ID: 947874195

View in Genome Browser
Species Human (GRCh38)
Location 2:233457718-233457740
Sequence CAGGGCAGGCACATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 4, 3: 79, 4: 526}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947874188_947874195 19 Left 947874188 2:233457676-233457698 CCAGGCAGAGAGAATTGCACAGA 0: 1
1: 0
2: 6
3: 48
4: 440
Right 947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG 0: 1
1: 0
2: 4
3: 79
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947874195 Original CRISPR CAGGGCAGGCACATGGAGGA TGG Intronic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900177002 1:1295395-1295417 CAGGGCAGGGCCAAGGAGGCTGG - Intronic
900238071 1:1601770-1601792 CAGGGCAGGAGCCTGGATGATGG + Intergenic
900458291 1:2787787-2787809 CAGGCCAGGTACATGGAGACGGG - Intronic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
900590699 1:3458255-3458277 CAGGGCATGCACAGGGCAGAGGG - Intronic
900718540 1:4160404-4160426 CAGGGCTGGCACAGGGACCATGG + Intergenic
900905333 1:5552959-5552981 CAGGGCAGGTACATGGGGCCAGG + Intergenic
901004067 1:6163271-6163293 CAGTGCAGGTGGATGGAGGAGGG - Intronic
901513300 1:9729171-9729193 CAGGGACGGGACATGGAGGATGG + Exonic
902211857 1:14910317-14910339 TAGGGCACCCACATGGGGGAAGG - Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902876638 1:19344492-19344514 CAGGGCTGGCAGGTGGAGGGAGG - Intronic
902998984 1:20250897-20250919 CTGGCCAGGCCCATGGAAGACGG + Intergenic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903269201 1:22177232-22177254 CAGGGGAGGGACAAGGAGCAAGG + Intergenic
903744875 1:25580165-25580187 CAGGGTAGGCTCCTGGTGGATGG + Intergenic
903772981 1:25775711-25775733 CAGGGCTGGAGCATGCAGGAAGG + Intronic
903823545 1:26123582-26123604 CAGGGCAGGCAAAGTGAGGGTGG - Exonic
903847982 1:26289819-26289841 AAGGGCAGGCACATGGAGGGCGG - Intronic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904239382 1:29134274-29134296 CAGGGCAGGCCCCAGGTGGAGGG + Intergenic
904830615 1:33304185-33304207 AAGGGCAGGCACGGAGAGGAAGG + Intergenic
904940155 1:34160078-34160100 CAGGTCAGGCACATGAATGAGGG + Intronic
905276055 1:36818993-36819015 GAGGGCAGGCACAGGGAGAGGGG - Intronic
905325564 1:37149376-37149398 CAGAGCAGCCACATTGAGGAAGG + Intergenic
906607365 1:47181528-47181550 CAGGGCAGGAACATGGGGTGAGG + Intergenic
906688876 1:47779708-47779730 CAGGGCAGGCCCATGGCAGGAGG - Intronic
906711103 1:47930521-47930543 CAGGGCAGTAGCAGGGAGGAGGG - Intronic
908265249 1:62372350-62372372 CAGCGCAGCCACATGGTAGAAGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
909266098 1:73559410-73559432 CATGGGAGGGACCTGGAGGAAGG + Intergenic
909688994 1:78384490-78384512 CAGTGCAAACTCATGGAGGAAGG + Intronic
910159870 1:84261179-84261201 CAGGTCAGGCACATGGATTTTGG + Intergenic
911210880 1:95136991-95137013 CAGGGCTGGTACATGGCGGGTGG + Intronic
911218081 1:95217084-95217106 CAGGGGAGGCACCTGGTGGAAGG - Intronic
914388908 1:147200267-147200289 AAGGGAAGGCACATGGAAGAAGG - Intronic
914937410 1:151993367-151993389 CAGGGCAGGGGCGTGTAGGAGGG + Intronic
915076214 1:153309793-153309815 CAGGGCAGGAACCAGGAGGCAGG + Intronic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915734720 1:158077535-158077557 CAAGGCAGGCCCAGGGAGGAAGG - Intronic
915949168 1:160176468-160176490 GATGGCAGGGACCTGGAGGATGG - Exonic
916215606 1:162390533-162390555 CCGGGAAGCCACCTGGAGGAAGG - Intergenic
917494505 1:175527937-175527959 CAGTGCAGGCACAGGCAGGCTGG + Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
918099553 1:181361657-181361679 CAAGGCAGACACCTGTAGGAGGG - Intergenic
918983791 1:191596674-191596696 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
919925537 1:202189994-202190016 CAGGGAGGGCATATGGAGAAAGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920054706 1:203183610-203183632 CAGGTCAGGGACAGGGAGGGAGG - Intronic
920566547 1:206978543-206978565 CAGCACAGCCACATGGTGGAAGG - Intergenic
920872123 1:209803611-209803633 CAGGGCATGGGCTTGGAGGAGGG - Intronic
921068747 1:211641793-211641815 CAGCGCAGCCACATGGTGGAAGG + Intergenic
921316386 1:213895440-213895462 CAGAGCTGTCACTTGGAGGAGGG - Intergenic
922367984 1:224883948-224883970 AAGGGCAGCAACTTGGAGGAAGG + Intergenic
922740437 1:228011262-228011284 CAGGGCAGGGACATGGCCCAGGG + Intronic
923109507 1:230879742-230879764 CAGGGCAGGGTGATTGAGGAGGG - Intergenic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
923428270 1:233893286-233893308 CAGGGGAGGGACCTGGTGGAAGG - Intergenic
924518283 1:244783979-244784001 CAGAGCAGGCACTTGGAGAATGG + Intergenic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1065200943 10:23312453-23312475 CAGGGCAGGGACAGGGAAAATGG - Intronic
1065818998 10:29507871-29507893 CCGGGCAGGGACATGGGGGAGGG + Intronic
1065953822 10:30676051-30676073 CCGGGCAGGGACGTGGGGGAGGG - Intergenic
1065970144 10:30799552-30799574 CACTGCAGGCACAGGGAGGCAGG - Intergenic
