ID: 947872324

View in Genome Browser
Species Human (GRCh38)
Location 2:233446283-233446305
Sequence GCTTCTGGGAGCAACTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947872324_947872330 1 Left 947872324 2:233446283-233446305 CCTTCCTAGTTGCTCCCAGAAGC 0: 1
1: 0
2: 1
3: 15
4: 164
Right 947872330 2:233446307-233446329 TGGAGTTCTGAGCACAGTTGTGG 0: 1
1: 0
2: 2
3: 22
4: 248
947872324_947872331 27 Left 947872324 2:233446283-233446305 CCTTCCTAGTTGCTCCCAGAAGC 0: 1
1: 0
2: 1
3: 15
4: 164
Right 947872331 2:233446333-233446355 TGCAATGCCCCCACCATTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947872324 Original CRISPR GCTTCTGGGAGCAACTAGGA AGG (reversed) Intronic
900579793 1:3403309-3403331 GCTGCGGGGAGAAACTAGAAAGG + Intronic
902457864 1:16548694-16548716 GCTTCCGGGAGCAACTGGCCCGG - Intergenic
902475310 1:16681035-16681057 GCTTCCGGGAGCAACTGGCCCGG - Intergenic
902494295 1:16859219-16859241 GCTTCCGGGAGCAACTGGCCCGG + Intronic
903438664 1:23370909-23370931 GCTCCTTGGAGCAAGGAGGAGGG + Exonic
903569499 1:24293903-24293925 GCTTCTGGGGGCACCCAGGTGGG - Intergenic
903869948 1:26426668-26426690 GGTTCTGGGGGCAACCAGGAGGG + Exonic
907998683 1:59658768-59658790 GCCTCTGTCAGCAATTAGGAAGG + Intronic
915894714 1:159802829-159802851 GCTGCTGGGGGCAACAGGGAAGG + Intronic
916913909 1:169385038-169385060 GCTACTGGCAGCAACTAAGTAGG - Intronic
917529599 1:175822857-175822879 CATTCTGGGAGCAAAAAGGAGGG + Intergenic
917795523 1:178530183-178530205 TCATCTGGGAGCAATTAAGAGGG + Intronic
918310623 1:183282756-183282778 GTTTTGGGGAGCAACCAGGAAGG + Intronic
924847832 1:247790790-247790812 TCTAGTGGGAGCAGCTAGGAGGG - Intergenic
1065961088 10:30734887-30734909 GCTTATTGGAGGAACGAGGAGGG + Intergenic
1069609251 10:69761630-69761652 GCTCCTGGCAGCAACTATGGAGG + Intergenic
1072513196 10:96149569-96149591 GCTTGTGGGAGGAAGGAGGAAGG - Intronic
1072888242 10:99299089-99299111 CCTATGGGGAGCAACTAGGAGGG - Intergenic
1074885036 10:117686606-117686628 GCTGCTGGGAGCCACAAAGATGG - Intergenic
1074888919 10:117719001-117719023 GCTACTGGAAGCACCTTGGAGGG - Intergenic
1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG + Intronic
1077143075 11:1033389-1033411 GCTTCTGGGTGGGGCTAGGAGGG + Intronic
1079570265 11:21934521-21934543 GCATTTGGGAGCAAATAGGGAGG - Intergenic
1080639398 11:34149959-34149981 CCCTCTGGGGGCCACTAGGAGGG - Intergenic
1081912241 11:46707176-46707198 GCTACTGGGACCAACATGGATGG + Intergenic
1082299011 11:50482308-50482330 GTTTTTGGTAGCAACTATGAAGG - Intergenic
1084468185 11:69339491-69339513 GCTTCTGGGAGCTATGAGGCAGG - Intronic
1085986262 11:81792104-81792126 GCCTCTGAGAGCAGCTTGGAGGG - Intergenic
