ID: 947874501

View in Genome Browser
Species Human (GRCh38)
Location 2:233459394-233459416
Sequence TGCCATCTGCTCTTTTCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947874501 Original CRISPR TGCCATCTGCTCTTTTCTAG GGG Intronic
900735258 1:4295645-4295667 ACCCAGCTGCTCTTTTCGAGGGG - Intergenic
900822238 1:4898681-4898703 TGCCATTTGCTCTCTGCTTGTGG + Intergenic
901262502 1:7884608-7884630 CAACATCTGATCTTTTCTAGTGG + Intergenic
912010790 1:104959047-104959069 AGGCATCAGCTCCTTTCTAGTGG + Intergenic
914879836 1:151538816-151538838 TCCCATCTGCTCTGTTCTAAAGG - Intergenic
918401851 1:184171455-184171477 TGGCATCTGATCTTTTCTTCAGG - Intergenic
918403400 1:184187600-184187622 AGCTTTCTTCTCTTTTCTAGTGG - Intergenic
918925330 1:190778243-190778265 TGCCATTTTCTCTTTTCTTTCGG + Intergenic
920123900 1:203678369-203678391 TGGCAGCTCCTCATTTCTAGAGG + Intronic
921665508 1:217866042-217866064 TGCCATCGTCTTTTTTCCAGAGG + Intronic
922424254 1:225478889-225478911 TGCCATCTCCTCTCTTTTTGGGG - Intergenic
924218908 1:241853585-241853607 TGACATCTGCCCTTTACTTGAGG - Intronic
1064718548 10:18203733-18203755 TTCCCTCTGCTTTTTGCTAGTGG + Intronic
1067264698 10:44729507-44729529 TGCTATATGCTCTTTTCAGGAGG - Intergenic
1068660236 10:59615846-59615868 TGCCATATACACTATTCTAGAGG + Intergenic
1073908209 10:108309036-108309058 TCCTGTCTGCTCTATTCTAGTGG - Intergenic
1074209789 10:111319978-111320000 TGCCCTCTGCCCTGTACTAGTGG - Intergenic
1077955251 11:7012181-7012203 AGCCCTCTGCTCTGTTCTACTGG - Intronic
1081926671 11:46835313-46835335 TGCCGTCTGCTCCTTGCTAGTGG - Intronic
1084400920 11:68942441-68942463 TGCCATGTGCTCCTTTCCGGGGG + Intergenic
1084902625 11:72321230-72321252 TGCCTTCTCTTCTTCTCTAGTGG - Intronic
1088899795 11:114106771-114106793 TCCCATCTTCTCTTTTCTGATGG + Intronic
1088998163 11:115021873-115021895 TGCCATCAGTTCTTTTTCAGGGG - Intergenic
1092231954 12:6780905-6780927 TGCCCTTTGCTCTTCTCTAAGGG - Intergenic
1094665955 12:32521084-32521106 TGCAATGTCCTTTTTTCTAGAGG - Intronic
1101671227 12:106875487-106875509 TGCTCTCTCCCCTTTTCTAGAGG - Intronic
1102843446 12:116151533-116151555 TCCCATCTGCATTTTTCTAAAGG - Intronic
1103713243 12:122928680-122928702 TGCCACCTGTTCTTTTCCATCGG - Intronic
1107115817 13:36744058-36744080 TTGCATCAGCTCTTTTCCAGAGG + Intergenic
1108735698 13:53281509-53281531 TGCCATGTGGTCATATCTAGAGG + Intergenic
1109879114 13:68448177-68448199 TGCCTTCTTTTCTTTTCTATAGG - Intergenic
1110190311 13:72722756-72722778 TCCCATCTGCTCCTTTCTTTTGG + Intronic
1116767617 14:49091756-49091778 TGCCCTCCTCTCTTTTCCAGTGG - Intergenic
1117174987 14:53136590-53136612 TTCCACCTGCTCCTTTCCAGTGG - Intronic
1117621943 14:57596532-57596554 TGCCTTCTCCTCTTTTCTCAGGG + Intronic
1117773008 14:59153384-59153406 TGCCGCCTGCTCTCTTCTGGGGG - Intergenic