1067131574 10:43570132-43570154 CAGGGCAGGCCCAAGGAAGGAGG - Intronic
1067151087 10:43735491-43735513 CAGGACAGCCCCATGAAGGAGGG + Intergenic
1067465501 10:46495244-46495266 CAGAGCAGGAACATGCAGGGGGG + Intergenic
1067621686 10:47889357-47889379 CAGAGCAGGAACATGCAGGGGGG - Intergenic
1068083524 10:52347445-52347467 CAGACCAGGCACAAGGAGCAGGG - Intergenic
1069858952 10:71458306-71458328 AAGGGAAGGCACATGGGTGAGGG - Intronic
1070109334 10:73467804-73467826 CAGGGCTGGTAGAGGGAGGAAGG + Intronic
1070511638 10:77166591-77166613 GAGGGGAAGGACATGGAGGAGGG + Intronic
1070654843 10:78264292-78264314 CTGTGCAGGCACATGGAGGGAGG + Intergenic
1070853357 10:79585249-79585271 CAGGCCAGGCACAAGGAGAAGGG + Intergenic
1070986592 10:80695039-80695061 CAGGGATGGGATATGGAGGATGG + Intergenic
1071797548 10:89022578-89022600 CAGGGGAGGTGCTTGGAGGACGG - Intergenic
1073441234 10:103553866-103553888 CAGGCCAGGGCCAGGGAGGATGG + Intronic
1073465798 10:103693915-103693937 CAGGGCAGGTAAACGGAGGCTGG - Intronic
1074011056 10:109480546-109480568 CATGGCAGGCACCGGGTGGAAGG + Intergenic
1075482022 10:122789968-122789990 CAGGGCAGTAACCTGTAGGAAGG + Intergenic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1075924191 10:126236860-126236882 CAGGGCCGCCTCCTGGAGGAAGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076140723 10:128077020-128077042 CTGAGAAGGCACCTGGAGGAGGG - Intronic
1076356315 10:129856119-129856141 TAGGGCAGGCACGTGGCAGAGGG - Intronic
1076676062 10:132148442-132148464 GAGGACGGGCAGATGGAGGACGG - Intronic
1076890236 10:133279814-133279836 CAGGACAGGCACTTGGGGGGTGG + Exonic
1077101812 11:825814-825836 CAGGGCTGGGATATGGAGGCAGG + Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077164419 11:1128771-1128793 CACGGGAGGCACATGGAGGTCGG - Intergenic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078360688 11:10665418-10665440 CTAGGCAGGAACATGGAGGTTGG - Intronic
1078447710 11:11416974-11416996 CAGAGGAGTCACATAGAGGAAGG - Intronic
1079599702 11:22295686-22295708 GAGGTCATGCACATTGAGGAAGG + Intergenic
1081068417 11:38577421-38577443 CAGGGGAGCCACATGGTGGGAGG - Intergenic
1081206747 11:40284280-40284302 CATGGCAGGCAGATGGGAGAGGG + Intronic
1081605607 11:44525493-44525515 CCTGGCAGGCACCTCGAGGAAGG - Intergenic
1081664286 11:44907373-44907395 CAGGGCAGGCTCTTGAAAGAGGG + Intronic
1082830694 11:57614750-57614772 CATGGCAGGGCCATGGAGAAGGG - Exonic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083997557 11:66279620-66279642 CAGGTGAGGCACCGGGAGGAAGG - Intronic
1085023953 11:73225832-73225854 GAGGGCAGGGACAGAGAGGATGG + Intronic
1085295232 11:75427740-75427762 AAGGGCAGGGACATGCAGAAAGG - Intronic
1085801433 11:79593644-79593666 CAGGGAAGGGTCAAGGAGGAAGG - Intergenic
1087499690 11:98933963-98933985 CAGGGCAAGAACATGGAGAAAGG + Intergenic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1088972586 11:114786935-114786957 CAGACCAGGGACCTGGAGGAGGG - Intergenic
1089166182 11:116478285-116478307 CATAGCAGGCAAATGGAGGGGGG - Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090654364 11:128831661-128831683 GGAGGCAGGCACAGGGAGGAAGG + Intergenic
1091372504 11:135072731-135072753 CAGGGCAGCCAAATGGAGACAGG + Intergenic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1094524023 12:31219898-31219920 CAGGGCAGGCTCCTGGAGGAGGG - Intergenic
1095890567 12:47231834-47231856 CAGGGAAGGCACATCGAGCTGGG + Intronic
1096195934 12:49648833-49648855 CAGGCCTGGCGCCTGGAGGAAGG + Intronic
1096539381 12:52296443-52296465 CAGGGCAGGGACATGGGGCGAGG + Intronic
1096545972 12:52340493-52340515 CAGGCCTGGCACATAGTGGAGGG + Intergenic
1096780110 12:53986633-53986655 CAAGCCAGGCATCTGGAGGAGGG - Intronic
1096807209 12:54148234-54148256 CAGGGCAGGAAGATGGCTGAAGG + Intergenic
1097311304 12:58122285-58122307 TAAGGCAGTGACATGGAGGATGG + Intergenic
1097707224 12:62880800-62880822 CAGGGCGAGCACCTGGAGAAGGG - Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1099322102 12:81162910-81162932 CAGAGCAGGCACCAGGAGCAGGG + Intronic
1099738455 12:86600903-86600925 CAGAGCAGGCACTGGGAGCAGGG - Intronic
1099871477 12:88355074-88355096 TTGGGTAGCCACATGGAGGATGG - Intergenic
1102096861 12:110247796-110247818 GCGGGCAGGCACAGGCAGGATGG - Intergenic
1102976858 12:117213070-117213092 AAAGGCAGGCACATGCAGAAAGG + Exonic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103292219 12:119855749-119855771 CAGGCCATTCACCTGGAGGAAGG + Intronic
1103409956 12:120703816-120703838 CAGGGCAGGCGCATGGGGCAGGG - Intergenic
1103725592 12:122996014-122996036 CAGGGCAGGTACATGGGGGCAGG - Intronic
1104550381 12:129751403-129751425 CAGGGGAGGGACATGGTGGGAGG - Intronic
1104768748 12:131346788-131346810 CAGGGCAGGCATTTAGAGGAAGG - Intergenic
1106083467 13:26519734-26519756 CAGAGCAGCCACTGGGAGGAAGG - Intergenic
1106969842 13:35126207-35126229 CAGGGCAGGAAGATGGAGTGAGG - Intronic
