGAGG + Intronic
1140260311 16:73372665-73372687 CAGAATAACCATGGCCAAGATGG + Intergenic
1140370025 16:74408490-74408512 GAGAGTGTCCTGGACCATGAAGG + Intronic
1140824749 16:78695582-78695604 CAGAGAGAGCAGAGCCATGCTGG + Intronic
1141161725 16:81633557-81633579 CAGAACGACTAGGGCCCTGAGGG + Intronic
1141593069 16:85081516-85081538 GCGAGGCACCAGGGCCATGAGGG - Intronic
1141822330 16:86455153-86455175 CAGGGTGAGCAGGGCCATTGTGG - Intergenic
1142051310 16:87959941-87959963 CCGAGTGACCATGGCCTAGACGG + Intronic
1142119514 16:88379078-88379100 CCGAGTAACCAGCGCCATGCAGG - Intergenic
1142276433 16:89121212-89121234 CAGGCTGACGTGGGCCATGATGG + Intronic
1142693982 17:1623360-1623382 CAGTCTGACCATGGGCATGAAGG - Intronic
1142715711 17:1745782-1745804 CAGGCTGGCCCGGGCCATGATGG + Exonic
1143306100 17:5947992-5948014 CAGAGTGACCACTGCTATCATGG - Intronic
1143777204 17:9207215-9207237 CAGGGTGACAAGTGCCGTGAAGG + Intronic
1143804241 17:9413246-9413268 CAGACTGACCAGGGCTAAGTGGG + Intronic
1145266374 17:21381428-21381450 CAGACTGTGCAGGGCCCTGAGGG - Intronic
1145772599 17:27504434-27504456 GACAGTGAGCAGTGCCATGATGG + Intronic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1146477520 17:33174924-33174946 CAGAGACACCAGGGCCAGTAGGG - Intronic
1146619481 17:34386429-34386451 CTGGGTAACTAGGGCCATGATGG - Intergenic
1147220449 17:38925725-38925747 CAGAATGACCAGGCCTATGATGG - Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147953675 17:44120905-44120927 CAGAAGGATCAGAGCCATGAAGG + Intronic
1148647391 17:49226822-49226844 CAGAAGGACCAGGGCCAGGTGGG - Intronic
1148806846 17:50268223-50268245 CAGATGGAGCAGAGCCATGAAGG - Intergenic
1150135836 17:62694482-62694504 CAGATTGTCCAAGGCCCTGAAGG + Intergenic
1151100862 17:71553724-71553746 CAGACAGACCAGGCCCCTGAAGG - Intergenic
1152584792 17:81184121-81184143 GAGAGTGACCATGGCCAGGGTGG - Intergenic
1154491334 18:14924627-14924649 CAGACAGACGAGGTCCATGAGGG + Intergenic
1155247288 18:23922866-23922888 CAGAGTGACAGGTGCCAAGAAGG + Intronic
1156805442 18:41173352-41173374 CAGAGTGACCAGGTCAAACATGG - Intergenic
1157331192 18:46705017-46705039 CAGAGAGACCAGAGCCATTCTGG + Intronic
1159305121 18:66630863-66630885 CAGAATGTCAGGGGCCATGATGG + Intergenic
1160225020 18:77005737-77005759 CAGAGGGGCCAGGGCCAGCAGGG + Intronic
1161124936 19:2550579-2550601 GAGAGTGACCATGGCCCTGCTGG + Intronic
1162145894 19:8611799-8611821 CAGAGTGACCAAGACCAAGAGGG - Intergenic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1162531421 19:11238329-11238351 CAGAGGGACAGGGGCCCTGAAGG + Intronic
1163229659 19:15992659-15992681 CTGAGTGCCCAGGGGCATGGAGG - Intergenic
1163497606 19:17655815-17655837 CAGGGTCAGCAGGGCTATGATGG - Intronic
1165396874 19:35569304-35569326 CAGAGTGGTCAGGGCTGTGATGG - Intergenic
1165431730 19:35776775-35776797 CAGAGTGATCAGAGCTGTGAAGG + Intronic
1165798498 19:38533037-38533059 CAGAGGGGTCAGGGCCAAGATGG + Intronic