1087155573 11:94898518-94898540 GCCTATGGGAGCAAAGAGGAGGG - Intergenic
1087177300 11:95107564-95107586 GCTTCTGTGAGTAACGTGGAAGG + Intronic
1087215066 11:95484603-95484625 GCATCTGGGAGCAAGAATGAGGG + Intergenic
1089069451 11:115688264-115688286 GCTCCTGGGAGCATCCAGGATGG - Intergenic
1090403725 11:126465134-126465156 GCTACTAGGAGGTACTAGGAAGG + Intronic
1091162219 11:133434573-133434595 GCTTGTGAGAGCAGCTGGGAAGG + Intronic
1092256170 12:6927896-6927918 GCTTCGGGGAGGGGCTAGGAGGG + Intronic
1093181506 12:15972343-15972365 AGTTCTGGGAGCAACAAGAAGGG - Intronic
1093280950 12:17195625-17195647 GCTTCTGGGGGCTACTGAGATGG + Intergenic
1095708202 12:45260472-45260494 GGTTATGGGAGCAAATAGGAGGG + Intronic
1096076769 12:48810808-48810830 GCTAGTGGGAGCAAGTAGAAAGG + Intergenic
1096531408 12:52244835-52244857 GCATCTGGGGGCATCTAGGAGGG + Intronic
1097504445 12:60447610-60447632 GCTTCTGGGAAAAAATAGGATGG - Intergenic
1098329675 12:69340118-69340140 GGTTCTGGTAGGAACTAGGCAGG - Intergenic
1099226380 12:79974618-79974640 GTTTCTGGGAACAACAAGGGTGG - Intergenic
1104127568 12:125861996-125862018 TCTTCTGGGAGCAGCTGGGGTGG + Intergenic
1110302078 13:73940300-73940322 GCTGCTGGCAGCCTCTAGGAAGG - Intronic
1111604512 13:90520111-90520133 GCTTCTGGGAGCCACTCTCAGGG - Intergenic
1113758923 13:112834035-112834057 CCTTGTGGGAGCCACTGGGACGG - Intronic
1118154770 14:63228876-63228898 GCTTCTGGAAGAAACTCGGAAGG - Intronic
1118884301 14:69853663-69853685 GCTTCTGGAAGAACCCAGGATGG - Intergenic
1119767922 14:77202031-77202053 GCTGCAGGGAGCACCTAGAAGGG - Intronic
1120914983 14:89702779-89702801 GCTTCCAGGAGAAACTAGAAAGG + Intergenic
1122389007 14:101367742-101367764 GCTGCTGGGAGCCAGGAGGATGG + Intergenic
1122543088 14:102508647-102508669 GCTCCTGGGAGGAGATAGGAGGG + Exonic
1122609312 14:102970421-102970443 ACTTCTGGGTTCAACTGGGATGG + Intronic
1125881439 15:43199245-43199267 GCCTGTGAGAGCAACTGGGAGGG + Intronic
1126747722 15:51843367-51843389 GATTCTTAGAGCAAGTAGGAAGG + Intronic
1127683774 15:61322079-61322101 GCTTCTGAGAGAAACTGGTAAGG + Intergenic
1127813514 15:62585481-62585503 GCTTCCCTGAGCAAGTAGGAAGG + Intronic
1129194036 15:73953692-73953714 ACTCCTGGGAGTATCTAGGAAGG - Intergenic
1130043053 15:80421093-80421115 GCCTTTTGGAGCAACTTGGATGG + Intronic
1130964941 15:88690143-88690165 GGTGCTGGGAGCACCCAGGAGGG - Intergenic
1134505781 16:14805726-14805748 GCTCCTGTGAGCAAAGAGGATGG + Intronic
1134574800 16:15323221-15323243 GCTCCTGTGAGCAAAGAGGATGG - Intergenic
1134727645 16:16433253-16433275 GCTCCTGTGAGCAAAGAGGATGG + Intergenic
1134939787 16:18278574-18278596 GCTCCTGTGAGCAAAGAGGATGG - Intergenic
1137223716 16:46481896-46481918 CCTTGAGGGAGCAACTAGGCAGG - Intergenic