1107027461 13:35817588-35817610 AAAGGCTGCCACATGGAGGACGG - Intronic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107272489 13:38636288-38636310 CAGGGCAGCCACGTGGTGGAAGG - Intergenic
1107430696 13:40337837-40337859 CTGGGGATGCACGTGGAGGAAGG + Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108526246 13:51288275-51288297 GAGGCCAGGCCCATGCAGGATGG - Intergenic
1108530155 13:51320944-51320966 CAGGGACAGCACATGGGGGAAGG - Intergenic
1110046708 13:70841472-70841494 CAGGGAAGGAACAGGGAGGTGGG + Intergenic
1110936926 13:81303062-81303084 CAGTGCAGCCACATGGTGGGAGG + Intergenic
1112563077 13:100530853-100530875 CAGGGCAGTCACAAGGAGCTTGG + Exonic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113565180 13:111315568-111315590 CAGGGCGGGGCCAGGGAGGAGGG - Intergenic
1113614652 13:111671619-111671641 GATGGCAGGCACAGGGAGGTTGG + Intronic
1113620121 13:111756533-111756555 GATGGCAGGCACAGGGAGGTTGG + Intergenic
1113927158 13:113947917-113947939 CAGGCCAGAATCATGGAGGAGGG - Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1117426914 14:55609298-55609320 CTCGGCAGGGACATGGATGAAGG - Intronic
1118382630 14:65229871-65229893 CTGGGCGGGCCCACGGAGGAAGG - Intergenic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118947096 14:70398584-70398606 CAGAGCAGGCACTGGGAGCAGGG + Intronic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1120759178 14:88270779-88270801 CATGGCTGGTATATGGAGGATGG - Intronic
1120824508 14:88943276-88943298 CAGGGCAGACTCATGGAGAAGGG - Intergenic
1121239596 14:92419283-92419305 CTGGGAAGGGACCTGGAGGAAGG - Intronic
1121261562 14:92570011-92570033 CAGGGATGGCACAGGAAGGAAGG - Intronic
1121642359 14:95494322-95494344 CAGGAGAGGCTCATAGAGGAAGG + Intergenic
1121816670 14:96933984-96934006 CTGAGGAGGCACATGGGGGAGGG + Intergenic
1122053431 14:99075620-99075642 CAGGGAAGGTGCCTGGAGGAGGG + Intergenic
1122064962 14:99166477-99166499 CAGAGAATGCACATGGAGGTTGG - Intergenic
1122353696 14:101111501-101111523 GAGGGCAGGCACATGGAGGGTGG + Intergenic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1124072219 15:26406035-26406057 TATGCCAGGCACATGGGGGAAGG + Intergenic
1126065332 15:44822215-44822237 CAGGTCAGGCACAAGGGGAAGGG + Intergenic
1126094501 15:45078368-45078390 CAGGTCAGGCACAAGGGGAAGGG - Intergenic
1127354210 15:58182625-58182647 TAGGGGAGGCACATGGAGGGTGG - Intronic
1128111164 15:65077072-65077094 CAGCGCCGGCGCCTGGAGGAAGG - Exonic
1128623415 15:69173421-69173443 AAGGGTTGGCACATGGAAGAAGG + Intronic
1128639365 15:69324803-69324825 CAGGACAGGGCCATGGAGGTAGG - Intronic
1128797873 15:70478317-70478339 CAGGGCAGGCGCCCGGAGGGAGG - Intergenic
1129714918 15:77841571-77841593 CAGGGGAGGCACCTGGACAATGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130770609 15:86919939-86919961 AAGGGCAGGCTCATGGGGGAGGG + Intronic
1130928557 15:88403568-88403590 CAAGGCGGGGACATGAAGGAGGG + Intergenic
1130957408 15:88637467-88637489 CAGGGCATGAAGATGGAGGTGGG + Intronic
1130990232 15:88871640-88871662 CAGGACAGGGACCTGGGGGAGGG + Intronic
1131254454 15:90852830-90852852 CAGGGCAGGCAAAAGGATGTGGG + Intergenic
1131666792 15:94579511-94579533 AGTGGCAGGCAGATGGAGGAAGG + Intergenic
1131842845 15:96456092-96456114 CACGGCAGGCACATGGTAAACGG - Intergenic
1131952427 15:97694960-97694982 CAGGGGAGGACCATGGTGGAAGG + Intergenic
1132110651 15:99099888-99099910 CAGGGCGAGGGCATGGAGGAAGG + Intronic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132720461 16:1313152-1313174 CAGGGCAGGAGCATGGGGTAGGG - Intronic
1132834639 16:1946689-1946711 AGGGGCCCGCACATGGAGGACGG - Exonic
1133603315 16:7361129-7361151 GAGGGCTGGCAGGTGGAGGAAGG - Intronic
1134028965 16:10976752-10976774 CAGGGCAGGGGCCTGGGGGAGGG + Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134739925 16:16533611-16533633 CAGGGCAGGGACTTGGAGTATGG + Intergenic
1134911709 16:18033051-18033073 CAGGGGAGGAAGATGGAGGGAGG - Intergenic
1134927574 16:18178553-18178575 CAGGGCAGGGACTTGGAGTATGG - Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135415493 16:22265492-22265514 CAGGGAAGGCTCCTGGACGAGGG - Intronic
1135516292 16:23138449-23138471 CAGACTAGGGACATGGAGGATGG - Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136274283 16:29169383-29169405 CAAGGCAGGCACATGGCGGGGGG - Intergenic
1136283872 16:29230190-29230212 CAGGCCAGGTGCAGGGAGGACGG + Intergenic
1136631342 16:31490788-31490810 CAGGGCAGGAACCTGGAGCAAGG - Exonic
1138414294 16:56862551-56862573 CAGGGAAGGCTTCTGGAGGAGGG - Intergenic
1138451810 16:57097788-57097810 CAGGGGACTCCCATGGAGGAGGG - Intronic
1138522367 16:57578124-57578146 CAGAGCAGGCACTTGGTGAACGG + Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138955213 16:61963244-61963266 CATGGAAGGGACATGGAGGAAGG - Intronic
1139027879 16:62841524-62841546 GAGGGAAGGCACAGTGAGGATGG + Intergenic
1139557427 16:67721212-67721234 CTGGGCATCCTCATGGAGGAAGG + Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1141579685 16:84988733-84988755 TGGGGTAGGCACATGGGGGAGGG - Intronic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141769504 16:86080835-86080857 CAGGGCAGGAACAGGGAAGGCGG - Intergenic