1119414834 14:74462925-74462947 TCCCTTCTGCTGTTTTCTACTGG + Intergenic
1120940880 14:89948017-89948039 TGCCATCTTCTCTTTTCAGTAGG + Intronic
1122401221 14:101468733-101468755 TCCCATCAGCACTTTTTTAGGGG - Intergenic
1125194237 15:37028484-37028506 TGCAATTTTCTCTCTTCTAGAGG + Intronic
1125426682 15:39555984-39556006 TGCTATCTGCCCTTCTCAAGCGG - Intergenic
1125797105 15:42411020-42411042 TGCCCTCTGCTCTCTTGCAGGGG + Intronic
1125917551 15:43502755-43502777 TGCCATTTGTTTTTTTCTTGAGG + Intronic
1127959084 15:63877828-63877850 TGTGCTCTGCTCATTTCTAGAGG - Intergenic
1130993154 15:88888843-88888865 TGGCATCTGCACCTTTGTAGTGG - Intronic
1131599397 15:93831130-93831152 TGCAATGAGCTCTTTTGTAGAGG + Intergenic
1131685540 15:94763677-94763699 TGCCCTCTGCCCCTTTTTAGGGG - Intergenic
1132203126 15:99968760-99968782 TGCCACCTGCTCTCTGCCAGCGG - Intergenic
1133965729 16:10530409-10530431 TGCCATCAGCTCAGTTCCAGTGG - Exonic
1134826507 16:17288680-17288702 TGCCATTTGCTCTCTACTGGAGG + Intronic
1139993438 16:70958410-70958432 AGCCACCAGCTCTGTTCTAGTGG - Intronic
1144628387 17:16857182-16857204 TGGCATCGGCCCTTTTATAGAGG - Intergenic
1144654906 17:17029227-17029249 TGACATCGGCCCTTTTATAGAGG + Intergenic
1144752324 17:17657755-17657777 TGGCCTCTGCTCTTTCCTTGGGG + Intergenic
1145159978 17:20567753-20567775 TGGCATCGGCCCTTTTATAGAGG - Intergenic
1149586205 17:57788965-57788987 TCCCATCTGCCCATTTATAGGGG + Intergenic
1150513019 17:65776183-65776205 TACCATCTGCTCTATTCAAAGGG + Intronic
1150639896 17:66942502-66942524 AGCCATCAGCTCTTGTCTGGAGG + Intergenic
1153099621 18:1451722-1451744 TTCCCTCTGCTTTTCTCTAGCGG - Intergenic
1153183552 18:2462538-2462560 TGCGATTTGCTCTTTTCTATAGG + Intergenic
1153531033 18:6045967-6045989 TTCCATCTGCTCTCTTCAAGAGG + Intronic
1155354810 18:24941951-24941973 TGCCATCTTTTCTTTTTTGGTGG - Intergenic
1155552340 18:26978067-26978089 AGACATCTGCTCTTTTCCTGTGG + Intronic
1157979942 18:52368081-52368103 TTAAATCTGCTCTTGTCTAGAGG + Intronic
1159008565 18:63036849-63036871 AGCCAAAAGCTCTTTTCTAGGGG + Intergenic
1159489181 18:69107546-69107568 TGCCATCTGTTCGTTTCATGGGG + Intergenic
1159991080 18:74908501-74908523 TGCTGTCTGTTCTGTTCTAGTGG + Intronic
1160130370 18:76219797-76219819 TGCCATCTTCTATTTTTTAGTGG - Intergenic
1163085592 19:14977462-14977484 TGCTGTCTGCTCTTCTCCAGGGG - Intronic
1163289881 19:16372400-16372422 TGCCATCTCTTGTGTTCTAGAGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1164598772 19:29547489-29547511 TGACATCTGCTCTTGACTAGAGG + Intronic
1164696441 19:30248101-30248123 TGTCTTCTGCTATTTTCTATTGG - Intronic
927840627 2:26440673-26440695 TGCTATGTACTCTTTTCTTGGGG - Intronic
929392735 2:41489982-41490004 TGCCATGTGGACCTTTCTAGAGG + Intergenic
929801307 2:45105559-45105581 TGGGATCTGCTCCTTTCTGGAGG - Intergenic
931293471 2:60898425-60898447 TTTCCACTGCTCTTTTCTAGGGG + Intronic