1165806575 19:38584411-38584433 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1165806679 19:38584685-38584707 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1165893815 19:39130038-39130060 CAGAGAGGCCAGGGCTGTGAAGG + Intronic
1165906954 19:39200066-39200088 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1166003020 19:39889532-39889554 CAGTGTGACCAGGGTGATCACGG - Exonic
1166005807 19:39905784-39905806 CAGTGTGACCAGGGTGATCACGG - Exonic
1166194203 19:41195467-41195489 CAGAGTGGTCAGGGCCAAGATGG + Intronic
1166200139 19:41232098-41232120 CAGAGTGGCCAGGGCTGGGATGG - Intronic
1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG + Intronic
1166664348 19:44669830-44669852 CAGAGTGATCAGGGCTGGGATGG - Intronic
1167556238 19:50197675-50197697 CAGATGGAGCAGGGCCATGTGGG + Intronic
1167720022 19:51172886-51172908 AAGAATGACCAGGGTCAGGATGG - Intergenic
1168190536 19:54735380-54735402 CAGAGAGCTCAGGGCCATGTGGG + Intronic
1168192757 19:54751776-54751798 CAGAGAGCTCAGGGCCATGTGGG + Intronic
1168194843 19:54766604-54766626 CAGAGAGCTCAGGGCCATGTGGG + Intronic
1168197093 19:54783046-54783068 CAGAGAGCTCAGGGCCATGTGGG + Intronic
1168202891 19:54829488-54829510 CAGAGAGCTCAGGGCCATGTGGG + Intronic
1168205452 19:54847311-54847333 CAGAGAGCTCAGGGCCATGTGGG + Intronic
1168207916 19:54865932-54865954 CAGAGAGCTCAGGGCCATGTGGG + Intronic
1202676329 1_KI270711v1_random:10131-10153 CAAAGTTACCTGGGGCATGATGG + Intergenic
1202698905 1_KI270712v1_random:148046-148068 CAGAGTGTCCAGAGCAATGAGGG + Intergenic
925183628 2:1832510-1832532 CAGAATGAGCAGGGCCTTGTGGG - Intronic
925895397 2:8467744-8467766 CATGGTGGCCAGGGCCATGGAGG - Intergenic
925968085 2:9084723-9084745 AATATTCACCAGGGCCATGATGG + Intergenic
926942716 2:18155068-18155090 CAGAGGGAGCAGGGCCCTGCAGG + Intronic
927648897 2:24899015-24899037 CAGGGTGACAAGGGGCATGAGGG - Intronic
927746218 2:25623904-25623926 CAGAGTGCCCTGGCCCAGGAGGG - Intronic
929893908 2:45941518-45941540 CAGAGAAAGCAGGGCCGTGAAGG + Intronic
931146714 2:59527253-59527275 CAGAGTGAGCAGGGACAGGGTGG - Intergenic
932735078 2:74248657-74248679 CAGAGTGACAATGGCCATGGTGG - Intronic
933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG + Intergenic
933854081 2:86396466-86396488 CGGAAAGACCAGGGTCATGAAGG - Intergenic
934560719 2:95311954-95311976 CAGAATGAACAGTGCCCTGAAGG - Intronic
935631800 2:105218237-105218259 CAGAGTGCCCACGGTTATGAGGG - Intergenic
935666323 2:105516143-105516165 CACAGTGACCATGGCAAGGAAGG - Intergenic
946337201 2:219045827-219045849 AAGAGCGTCCAGGGCAATGAAGG + Intergenic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948082711 2:235219801-235219823 CAGAGTGACCTGGGGCTTGGAGG + Intergenic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
948887636 2:240892126-240892148 CAGAGTGAGCAGGCTCAGGAAGG - Intronic
1169649741 20:7853830-7853852 CAGTGTGATAAGGGCCATGAAGG + Intergenic