1141983695 16:87565903-87565925 GAGGGGAGGGACAGGGAGGAAGG - Intergenic
1142317776 16:89359519-89359541 CAGGGCCGGAACAAGGAGGTAGG - Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143325143 17:6093674-6093696 CAGGGCAGACACACGGTGGTGGG + Intronic
1145280640 17:21464559-21464581 GAGGGCAGGAACATATAGGAAGG + Intergenic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1146890591 17:36504038-36504060 CAGGGCAGGCACCTGCAGCATGG + Intronic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147164549 17:38586395-38586417 CAGGGCTGGGAGGTGGAGGAGGG - Intronic
1147218793 17:38916067-38916089 CAGGACAGACCCATTGAGGAGGG - Intronic
1147609282 17:41792196-41792218 CATGGCAGCCCCATGGAGAACGG - Intergenic
1147884486 17:43675595-43675617 CTGGGCAGGCCCAGGGAGGGTGG + Intergenic
1148109567 17:45136953-45136975 CAGGGCAGGAGCAGGGAGGAAGG + Intronic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1148289823 17:46435168-46435190 GAGGGCAGGGACATGGAGAGAGG - Intergenic
1148311991 17:46652740-46652762 GAGGGCAGGGACATGGAGAGAGG - Intronic
1148520139 17:48265837-48265859 CAGGGGAGGCATTTGGAGCATGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148748415 17:49931155-49931177 CTGGGCTGGCACCTGGGGGAGGG + Intergenic
1149010427 17:51850975-51850997 CAGGGCAGGCACTGGGAAGAAGG - Intronic
1150664471 17:67119459-67119481 CAGGGCTGGGAGCTGGAGGATGG + Intronic
1150833080 17:68541047-68541069 CAGGGCAGGATCAGGGAGGCAGG - Intronic
1151315852 17:73322111-73322133 CAGGACACGCATGTGGAGGAGGG - Intergenic
1151361572 17:73592467-73592489 CAGGCCAACCACATGGAGGTGGG + Intronic
1152007928 17:77694144-77694166 CAGGGGAGGGACCTGGAGGGAGG + Intergenic
1152143127 17:78550301-78550323 GAGGACAGGCTCATGCAGGAAGG + Intronic
1152365593 17:79854568-79854590 CAGGGAAGGCTCACTGAGGAAGG + Intergenic
1152428243 17:80230572-80230594 CAGGCCAGGCTGGTGGAGGAAGG + Intronic
1152432543 17:80257316-80257338 CATGGCCGGCACTTGGAGGGAGG + Intergenic
1152465666 17:80464693-80464715 CAGGAGAGGAACCTGGAGGAGGG + Intergenic
1152526798 17:80892964-80892986 CAGGGCACGCACTTAGACGAAGG - Intronic
1152797802 17:82316559-82316581 CAGTTCAGGCACATGTAGGAGGG + Intronic
1152939878 17:83162783-83162805 CACGTAAGTCACATGGAGGAGGG + Intergenic
1153101389 18:1474160-1474182 CAGGGCAGGCAGGTAGGGGAAGG - Intergenic
1155035265 18:22020565-22020587 CAGCACAGGCACATGCTGGATGG - Intergenic
1155050835 18:22146497-22146519 CCGGGCAGGCACATGGGTGTGGG - Intergenic
1155067743 18:22282420-22282442 CAGGGCAGGCTCCTGGAGCTGGG + Intergenic
1156579512 18:38358876-38358898 CAGGGCAGGGATGTGGAAGATGG + Intergenic
1157208783 18:45723020-45723042 CTCGGGAGGCACTTGGAGGAAGG + Intergenic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1159779165 18:72641653-72641675 CAGGGCAAGGACATGAAGAATGG - Intergenic
1160231904 18:77055085-77055107 CTGGGCACGCACATCGTGGATGG + Intronic
1160240541 18:77119440-77119462 CATGGCAGGCACATGGTACATGG + Intronic
1160777425 19:862478-862500 GGGGGCGGGCACGTGGAGGAAGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162364206 19:10238122-10238144 CAGTGGAGGCCCAGGGAGGATGG - Intergenic
1162499081 19:11041207-11041229 CCGGGCTGGGACACGGAGGAGGG - Intronic
1162881621 19:13663975-13663997 CAGGGCAGCCCCATGCAGGATGG - Intergenic
1163453592 19:17393290-17393312 CTGAGTTGGCACATGGAGGAGGG + Intergenic
1164616029 19:29667223-29667245 CAGGGCAGGGCCTGGGAGGACGG - Intronic
1165020887 19:32923022-32923044 CAGGGCAGGCGGATGGAAGCTGG + Intronic
1165156452 19:33791825-33791847 CAGGGCAGGCCCAAGGAGAAGGG + Intergenic
1165158064 19:33799873-33799895 AAGTCCAGGCACATGGATGAGGG - Intronic
1165798410 19:38532668-38532690 CAGAGCTGCCACCTGGAGGAGGG + Exonic
1165824490 19:38698097-38698119 CAGAGCAGGCACACTGTGGAGGG + Intronic
1166085621 19:40472783-40472805 CTTGGCAGGTACCTGGAGGAGGG + Exonic
1166219509 19:41355428-41355450 CAGGGCAGGGACATGAGGGAAGG - Intronic
1166360976 19:42252942-42252964 GAGAGCAGGCACATGGAGAGAGG + Intronic
1166762816 19:45235374-45235396 CAGGGCGGAAAAATGGAGGAGGG + Intronic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1167896354 19:52585391-52585413 CAGGGCCGGCACGAGGAGGGAGG - Exonic
1168229928 19:55024385-55024407 GTGGGCAGGGACATGGAAGATGG - Intronic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925304888 2:2841018-2841040 CAGAGAAGGCATATGGAAGAGGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
925907533 2:8548164-8548186 CGGGGAGGGGACATGGAGGAAGG - Intergenic
926748473 2:16179785-16179807 CAGGGAAGGTTCCTGGAGGAGGG + Intergenic
927154320 2:20212875-20212897 CAGGGCAGGGCCAGGGTGGAGGG + Intronic
927515520 2:23669676-23669698 CAGGGCAGCCACACAGAGGGGGG - Intronic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
929588066 2:43128330-43128352 CAGAGTAGGGGCATGGAGGAAGG + Intergenic