1140372258 16:74420044-74420066 GCTTATCTGAGCCACTAGGACGG - Intronic
1142508413 17:380439-380461 GCTTCTGGGAGGGATGAGGAGGG - Intronic
1142508420 17:380461-380483 GCTTCTGGGAGGGATGAGGAGGG - Intronic
1142508805 17:381502-381524 GCTTCTGGGAGCGATGAGGAGGG - Intronic
1142939071 17:3366298-3366320 GATTCTGGGATTAGCTAGGATGG - Intergenic
1143779917 17:9224007-9224029 GCAGCTGGGAGCAAGGAGGAAGG + Intronic
1145030273 17:19499881-19499903 GCTTGTGAGTGCAACTAGCAAGG - Intronic
1145969828 17:28950363-28950385 GATTCTGGGAGCAGCCTGGATGG - Intronic
1147389961 17:40103104-40103126 GAGTGTGGGAGCAACTGGGAGGG + Intergenic
1147546855 17:41408462-41408484 GCTTCTGGAAGCTGCTAGGCTGG - Intergenic
1151545432 17:74790181-74790203 CCTCCTGGGAGCCAGTAGGATGG - Exonic
1152348441 17:79769256-79769278 ACTTCTGGGAGCCCCTAGAAGGG + Intergenic
1154163447 18:11996735-11996757 GCCTCTGGGATCATCAAGGAAGG - Intronic
1157664447 18:49473989-49474011 GCTTCTGGGAGCTAAGAGCAGGG + Intergenic
1159557363 18:69959400-69959422 GCTTCTGTCAGCAACTGGTAAGG - Intronic
1162538685 19:11279984-11280006 GGTTCTGGGAGCAAATACAATGG - Intergenic
1166107922 19:40606521-40606543 GCATCTGTGAGCAACCAGCAGGG + Exonic
1166660524 19:44644078-44644100 GCTGCTCGGAGCAACTGGCATGG + Exonic
927879393 2:26679958-26679980 GCTTCTGGGAGAAACAGGCAGGG + Intergenic
929613917 2:43293176-43293198 GCTTCTGGGAGGAAGTCAGAGGG - Exonic
929684935 2:44025495-44025517 CCTTCTGGGGGCAACTTTGATGG + Intergenic
931830586 2:66046984-66047006 GCTTCTGGGATCCAGTAGGGAGG + Intergenic
936988848 2:118340558-118340580 TCTTCTGGGAGCAACTAGGTTGG + Intergenic
937436466 2:121885776-121885798 GCTTCTGAGAGCCACGAGGAAGG + Intergenic
938796219 2:134719579-134719601 GCTCCAGGGAGAAACTGGGAGGG - Intergenic
939777538 2:146405485-146405507 GATCCTGGGAGCAACTGGAAGGG - Intergenic
940577799 2:155535287-155535309 GTATCTGTGAGCAACTAGAATGG - Intergenic
941490670 2:166138837-166138859 GCCTGTGAAAGCAACTAGGAGGG + Intergenic
941543857 2:166820644-166820666 GCTTCTGGGAGGAAATAGGCTGG + Intergenic
946674638 2:222145837-222145859 GCCTCTTGCAGCAACTCGGATGG + Intergenic
947218329 2:227769372-227769394 GCTTCTGGGGCCAAATTGGAGGG + Intergenic
947504316 2:230695188-230695210 TCTTCTGGAAGAAACTGGGAGGG + Intergenic
947637716 2:231688588-231688610 AATTATGGGAGCAACTGGGAAGG - Intergenic
947872324 2:233446283-233446305 GCTTCTGGGAGCAACTAGGAAGG - Intronic
947996527 2:234532453-234532475 GTCTTTGGGAGCAACTTGGATGG + Intergenic
1169225614 20:3854808-3854830 GCTTGGGTGAGGAACTAGGATGG - Intronic
1170698863 20:18685209-18685231 GCTTCTGGAAGGAAAGAGGAAGG + Intronic
1170933062 20:20786421-20786443 GCATCTGGAAGTAACTAGGATGG + Intergenic