1170211500 20:13850107-13850129 CAAAGTGACAAGGCCCATCAGGG - Intronic
1171780452 20:29411807-29411829 CACAGGGACCAGGGCCTTGTGGG + Intergenic
1172184017 20:33020281-33020303 CAGAGGGCACAGAGCCATGAGGG - Intronic
1174201341 20:48808690-48808712 CAGATTGCACAGGGCCTTGAGGG - Intronic
1175232135 20:57480719-57480741 CAGAGTGTACAGGGCCGTGCAGG - Intergenic
1176204888 20:63882946-63882968 CAGACTGGTCGGGGCCATGATGG - Intronic
1181803680 22:25362594-25362616 CCGTGTGACCTGGGCCTTGAAGG - Intronic
1181901959 22:26163471-26163493 CAGATTGACCAAGCCCCTGATGG + Intergenic
1182173101 22:28253771-28253793 CTGAGTGACCAGGTAAATGATGG + Intronic
1183219909 22:36505970-36505992 CAGAGTGACGTGGGCGATGGTGG + Exonic
1183354810 22:37352471-37352493 CAGAGTGGCCAGTGTCATGAAGG + Intergenic
1183701623 22:39454356-39454378 AAGAGTGACAGGGGCCATGTGGG + Intergenic
1184046038 22:41972722-41972744 CAGAGTGAACAGAGCCAAGCTGG + Intergenic
1184489714 22:44801564-44801586 CATGGTGACCCGGGCCATAATGG + Intronic
1184647058 22:45901899-45901921 CAGAATGCCCAGCGCCAAGAGGG + Intergenic
1184676569 22:46046172-46046194 CAGAGAGTCCAGGGACATGGTGG - Intergenic
1184684382 22:46089555-46089577 CAGAGAGCCCAGCTCCATGATGG + Intronic
949318640 3:2784998-2785020 TAGGGTGTCCAGGGCCAAGAAGG - Intronic
950106429 3:10391851-10391873 CTCAGTGTCCAGGGCCAAGAAGG - Intronic
950454497 3:13084560-13084582 CAGAGTGCCCAGGGCCATCATGG - Intergenic
950480063 3:13238498-13238520 GAGAGTGACAAGTGCCATGAAGG - Intergenic
950485883 3:13273805-13273827 CAGAGCCAGCAGGGCCATGTGGG - Intergenic
952048521 3:29354821-29354843 CAGAGAGACAGAGGCCATGAAGG - Intronic
952658199 3:35813169-35813191 AAGAGTAATCAGGGCCCTGATGG - Intergenic
952673676 3:36000796-36000818 CAGAGTGCCCAGGGGAAGGAGGG - Intergenic
952960208 3:38584297-38584319 CAGAGTGATCAGAACCATTAAGG - Intronic
953563575 3:44013011-44013033 CAGAGTGCTGAGGGCCAGGATGG + Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954124250 3:48519334-48519356 GAGAGTCACCAGGTCCATGCTGG + Exonic
954137972 3:48590897-48590919 CAGAGTGAGAAGGGCCATGGGGG + Intronic
954631013 3:52047585-52047607 CAGAAGGAACAGGGCCCTGAGGG + Intergenic
954792870 3:53145863-53145885 CAGAGTGAGCAGGGCCCAGATGG - Intergenic
956551633 3:70467433-70467455 CAGAGTGACGGGGGACATGGAGG - Intergenic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
956780716 3:72601033-72601055 CAGAGTGACCAGGCCCCTCATGG - Intergenic
957084627 3:75668704-75668726 CACAGGGACCAGGGCCTTGTGGG - Intergenic
959469208 3:106728505-106728527 CAGAGTGACTAAGTACATGAAGG + Intergenic
960847298 3:122016355-122016377 CACGGGGGCCAGGGCCATGATGG + Intronic
960874595 3:122284260-122284282 CAGGAAGCCCAGGGCCATGAGGG - Exonic
961887958 3:130108688-130108710 CAGCGTGACCTTGGCCTTGAGGG - Intronic
964679964 3:159327687-159327709 CAGAGTTATTAGGGCCTTGAGGG - Intronic
966884152 3:184366081-184366103 CTGAGTGACCTAGGCCATGTGGG + Intronic
968702421 4:2063251-2063273 CAGGGTCACCCGGGCCATCACGG - Intronic