933615920 2:84482509-84482531 TGCAAACTGCTCCCTTCTAGAGG + Intergenic
935342939 2:102074217-102074239 AACCATCTTCTCTTTTCTCGTGG + Intronic
939429125 2:142080342-142080364 AGCCATCTTTTCTTTTCTATTGG - Intronic
941187699 2:162337503-162337525 TGCCATCTGCTTTTTTCTGGTGG + Intronic
943361997 2:186930957-186930979 TTCCATCTTCTCCTTTCTACCGG + Intergenic
944139758 2:196443137-196443159 TGCCATCTCCTCTTCTCTGTAGG - Intronic
944329064 2:198443644-198443666 TGCTATCTACTCTTTACTACAGG - Intronic
947874501 2:233459394-233459416 TGCCATCTGCTCTTTTCTAGGGG + Intronic
1169923721 20:10761315-10761337 GGCCATCTGCTCTTATCAACAGG - Intergenic
1170864162 20:20138149-20138171 TCCCCTCTCCTCTTTTCAAGTGG + Intronic
1171063618 20:21991543-21991565 TCTCATCTGATCTTCTCTAGTGG - Intergenic
1172789444 20:37492564-37492586 TGCCTTCTGCTATATTCTATTGG + Intronic
1172971598 20:38877235-38877257 TGCCCTCTGATCTTTTCTTTAGG + Intronic
1173173824 20:40748842-40748864 TCCCCTCTGCTCCTTTCTGGTGG - Intergenic
1174402197 20:50282159-50282181 TGCCCTCAGCCCTTTTCTGGAGG + Intergenic
1174756454 20:53163256-53163278 TGCCATATTCTGTTTACTAGAGG - Intronic
1175240961 20:57548549-57548571 TGCCTTCTTCACTTGTCTAGGGG - Intergenic
1176067540 20:63206204-63206226 TCCCATCTGCTCTTTTTGCGTGG - Intronic
1179156901 21:38858867-38858889 TGTCTTCTGCACTGTTCTAGGGG + Intergenic
1179165959 21:38935365-38935387 TCCCCACTGCCCTTTTCTAGTGG + Intergenic
1179389629 21:40975861-40975883 TGCCATGTGGTCTTCTCTATAGG + Intergenic
1179716772 21:43292437-43292459 TGCTATCAGCACTTTCCTAGAGG - Intergenic
1182802998 22:33046996-33047018 TGCCAGGTACTCTTTTCTACAGG + Intronic
1183455114 22:37918417-37918439 TCCCATCTGCTCTTTGCTGGAGG + Intronic
949656077 3:6221501-6221523 TGCCATCTTTTCTTTTTCAGTGG - Intergenic
950215727 3:11157119-11157141 TTCAATCAGCTGTTTTCTAGAGG + Intronic
950315957 3:12002591-12002613 TGCCTTCTTCACTTTTCTACTGG + Intergenic
950659686 3:14459477-14459499 TGCCCTCTGCTTGTTTCTTGGGG + Intronic
951263445 3:20539651-20539673 TGCTTTCTCCCCTTTTCTAGTGG + Intergenic
952667676 3:35926688-35926710 TGTCATTTGCCCTTTTTTAGTGG + Intergenic
956226211 3:66961944-66961966 AGCCATCTCCTCTTTTATATGGG + Intergenic
956357504 3:68410212-68410234 TCCCAACTGCTCTTTTCTCTTGG - Intronic
956358222 3:68417438-68417460 TGCCATGTGAGCTTTTCAAGAGG - Intronic
957402113 3:79729748-79729770 TGCCAGCCTTTCTTTTCTAGTGG - Intronic
961521800 3:127471334-127471356 TGCCACCTGCCCCTTTCCAGTGG + Intergenic
962425893 3:135269077-135269099 TGCCATCTGCTCTATTCTACAGG - Intergenic
963454909 3:145533399-145533421 TCCCATCCTCTCTTATCTAGTGG + Intergenic
964971365 3:162567221-162567243 TGCCATCTGCCCATTTTTTGTGG - Intergenic
966090352 3:176127982-176128004 TGTCACTTGCTCTATTCTAGTGG - Intergenic
969339410 4:6530840-6530862 TGCCATCTGGCCCTTTCTACAGG + Intronic