929922134 2:46180199-46180221 AAGGGCATGTACATGGAGGTGGG + Intronic
930610460 2:53537265-53537287 CAGGGCAAGCTCATTGAGGAAGG + Intronic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931748095 2:65308134-65308156 CAGGGCAGCAGCAGGGAGGAAGG + Intergenic
932460376 2:71878473-71878495 CAGGGCAGGCACGTGGATAGTGG - Intergenic
932718815 2:74123513-74123535 CAGGGCAGGGGCGTGCAGGAGGG + Intergenic
933346573 2:81093522-81093544 CAAGACAGGCACCTGTAGGAAGG - Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934028774 2:88022720-88022742 CAGCGCAGTCACACGGTGGAAGG - Intergenic
934458054 2:94192126-94192148 CAGGACAGTCACATAAAGGAGGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934696613 2:96404845-96404867 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
934735528 2:96687974-96687996 CAGGGCAGGCACGCGGGGGTGGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935619238 2:105114151-105114173 AAAGGCAGGCACTTGGAGGGAGG - Intergenic
936034277 2:109098171-109098193 CAGAGCAGGCAGATTTAGGAAGG - Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936528343 2:113257593-113257615 CAGGGGAGGGAGATAGAGGATGG + Intronic
936567310 2:113591508-113591530 CAGGGCAGACTCCTGGAAGAGGG + Intergenic
937259243 2:120574884-120574906 CAGAGCAGACACCTGGATGAAGG - Intergenic
937866119 2:126752992-126753014 CGGGGCAGGGCCAGGGAGGAGGG - Intergenic
938236596 2:129710927-129710949 CTGAGCAGGCCCTTGGAGGAGGG - Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938609378 2:132931389-132931411 CAGCGCAGCCACATGGTAGAAGG - Intronic
939705177 2:145443980-145444002 CACAGCAGGCACACAGAGGAGGG + Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
942326255 2:174779294-174779316 CATGGCACACACCTGGAGGAAGG - Intergenic
943212182 2:184981106-184981128 CAGGGCAGGCAAATTCAGCAAGG + Intergenic
943345736 2:186734920-186734942 CAGGGCTGGCACCGGGAGCAGGG + Intronic
944677221 2:202043586-202043608 CAGGGCAGGCTCAAGGAGGGTGG + Intergenic
945321085 2:208424469-208424491 CAGGGCAGACCCATGAAGGCAGG - Intronic
945553179 2:211247041-211247063 CATTGCAGGGACATGGATGAAGG + Intergenic
945995440 2:216432368-216432390 CAGGGGACGTACATGGAGGAGGG - Intronic
946053181 2:216880717-216880739 CAGGCCAGGCTCCTGGAGGCAGG - Intergenic
946386506 2:219387410-219387432 CTGGGCAGGGACATGGGGGCGGG - Intronic
946484131 2:220084692-220084714 CAGGACAGGCACATAGAGAAAGG - Intergenic
947046693 2:225995133-225995155 AAGGAAAGGAACATGGAGGATGG + Intergenic
947162251 2:227226341-227226363 AAGGGGAGGCACATGGGGGTAGG + Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
947900457 2:233717393-233717415 CAAGGGAGGCATATGCAGGATGG - Intronic
948109532 2:235443682-235443704 CAGGGGAGGGACAAGAAGGAGGG - Intergenic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948533786 2:238631417-238631439 CATTGCAGGCACAGGGAGGGAGG + Intergenic
948790189 2:240372811-240372833 GAGGGCAGGGCCATGGAGGGTGG + Intergenic
948844710 2:240677502-240677524 GAGGGCAGGCCCAGGGAGGCGGG + Intronic
948849150 2:240697377-240697399 GAGGGCAGGCCCAGGGAGGCGGG - Intronic
1168866739 20:1093001-1093023 TAGGGCAGGAAGGTGGAGGAAGG + Intergenic
1168879482 20:1194418-1194440 GAGGGCAGGCCCAGGGAGAAAGG + Intergenic
1169043726 20:2518839-2518861 CAGGGGAGGGACCTGGTGGAAGG + Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1170519986 20:17175114-17175136 AAGGCAAGGAACATGGAGGATGG + Intergenic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171183845 20:23110931-23110953 AAAGGCAGGCACATTCAGGATGG - Intergenic
1171517313 20:25747716-25747738 CTGGGCAGGCACTGGGAGGGAGG + Intergenic
1172020676 20:31911575-31911597 CAGGGAAGGCGCAGTGAGGAAGG + Intronic
1173066564 20:39718685-39718707 CTTTGCAGGCACATGGAGAAGGG + Intergenic
1173174861 20:40756806-40756828 GGGGACAGGCAAATGGAGGAAGG - Intergenic
1173192327 20:40886174-40886196 ATGGGCAGGCACCTGGACGATGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174932678 20:54832773-54832795 CCAGGCAGTCACATGTAGGAAGG + Intergenic
1175435534 20:58944942-58944964 CACGGGAGCCACATGGAGGCGGG - Intergenic
1175783223 20:61696658-61696680 CAGGGCAGCCCCATGGACCATGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1176104495 20:63379545-63379567 CAGAGCAGGCACTGGGAGCAGGG - Intergenic
1176148064 20:63574183-63574205 CAGGGCAGGCAGCTCCAGGAGGG - Intronic
1176376581 21:6089684-6089706 CATGGCAGGCACAGGGTTGAGGG - Intergenic
1176567869 21:8396382-8396404 CAGGGCGGGCCCTCGGAGGAGGG - Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1178070343 21:28958430-28958452 CAGAGCAGACAAATGTAGGAAGG + Exonic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179488956 21:41728059-41728081 CAGGGCCGGCTCAGGAAGGAGGG - Intergenic
1179746894 21:43448560-43448582 CATGGCAGGCACAGGGTTGAGGG + Intergenic
1180713426 22:17855525-17855547 CAGGGCGGACGGATGGAGGAAGG + Intronic