1176310605 21:5147002-5147024 GCGTCTGGGAGGAGTTAGGAAGG - Intronic
1179846450 21:44115033-44115055 GCGTCTGGGAGGAGTTAGGAAGG + Intronic
1179878807 21:44285038-44285060 GCTTCCGGGGGCATCTGGGAAGG - Intergenic
1179926767 21:44539145-44539167 GCTCCTGGGAGCAAGGAGGGGGG + Exonic
1183319110 22:37154335-37154357 GCCTGTGGGAGCACGTAGGAGGG + Intronic
1183457852 22:37932501-37932523 GCTCCTGGCAGCAACCAGGCAGG + Intronic
1184587151 22:45455697-45455719 GCCTCTGGGAGCAATAAAGAAGG - Intergenic
1184815268 22:46864102-46864124 GCTTCTGGTTACAAATAGGAAGG - Intronic
1185414929 22:50704716-50704738 GCTGCGGGGGGCAATTAGGAAGG - Intergenic
949937886 3:9131093-9131115 GCTCCTAGCAGCAACTTGGATGG - Intronic
950487938 3:13283717-13283739 CCTTCTGGTTGCAACTGGGAAGG - Intergenic
952745667 3:36775496-36775518 TCTTCTTGGAGCAACTGAGAAGG - Intergenic
954417374 3:50399902-50399924 GCTTGTGGGGGCAACTCGGAGGG - Intronic
955634189 3:61008064-61008086 GCTCTTGGGAGAAACCAGGAAGG - Intronic
957493265 3:80957359-80957381 GCTTTTGGTAGAATCTAGGAAGG - Intergenic
959796103 3:110430057-110430079 GCTTCTAGGAGGACCTAGGCTGG - Intergenic
962756627 3:138469896-138469918 GCTAGTGGGAGGCACTAGGACGG - Intronic
963867420 3:150377868-150377890 GTTTCTGGTAGCAGCAAGGAGGG - Intergenic
964028527 3:152107813-152107835 GTTTCTGGAGGCAACTTGGAGGG - Intergenic
968803129 4:2756050-2756072 GCTTCCGGGAGCAGCTGCGAAGG - Exonic
968920996 4:3522272-3522294 GCTTTTGGCTCCAACTAGGAAGG - Intronic
970010888 4:11457879-11457901 CCTTCTGGGGGCTACGAGGAAGG + Intergenic
970656666 4:18238271-18238293 GCATCTGTGAACAACTTGGAAGG - Intergenic
972382639 4:38533749-38533771 GCTACTGGCAGCTACTTGGATGG - Intergenic
974167767 4:58225691-58225713 GCATCTAGGAGAAACAAGGAGGG + Intergenic
979509692 4:121538202-121538224 GCTTTTGGCAGCAACTTGGATGG - Intergenic
979540146 4:121871213-121871235 TCTTTTGGCAGCAACTTGGATGG - Intergenic
981275452 4:142893728-142893750 GCTTCTGAAAGCAGCTAAGAGGG + Intergenic
983507023 4:168564837-168564859 CCTTATGGGAGCAAATATGAGGG - Intronic
986279835 5:6314068-6314090 GGATATGGGAGCACCTAGGAGGG - Intergenic
986580949 5:9265213-9265235 GCATCTGGGAGGAACCAGGAGGG + Intronic
987135163 5:14893535-14893557 GCCTCTGAGAGCAAATAGGGAGG + Intergenic
987832525 5:23114695-23114717 GTTTCTGGGGGCCACTGGGAAGG + Intergenic
989469284 5:41796291-41796313 GCTTCTGGTCTCAACCAGGAAGG + Intronic
990595850 5:57311633-57311655 GCCTGTGGGAGCAACGAGAAGGG + Intergenic
990637117 5:57741251-57741273 GCTTATGGGAGTAAGGAGGAAGG - Intergenic
992882599 5:81125314-81125336 AGCTCTGAGAGCAACTAGGAAGG + Intronic
998056561 5:139083180-139083202 GCCACTGGGAGAAACTAGGGAGG + Intronic
998231785 5:140365589-140365611 GCTCCTGGGAGGTTCTAGGAAGG + Intronic