971414635 4:26413003-26413025 TGAAAACTGCTCTTTTCTATTGG + Intronic
971769958 4:30883201-30883223 TGTTATCTTCTCTTTTATAGAGG + Intronic
972271078 4:37511244-37511266 TTCCCTCTGCTCTTCTCAAGTGG + Intronic
972471845 4:39413128-39413150 TGTCATCTTCTCCTTTGTAGAGG + Intronic
975912369 4:79282131-79282153 TGCCATTCGTTCTTTTCTTGGGG - Intronic
976192756 4:82504197-82504219 TGCCATCTACTATTTTTTGGGGG + Intronic
976655494 4:87484414-87484436 AGCCATCTGCTCTGTTCCATTGG + Intronic
976837882 4:89396466-89396488 TCCCTTCTGCTCCTTTCTTGTGG + Intergenic
977052426 4:92145989-92146011 AGCCATCTGCTGTCTTCAAGAGG + Intergenic
980880239 4:138702625-138702647 AGCCATCTGCTGCTTTATAGTGG + Intergenic
980901561 4:138910117-138910139 TTCAAACTGCTCTTTTCTGGAGG - Intergenic
985697482 5:1348992-1349014 TGCCTGCTGCCCTTTCCTAGTGG + Intergenic
986608832 5:9547052-9547074 TACCATTTGCTCTTTTCGCGAGG - Intergenic
987377440 5:17249307-17249329 AGCCATCTGCTCCTCTCTTGGGG + Intronic
989464492 5:41739227-41739249 TCCCACCTGCTCTCATCTAGAGG + Intronic
989502561 5:42185794-42185816 TGCCTTCTGGTTTTTTCAAGAGG - Intergenic
990293073 5:54374657-54374679 TGCCATCAGGTCTTTTTTAGGGG + Intergenic
993679902 5:90863614-90863636 TGCCATGTCATCTTTTCCAGAGG + Intronic
993943136 5:94086008-94086030 TGCCTTCTGTTCTTTCCCAGTGG - Intronic
994047599 5:95327299-95327321 TTCTGTCTGCTCTTTTCTAATGG - Intergenic
994056105 5:95417664-95417686 AGCAATCAGTTCTTTTCTAGGGG + Intronic
994609039 5:102012405-102012427 TTCCATCTCTTCTTTGCTAGTGG + Intergenic
994865405 5:105262552-105262574 TGTCATCTCCTTTTTTTTAGTGG - Intergenic
995800396 5:115987881-115987903 TCCCATCTTCTCTTTTCTGGAGG + Exonic
996750045 5:126879176-126879198 TTCCATGTGTCCTTTTCTAGTGG - Intronic
999307541 5:150529919-150529941 TCCATTCTGCTCTTCTCTAGAGG - Intronic
1001416613 5:171549342-171549364 TGCCATCTGCGCTCTTCTGCTGG + Intergenic
1001962167 5:175886152-175886174 TGCCATCTTCTATTGGCTAGAGG + Intergenic
1003496221 6:6665823-6665845 TGCCATCTCCTCTTATGAAGGGG + Intergenic
1003676324 6:8207757-8207779 TGTCAGCTGATCATTTCTAGGGG + Intergenic
1004747597 6:18526747-18526769 TTCAATCTGCTCTTCTCTACTGG - Intergenic
1006384701 6:33723874-33723896 TTCCATCTGCTCCCTTCTGGTGG - Intronic
1011464079 6:87637247-87637269 GCCCATCTGTTCTTTTCTTGTGG - Intronic
1011790144 6:90890232-90890254 TGCCGTTTCCTCTTTTGTAGTGG + Intergenic
1011909101 6:92412285-92412307 TGCCATCTGGTCTTTTTCAGTGG - Intergenic
1012748515 6:103125740-103125762 TGCCATATGCTTTCTTCCAGTGG + Intergenic
1013965272 6:115948192-115948214 TGCCCTTTGCTCCTTGCTAGAGG - Intronic
1016790909 6:148065655-148065677 TGCCATCTGACTTTTTCTTGTGG - Intergenic
1017407059 6:154131134-154131156 GGACATCTTTTCTTTTCTAGTGG - Intronic
1018386392 6:163307901-163307923 TCCAATCTGGTCTTTTCTGGAGG - Intronic
1022702765 7:32777100-32777122 TCCCATCTGCTCTGTTTTGGAGG - Intergenic