1181407020 22:22692308-22692330 CAAGGCGGGCACTGGGAGGACGG + Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181537521 22:23554243-23554265 CTGGGCAGGCCCTTGGGGGATGG + Intergenic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1181718329 22:24752333-24752355 CATGGCAGGGACAAGGAGAAGGG - Intronic
1182426913 22:30278441-30278463 CAGGGCAGGAAGATGGAAGGTGG + Intergenic
1182814230 22:33145268-33145290 CACAGCAGGCACATGGTGGTAGG - Intergenic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183483320 22:38076470-38076492 CAGGGGTGGGACATGGAGGAGGG + Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1185299133 22:50070383-50070405 CAGGGCCTGCACAATGAGGAAGG - Intronic
1185394350 22:50579120-50579142 CAGGGCAGGACCTTGGAGGGAGG - Exonic
950872542 3:16242191-16242213 CAGCCCAGGCTCAGGGAGGAGGG + Intergenic
951597572 3:24334805-24334827 CAGGTCTGGCACATTCAGGATGG - Intronic
951811129 3:26701383-26701405 CAGGGGAGCCACATGGGGGGAGG - Intronic
953032894 3:39189598-39189620 CAGGCCAGGCACATAGAGAGAGG - Intronic
954107300 3:48416199-48416221 CAGACCAGACACATGGAGGCAGG + Intronic
954330447 3:49887201-49887223 AAGGGCAGGAACAAGGTGGAGGG + Exonic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954713845 3:52517457-52517479 CAGGGCAGGCCCGGGGAGGGGGG + Intronic
954781934 3:53068239-53068261 CAGGGCTGGTGCTTGGAGGAAGG - Intronic
955430418 3:58838317-58838339 CATGGCAGGCACATGGACCTAGG + Intronic
955918442 3:63929819-63929841 CAGGGCGGGCACAAGGCCGATGG + Intronic
956798779 3:72738827-72738849 CAGGGCAGGTGCCTGGAGGAGGG - Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
958481359 3:94649078-94649100 AAGGTCAGGAAAATGGAGGATGG + Intergenic
961534211 3:127559612-127559634 CAGGCCAGGCACGTTCAGGATGG + Intergenic
962292487 3:134148151-134148173 CAGGGGAGGAAGATGTAGGATGG - Intronic
962415795 3:135180581-135180603 CAGTGCAGGAAGATGGATGAGGG - Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
964026045 3:152076274-152076296 CAAGGCAGGCATAGGGAGAATGG + Intergenic
966442123 3:179957344-179957366 CAGGTAAGGCTCAGGGAGGAAGG + Intronic
966847980 3:184145184-184145206 CAGGCCCGGCAGTTGGAGGAAGG + Exonic
966932950 3:184687546-184687568 CAGGGCAGGGAAATGGAGCCTGG - Intergenic
967060559 3:185868714-185868736 GAGGTCAGGCACATGGAGCCTGG - Intergenic
967109008 3:186276720-186276742 CAGGGATAGCACATGCAGGAGGG - Intronic
967341735 3:188406164-188406186 CCGTGCAGGCACATGGCCGAGGG - Exonic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967540713 3:190664548-190664570 AAGGGCAGGTACATGGAAGCTGG + Intergenic
967826467 3:193881605-193881627 AAGGGCATCCACATGGAGGGTGG - Intergenic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
967938341 3:194747185-194747207 CAGGGCAGGCAAACGGAGCCCGG + Intergenic
967961367 3:194927926-194927948 GAGGGCAGTGAGATGGAGGAGGG - Intergenic
968143043 3:196274143-196274165 CAGAGCAGGCACCAGGAGCAAGG + Intronic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
968456116 4:700885-700907 CAGGGCAGGGACGGAGAGGAGGG - Intergenic
968520347 4:1032227-1032249 CAGGGCAGGGGCATAGATGAAGG - Intergenic
968601481 4:1512007-1512029 CAGAGCGGGCATAGGGAGGAAGG + Intergenic
968915946 4:3497139-3497161 GAGGGCAGGCTGCTGGAGGATGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969489485 4:7490994-7491016 CAGGGCAGGGACAGAGAGGAGGG - Intronic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
970479603 4:16459711-16459733 CAGGGCAGCAACTTGTAGGAAGG + Intergenic
970599206 4:17627597-17627619 CTGGGCAGGAACATGGCGGCAGG - Exonic
971258482 4:25034672-25034694 AAGGGCAGGCAAGTGCAGGAGGG + Intergenic
971889995 4:32507705-32507727 CAGGGTAGGCACTTGGTGGGAGG - Intergenic
972568719 4:40291766-40291788 CGGGGAAGACACATGCAGGATGG - Intergenic
973644596 4:52937366-52937388 AAGAGCATGCACATGGATGAAGG + Intronic
974561610 4:63529780-63529802 CAGGGGAGGGACCTGGTGGAAGG - Intergenic
975714788 4:77195249-77195271 CAGGGAAGGCTCCTGCAGGATGG + Intronic
977523191 4:98111595-98111617 CAGGCCAGGCAGATGTAGAAGGG - Intronic
978332574 4:107630353-107630375 CAGGGGAGGAACCTGGTGGAAGG + Intronic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
984118080 4:175707211-175707233 CAGGGCAAGCCCATAGAGCAAGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985636982 5:1040716-1040738 CAGGCCTGGCACATGGTGGATGG + Intergenic
985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG + Intergenic
985767443 5:1787441-1787463 CAGGACAGGGATATGGAAGATGG - Intergenic
986177064 5:5361464-5361486 CAGGGCTGTGACATGGAGGCAGG + Intergenic
987574512 5:19707909-19707931 CATGGCATGCAGATGGAGAAGGG - Intronic
987638005 5:20570684-20570706 CAGGGCTGGCTCAAGGATGAAGG + Intronic
988774594 5:34466616-34466638 AAGGTCAGGAAAATGGAGGATGG - Intergenic
989709418 5:44378978-44379000 CAGAGAAGGCACATTGAGGCTGG - Intronic
991507674 5:67342433-67342455 CAGGGTAGCCACATAGAGAAGGG + Intergenic
991507832 5:67343299-67343321 CAGGGCAGCCACATACAGAAGGG - Intergenic
991628452 5:68629408-68629430 GAGGGCAGGCATATGTAAGAGGG - Intergenic
994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG + Intronic