1001115730 5:168937626-168937648 GAACCTGGAAGCAACTAGGATGG + Intronic
1002083403 5:176751314-176751336 CCTGCTGGGAGCAATTCGGAAGG + Intergenic
1003986716 6:11442939-11442961 GCTCCTGAGAGCAGCCAGGAGGG + Intergenic
1006193289 6:32222482-32222504 GCTGCTGGGGGCAGCCAGGAGGG - Intronic
1009920726 6:70056702-70056724 GCTTCTGGCAGAAAGGAGGAAGG + Intronic
1012406589 6:98907346-98907368 GCTACTGGGAGCAAGGAGGCAGG + Intronic
1013463243 6:110395531-110395553 GTTTCAGGGAGAAACTGGGAAGG + Intronic
1013691951 6:112655893-112655915 GTTTCTTGGAGCAACTAGCAGGG + Intergenic
1013761869 6:113528237-113528259 CCTTCTGAAAGCAACTTGGAAGG - Intergenic
1015360283 6:132331954-132331976 ACTTCTGGAAGCCACTAGCAGGG + Intronic
1015933494 6:138385574-138385596 GGTTCTGTGAGCAAGGAGGAAGG - Intergenic
1017754701 6:157519568-157519590 GATTCTGGGAGCAACTTAGACGG + Intronic
1017841716 6:158227755-158227777 GCATTTGGGAGCCATTAGGAGGG - Intergenic
1027360486 7:77403499-77403521 AATTCTGGGAGCAAATGGGAGGG - Intronic
1031306969 7:120140672-120140694 CTTTCTGGGAGCAACTTGAAAGG - Intergenic
1032450544 7:132026687-132026709 GCATCTGGTAGCAAGGAGGATGG - Intergenic
1032478553 7:132228456-132228478 CCTTCCGGGTGCAACTGGGAAGG + Exonic
1033134493 7:138773447-138773469 TCTTCTGGGGGCATGTAGGAGGG - Intronic
1034445748 7:151113423-151113445 TCTGCAGGGAGCACCTAGGATGG + Intronic
1035350478 7:158242097-158242119 GCTGCTAGGAGCCACTAGCATGG - Intronic
1035673101 8:1435060-1435082 GCTTCCAGGAGCAATAAGGACGG - Intergenic
1035997085 8:4560116-4560138 GCTTCCTGGAGCAGCTTGGAGGG - Intronic
1037206056 8:16321135-16321157 GCTTGGGAGAGCAACCAGGAGGG + Intronic
1037688808 8:21165827-21165849 GCTTCTGGAAGCTCTTAGGAGGG + Intergenic
1039304176 8:36243151-36243173 GCTGCTGGGAGTAGATAGGATGG + Intergenic
1039688324 8:39833734-39833756 GCTACTGGGAACAAGAAGGAGGG + Intronic
1041395088 8:57381605-57381627 GCTTCTGGGAGTAACCAGCCAGG - Intergenic
1045435798 8:102162525-102162547 ACTTCTGGAAGATACTAGGAAGG - Intergenic
1048196886 8:132338759-132338781 GCTTCTGGCAGAAAATAGGCAGG + Intronic
1048485626 8:134844757-134844779 TATTGTGGGAGCAAATAGGAGGG - Intergenic
1049676359 8:143891030-143891052 GCTTCTGGGGGTGACAAGGAAGG - Intergenic
1050508551 9:6371207-6371229 GCTTGTGGAAGCAGCTGGGAAGG + Intergenic
1051449745 9:17182055-17182077 TCTTCTGGCAGCAATTAGGGAGG + Intronic
1056273999 9:84975045-84975067 GGCTCTGGGAGCACCTTGGAAGG + Intronic
1057311184 9:93944237-93944259 GCTGATGGGAGCTGCTAGGATGG - Intergenic
1194962351 X:100250293-100250315 GCTTATGCAAGCCACTAGGAGGG - Intergenic
1196457367 X:115899982-115900004 GCTTCAGGGACCAAGAAGGAAGG - Intergenic
1200141927 X:153906789-153906811 GGTCCTGGGAGCCACTGGGAGGG + Exonic