968702440 4:2063317-2063339 CAGGGTGGCCCGGGCCATCAAGG + Intronic
968750253 4:2385209-2385231 CAGACAGACCTGGGCCATGGAGG + Intronic
968929947 4:3573539-3573561 CAGAGTGAGAAGGGCTATGCGGG + Intergenic
969458135 4:7312713-7312735 CAGAGTGCCCGGGGACAAGACGG + Intronic
969845426 4:9916742-9916764 CAGAATGCCCAGGGTCATGGTGG - Intronic
970326383 4:14929043-14929065 CAGAGTATGCAGGGCCATAAGGG + Intergenic
970550730 4:17178405-17178427 CAGAGTGAACAGGGAAATGGAGG + Intergenic
974074115 4:57153336-57153358 TAGAGTGTCCAGGGCCATGAAGG + Intergenic
978475351 4:109122229-109122251 CAGAATGTCCAGTGCCAAGAGGG + Intronic
979863420 4:125723184-125723206 CAGAGTGTCCAGGCCCAGGCTGG + Intergenic
985027543 4:185753051-185753073 ACCAGTGACCACGGCCATGAGGG + Intronic
985446345 4:190022869-190022891 CACAGGGACCAGGGCCTTGTGGG + Intergenic
986233242 5:5885745-5885767 GACAGTGACCAGGGCCTTGGTGG + Intergenic
990822377 5:59857191-59857213 CAGATTGACCAAGGGCATAAGGG - Intronic
992018090 5:72595753-72595775 CAGAGTGACAGGGTTCATGAGGG + Intergenic
993307059 5:86286935-86286957 CAGAGTTACCTGGGGCATGGTGG - Intergenic
996672623 5:126135662-126135684 CAGAAGGAACAGAGCCATGAGGG + Intergenic
996760107 5:126978293-126978315 CAGAGTGACCAGCCCCATTCGGG + Intronic
997739070 5:136237962-136237984 CAGACTACCCAGGGCCTTGAGGG - Intronic
997894225 5:137701710-137701732 AAGAGTGACCAAGTCCTTGATGG - Intronic
997992826 5:138560298-138560320 CAGATTTACAAGGGTCATGAAGG - Intronic
998251685 5:140557645-140557667 CCTTGTGACCAGGGCCCTGATGG - Exonic
998351407 5:141504433-141504455 CAGTGTGACTAGTGCCATGTGGG + Intronic
998391121 5:141787632-141787654 CAAAGTGATCAGGGCTAGGATGG + Intergenic
999328848 5:150659548-150659570 CAGAGTGGGCAGGGCCAAGCTGG + Intergenic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1002591439 5:180293462-180293484 CAGAGTGGCCAGGGCCAGAGTGG + Intergenic
1003087703 6:3074179-3074201 CTGAGTGGGCAGGGGCATGAAGG - Intronic
1003182198 6:3801522-3801544 CAGAATGACCAGGGCAGAGAGGG + Intergenic
1004325203 6:14668459-14668481 CAGAGGGACCAGAGGCCTGAGGG - Intergenic
1004363912 6:14996187-14996209 TAGTGTGATAAGGGCCATGACGG + Intergenic
1005016578 6:21380227-21380249 CAATGTGACCAGGGCTATGAAGG - Intergenic
1005583509 6:27254501-27254523 CACAGTGATCAGGGCTGTGATGG - Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006595850 6:35192185-35192207 AAGGGTGAGCAGGGCCATGTGGG - Intergenic
1007123403 6:39402260-39402282 CAGAGGTGCCAGGGGCATGAGGG + Intronic
1007307063 6:40915184-40915206 CAGAGAGAGCATGGCCCTGATGG - Intergenic
1007764904 6:44154590-44154612 CAGAGTGGGCAGGGCCCTGGGGG - Intronic
1019280431 7:197068-197090 GAGAGTGAGCATGGCCATTAAGG + Intronic
1019447654 7:1079738-1079760 CAGAGGGTCCAGGGCCCTGCAGG + Intronic
1021903467 7:25310658-25310680 CAGAATGAACAGGGCCCTGCTGG - Intergenic