994411651 5:99414138-99414160 CAGTACACTCACATGGAGGAAGG + Intergenic
994482174 5:100351112-100351134 CAGTACACTCACATGGAGGAAGG - Intergenic
995751390 5:115456680-115456702 CAGGGCAGGCTCTAAGAGGAAGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
996915508 5:128707532-128707554 CAGGGAAGGGATCTGGAGGAAGG - Intronic
997376815 5:133403417-133403439 CAGGGCAGGCACTTTGGGGTAGG - Intronic
997613273 5:135229939-135229961 CAGGGCAGGATGAGGGAGGAAGG - Intronic
999262083 5:150244601-150244623 CAGGGCAGGCCCTTGGAGCCGGG + Intronic
999904791 5:156128582-156128604 CAAGGTAGGGACCTGGAGGAAGG + Intronic
1001486487 5:172123204-172123226 CAGGGCAGGCATCTGCAGGAAGG + Intronic
1002306670 5:178287626-178287648 CAGGGCAGGAAGATGCAGGGAGG - Intronic
1003091687 6:3109245-3109267 CAGTGCAGGCTCATGGAAGGAGG + Intronic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1003922448 6:10846086-10846108 CAGGGCAGGTAGATGCTGGACGG - Intronic
1004454746 6:15782040-15782062 TTGGGCAGGCCTATGGAGGAGGG - Intergenic
1004473279 6:15947868-15947890 CAGGAGAGGCACAGGAAGGAGGG + Intergenic
1004630263 6:17414382-17414404 GAGGGGAGGAACTTGGAGGACGG - Intronic
1005083465 6:21980660-21980682 CAGAGCAGGAACACGGAGGTAGG - Intergenic
1005842359 6:29752167-29752189 TAGAGCTGGCACAGGGAGGAAGG - Intergenic
1006189421 6:32198522-32198544 CAGAGCTGGCACGTGGAGGGTGG + Exonic
1006286026 6:33094960-33094982 CAGGGCAGGAACATGGGGTGAGG + Intergenic
1006334805 6:33414963-33414985 CAGGGCAGGGCCCTGGGGGAGGG + Exonic
1006520045 6:34565976-34565998 CAGGGCAGGCCCAGGCAGGCAGG - Intergenic
1006799123 6:36748286-36748308 CAGGGGAGTCACCTGGAGGGAGG + Intronic
1007301762 6:40873021-40873043 AAAGCCAGGCACATGGAGGCAGG + Intergenic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1008919857 6:56831502-56831524 CAGGGCTGGCATTTGAAGGAAGG - Intronic
1011629691 6:89311711-89311733 CAGGGCCTGCACAGGGAGGAGGG - Intronic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1012677281 6:102132553-102132575 CAGGACAGAGACATGGAGAAAGG + Intergenic
1013094260 6:106930000-106930022 AAGGGCAGGCACAGGGAGTCTGG - Intergenic
1013258070 6:108409429-108409451 GATGGCAGGCACAGGGAGGAAGG + Intronic
1015318636 6:131846364-131846386 GAAGGCAGGCACATGGAAGGTGG - Intronic
1015604363 6:134939915-134939937 CTTTGCAGGCACATGGATGAAGG + Intronic
1016868978 6:148798141-148798163 CCGAGCAGGCACATGATGGAGGG + Intronic
1018638470 6:165885451-165885473 CAGGGGAGGCACCTGGCGGGAGG - Intronic
1018700357 6:166421531-166421553 CAGGGCTGGCCTATGGAGGCTGG - Intronic
1018829213 6:167429690-167429712 CATGGCAAGCACATAGTGGATGG - Intergenic
1018838493 6:167502539-167502561 CAGGGCAGGCCCAGGGTGGAGGG - Intergenic
1019329455 7:455467-455489 CAGGCCTGGCACAGGGAGGAGGG - Intergenic
1019406360 7:886172-886194 CCGGGCAGGCAAGTGGAGGTGGG + Intronic
1019479785 7:1261224-1261246 CAGGGGACGGACAGGGAGGATGG + Intergenic
1020240614 7:6391774-6391796 CCCTGCAGGCACAAGGAGGAAGG - Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1021911525 7:25390061-25390083 CAGAGGAGGCACCTGGAGGCAGG - Intergenic
1022423533 7:30246336-30246358 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
1023765698 7:43508519-43508541 AAGGGCAAGCCCATGTAGGAAGG + Intronic
1023874243 7:44278155-44278177 CAGGACAGCTTCATGGAGGAGGG + Intronic
1024045436 7:45582553-45582575 CAGGGCAGGCACCTGGCGGGGGG + Intronic
1024553580 7:50584128-50584150 CAGGCCAGGCACAAGCAAGAGGG - Intergenic
1025264967 7:57449372-57449394 CAGGGCAGGCACCGGGTGGGAGG - Intergenic
1025610142 7:63070879-63070901 CTGGGCAGGCACTGGGAGGTAGG - Intergenic
1025709267 7:63891930-63891952 CTGGGCAGGCACTGGGAGGGAGG + Intergenic
1026012113 7:66644652-66644674 CAGGGGAGGGACCTGGAGGGAGG - Intronic
1026229548 7:68471062-68471084 CAAGGAAGGCACCTGGAGGCGGG - Intergenic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026856747 7:73760134-73760156 GAGGGCTGGCACAAGGAGGCTGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1028035214 7:85972842-85972864 CAGAGCAGGCACCAGGAGCAAGG + Intergenic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029270598 7:99374815-99374837 CAGGGGAGCCACCTGGAGGTGGG + Intronic
1029403900 7:100361755-100361777 GAGGGGAGGAACATGGAGTAGGG + Intronic
1031265224 7:119572582-119572604 CAGAGCAGGCACTAGGAGCAGGG - Intergenic
1031790270 7:126093626-126093648 CATGGCAAGGACATGGTGGAAGG - Intergenic
1032481186 7:132248497-132248519 GAGGTCAGTCAAATGGAGGAGGG + Intronic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035083767 7:156238929-156238951 CAGGGCTGGACCATGGAGGCGGG - Intergenic
1035275446 7:157745471-157745493 CAGGGCAGGCTCAGGGAGGCAGG + Intronic
1035591017 8:813654-813676 CAGAGCAGGCCCCTGGAGGAGGG - Intergenic
1035918070 8:3646785-3646807 CAGGGCTGGAACAATGAGGAAGG - Intronic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1037319853 8:17632026-17632048 CAGGGATGGCACGCGGAGGATGG - Intronic