1022727151 7:32991699-32991721 TGCCATCTGCTTTGTTCCATGGG + Intronic
1022906991 7:34867220-34867242 TCCCATCTGCTCTGTTTTGGAGG - Intronic
1023357938 7:39386247-39386269 TGCCACCTGCTCTCTTCTTCAGG + Intronic
1025046430 7:55695931-55695953 TGCCATCTGCTTTGTTCCATGGG - Intergenic
1026579895 7:71606497-71606519 TAGCATCTGCTCTTCTCTTGTGG + Intronic
1028655279 7:93198276-93198298 TAACATCTGCTCTGTTCTAAGGG + Intronic
1030473470 7:109998452-109998474 TGCAATCTGGTCTTTTTTAGTGG + Intergenic
1032752882 7:134859379-134859401 TGTCATTTGTTCTTCTCTAGTGG + Intronic
1033294865 7:140123158-140123180 TGCCTTCTATTCTATTCTAGTGG - Intronic
1034576613 7:152005345-152005367 AGCCACCTGCCCTTTTCTAAGGG + Intronic
1035140176 7:156751774-156751796 TGCCATCGGCCCTTCTCTACAGG - Intronic
1035293963 7:157857379-157857401 TGCCATCTCCTCCTCCCTAGGGG - Intronic
1037360114 8:18064092-18064114 TGACATCTGTCCTTTTCTTGAGG - Intronic
1037648481 8:20815425-20815447 TGCCATATTCTATTTGCTAGAGG - Intergenic
1038405110 8:27315854-27315876 TTCCATCTTTTCTTTTATAGTGG - Intronic
1038830534 8:31054081-31054103 TGCCATTTGCTTTTTTGTAGTGG + Intronic
1041228972 8:55730232-55730254 TGCCTTATGCTCTTTGCTAGTGG - Intronic
1041793415 8:61721704-61721726 CCCCTTCTGCTCTTTTCTAATGG + Intergenic
1042364041 8:67916049-67916071 TGCCAACTGCTTTTTTCTTTTGG + Intergenic
1043516070 8:80996243-80996265 TGCCACCTACTCTTCTTTAGGGG + Intronic
1044952870 8:97450829-97450851 TGCCATCTGCTTTGTTCTGTCGG - Intergenic
1045982671 8:108209840-108209862 TTCAAGCTGCTCTTTTATAGTGG - Intronic
1046359472 8:113131624-113131646 TCCCTTCTGCACTTTCCTAGCGG - Intronic
1050998657 9:12252535-12252557 TGGAATCTGCCATTTTCTAGAGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1055739029 9:79365299-79365321 TGCCATCTTCTCTCTTTTAAAGG - Intergenic
1057667733 9:97059281-97059303 TGCCATTTACTTTTTTCTACTGG - Intergenic
1058703962 9:107623755-107623777 TGCCACCTGCACTTTGCTAAGGG + Intergenic
1187185836 X:16984416-16984438 TCACTTCTGCTCTTTTCTATTGG + Intronic
1189068058 X:37832647-37832669 TTCTAGCTGCTCTTTTCCAGAGG - Intronic
1192416897 X:70989014-70989036 TGCCATCTGCTGTTTCCTGCGGG + Intergenic
1195373944 X:104207204-104207226 TACCATCTGCTGGTTTCTAATGG + Intergenic
1195938435 X:110146740-110146762 TGCCATCTGCTGTTCACTTGGGG + Intronic
1198986752 X:142463490-142463512 TGCTAACTGATCTTTTCTTGGGG + Intergenic
1199258495 X:145744469-145744491 TTCCCTCTCCTCTTTTCAAGTGG - Intergenic
1199549919 X:149048716-149048738 TTCCTTCTGCTATTTTCTGGAGG + Intergenic
1201783113 Y:17744641-17744663 TTCCATCTGATCTCTTTTAGAGG - Intergenic
1201818440 Y:18161346-18161368 TTCCATCTGATCTCTTTTAGAGG + Intergenic
1202342884 Y:23888093-23888115 TGCTATCTGATCTCTTGTAGAGG - Intergenic
1202527884 Y:25781992-25782014 TGCTATCTGATCTCTTGTAGAGG + Intergenic