1023848249 7:44135457-44135479 CACAGTGAGCAGGGCCCTGCAGG + Intergenic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1025858783 7:65307295-65307317 CAGAGAAACCAGAGCCCTGACGG + Intergenic
1026552299 7:71379065-71379087 CAGAGTGAAGAGTGCCATGATGG + Intronic
1027222072 7:76220546-76220568 CAAAGTTTCCAGGGCCAAGATGG - Intronic
1028130585 7:87168006-87168028 CTAAGTGAACAGCGCCATGAAGG - Intronic
1029226775 7:99034196-99034218 CAGAGTGGCCAGGGCCCTGCAGG - Intronic
1031998252 7:128246918-128246940 CAGAGAGAAGTGGGCCATGAGGG + Intronic
1032084898 7:128878785-128878807 CACAGTGCCTGGGGCCATGATGG - Intronic
1032530409 7:132615295-132615317 CAGAGGGAGCAGGGCCCTAAGGG + Intronic
1032901276 7:136311402-136311424 CTTAGTGACCAGGGCAATGAAGG - Intergenic
1033415927 7:141161260-141161282 GAGAGTGGCCAGGGCTATGGTGG + Intronic
1037672416 8:21026629-21026651 TAGCATGAGCAGGGCCATGAAGG - Intergenic
1038503478 8:28064228-28064250 CAGAGTGACCAAGGACAGAAGGG - Intronic
1038821129 8:30952738-30952760 CAGAGCATGCAGGGCCATGAAGG + Intergenic
1039956013 8:42207659-42207681 CTCAGTGGACAGGGCCATGAGGG + Exonic
1041395765 8:57389650-57389672 AATATTCACCAGGGCCATGATGG - Intergenic
1042634888 8:70863103-70863125 CAGAGAGACTAGAGCCTTGAGGG + Intergenic
1044842295 8:96346827-96346849 GAAAGGGACCAGGGACATGAGGG - Intergenic
1046595754 8:116259428-116259450 CAGAGTGACTAGGGCCTTCCTGG + Intergenic
1048267355 8:132999204-132999226 CAGAGTGAGAAAGGCCAAGATGG + Intronic
1048494652 8:134925145-134925167 GAGAGTGCCCAGAGCCATAAGGG + Intergenic
1049594480 8:143477108-143477130 CAGAGGGACCAAGGCCCGGAGGG - Intronic
1051347787 9:16168209-16168231 CAGGGTGACCTGGCCCATTAGGG + Intergenic
1052489805 9:29150944-29150966 CAGAGTCACCAGAGTCATCAAGG + Intergenic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1054460333 9:65458932-65458954 CAGAGTGAGAAGGGCTATGAGGG - Intergenic
1056494350 9:87141440-87141462 CACAGTGACAGGGGCCATCAGGG - Intergenic
1060067676 9:120517451-120517473 CTGAGTGATCATTGCCATGAAGG - Intronic
1060793087 9:126498656-126498678 CAGAGTGAGCTGGGCAATGCTGG - Intronic
1061487973 9:130929873-130929895 CACAGTGACCAGGGCGCTGTTGG + Exonic
1061664326 9:132151653-132151675 CCCAGTGACCTGGGCCCTGAGGG + Intergenic
1062715908 9:138009953-138009975 CAGTGTGACTGGGGCCATGTGGG + Intronic
1185634164 X:1539081-1539103 CACTGTGACCAGGGGCCTGAAGG - Intergenic
1187520679 X:20011273-20011295 CAGATTGAGCAGGGCTGTGATGG + Intronic
1190327638 X:49216405-49216427 GACAGTGAACAGGGCCATCATGG + Exonic
1190912499 X:54786138-54786160 CAGAGTGACCATGTGGATGATGG - Intronic
1190918460 X:54827270-54827292 CAGAGTGACCATGTGGATGATGG + Intergenic
1192266082 X:69538847-69538869 CGGAGGGACCAGAGCCATTAAGG + Intergenic
1192756825 X:74055424-74055446 CAGAGTGGTCATGACCATGAGGG + Intergenic
1194904006 X:99550960-99550982 CAGAGTGAGAAGGAGCATGACGG - Intergenic
1198228107 X:134665211-134665233 GATAATGACCAGGGGCATGAGGG - Intronic
1199803022 X:151270210-151270232 CAGAGTCACCATGGCTGTGATGG - Intergenic