1037325063 8:17680820-17680842 CTGAGCAGACACATGAAGGAAGG + Intronic
1037602124 8:20406099-20406121 CAAGCCAGGCAGATAGAGGAGGG - Intergenic
1037648310 8:20813852-20813874 TAGGACAGGAATATGGAGGATGG - Intergenic
1037709960 8:21347637-21347659 CAGGGGAGGGACATGGGGGAGGG + Intergenic
1038228703 8:25680869-25680891 CAGGGCAGGAGCAATGAGGATGG + Intergenic
1038415258 8:27390211-27390233 TGGGGCAGGTGCATGGAGGAAGG + Intronic
1038490232 8:27965434-27965456 CAGAGCAGGCACATAGAGGGAGG - Intronic
1039412686 8:37368506-37368528 CAAAGCAGAAACATGGAGGAGGG + Intergenic
1040565133 8:48558170-48558192 CAGGGAAGGCACAGGCAGGGTGG - Intergenic
1040997558 8:53417476-53417498 CAGAGCTGGGACATGGAGGATGG + Intergenic
1041376898 8:57214922-57214944 AAGGGCAGGCACCTGATGGATGG - Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1041929165 8:63268207-63268229 CAGGGTAAGCACATGTAGTATGG - Intergenic
1041985977 8:63922996-63923018 CAGGCCAGTCCCATTGAGGAAGG + Intergenic
1045107358 8:98905842-98905864 CAGCGCAGCCACATGGTAGAAGG + Intronic
1047480104 8:125273953-125273975 CAGAGGAGGCACCTGGAGGAGGG - Intronic
1047513732 8:125535556-125535578 CAGGGCAAGCCCATTAAGGATGG + Intergenic
1047537172 8:125730345-125730367 CAGGGCAGGGACCTGGAAGATGG - Intergenic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1048034670 8:130666161-130666183 CAGGACAGACACCTGGAGGCGGG - Intergenic
1048839221 8:138550242-138550264 CAGGGGAGGCACCTGGTGGAAGG + Intergenic
1049203551 8:141353050-141353072 CAGGGCAAGGACGTGGAGGTGGG - Intergenic
1049667601 8:143853433-143853455 CAGAGCAGCGACCTGGAGGAGGG + Intergenic
1049769595 8:144373799-144373821 CCGGGCAGGCACCTGCCGGAAGG - Intronic
1049818695 8:144621110-144621132 CAGGGCAGGCAGCTGCAGGCTGG - Intergenic
1049822124 8:144641831-144641853 CAGTGCAGCCACGAGGAGGAGGG + Intergenic
1050150196 9:2612279-2612301 CAGGGCATCTACAAGGAGGATGG - Intergenic
1050213092 9:3287048-3287070 AAGGGGAGGCACATGGAGAATGG - Intronic
1050553562 9:6769742-6769764 AAGAGCAAGCACATGGAGAAAGG + Intronic
1051708176 9:19902340-19902362 CAAGGCAGGCAAATGGAAAAAGG + Intergenic
1051861410 9:21628992-21629014 CAAGGCAGGCAAAAGAAGGAGGG + Intergenic
1052522339 9:29563735-29563757 CAGGGGAGGAACTTGGTGGAAGG + Intergenic
1052560740 9:30079682-30079704 AGGGGCAGGCAAATGGAGAATGG - Intergenic
1052864985 9:33459455-33459477 CAAGGCAGGCACATCCATGAGGG + Intergenic
1052992185 9:34525231-34525253 CAGGGGAGGGAAATGGAGGCAGG - Intergenic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1054937196 9:70700388-70700410 CAGGGCAGGACCCTGGAAGATGG + Intronic
1056827025 9:89883598-89883620 CAGGGCAGGGAGGTGGAGGGAGG - Intergenic
1056858637 9:90158839-90158861 CAGGCCAGGAGCAGGGAGGAGGG - Intergenic
1056889950 9:90482635-90482657 CAGGTCTGGCAGATGTAGGAAGG + Intergenic
1056896882 9:90559372-90559394 CAGGGCAGGGCCATAGGGGAGGG - Intergenic
1056956833 9:91089351-91089373 CAGGGCATCCACTTAGAGGAAGG - Intergenic
1057076159 9:92139171-92139193 CAGGGAAGGCATATGGAGAAAGG + Intergenic
1057275662 9:93674866-93674888 CAGGGCAGGTCCACGGAGGAGGG - Intronic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1059642641 9:116232651-116232673 CAGTGCCTGCACATTGAGGATGG + Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060212172 9:121717291-121717313 CAGGGCAGGTACAGACAGGATGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060789973 9:126479316-126479338 CAGGTCAGGCAGATGGTGGTGGG + Intronic
1061377602 9:130235499-130235521 AAGGGCAGGACGATGGAGGAAGG - Exonic
1062032168 9:134366587-134366609 CAGGGCTGGGGCAGGGAGGAAGG + Intronic
1062067032 9:134534087-134534109 CACCGCAGGCCCAGGGAGGAGGG - Intergenic
1062074307 9:134576065-134576087 CAGGGGAGGCCCAGGCAGGAAGG + Intergenic
1062253540 9:135609930-135609952 CAGGCCAGACGCATGGAAGAGGG - Intergenic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1185818580 X:3180271-3180293 CAAGGAAGGCTCTTGGAGGATGG + Intergenic
1186409700 X:9336021-9336043 CACGGCAGGCACATGGGGCCAGG + Intergenic
1187630884 X:21170451-21170473 GAGGGCTGGGAAATGGAGGAAGG - Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1191807487 X:65150467-65150489 CAGGGAAGGAACTTAGAGGATGG - Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192429698 X:71103617-71103639 AAAGGCAGAGACATGGAGGAGGG + Intergenic
1193057866 X:77173881-77173903 CAGGGGAGGGACTTGGTGGAAGG - Intergenic
1193911147 X:87308743-87308765 CAGGGCTGGGACCTGGAGGGAGG - Intergenic
1193980502 X:88176214-88176236 CTGGGCAGGCACCTGGAAGCAGG - Intergenic
1194683862 X:96887346-96887368 CAGGGCAGGACCTTGGAGAAAGG - Intronic
1195940167 X:110161342-110161364 CAGGGAAGCCTCATGGAAGAGGG - Intronic
1195966378 X:110433475-110433497 AAGGGCAGGGAGATGGGGGAAGG + Intronic
1196288703 X:113914299-113914321 TCTGGCAGGCACAGGGAGGAAGG + Intergenic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1197627832 X:128822661-128822683 TTGGGCAGGCACAGGGAGAAGGG + Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic