ID: 947876008

View in Genome Browser
Species Human (GRCh38)
Location 2:233468728-233468750
Sequence CACCACAACCAGAGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947876002_947876008 5 Left 947876002 2:233468700-233468722 CCCTCATCTAGGCAGTGATGGCT 0: 1
1: 0
2: 0
3: 9
4: 134
Right 947876008 2:233468728-233468750 CACCACAACCAGAGGAAGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 218
947876003_947876008 4 Left 947876003 2:233468701-233468723 CCTCATCTAGGCAGTGATGGCTC 0: 1
1: 0
2: 0
3: 6
4: 114
Right 947876008 2:233468728-233468750 CACCACAACCAGAGGAAGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 218
947875999_947876008 27 Left 947875999 2:233468678-233468700 CCTCAGGTGGGGGCGGCTGTGGC 0: 1
1: 1
2: 3
3: 35
4: 332
Right 947876008 2:233468728-233468750 CACCACAACCAGAGGAAGCCAGG 0: 1
1: 0
2: 2
3: 23
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947876008 Original CRISPR CACCACAACCAGAGGAAGCC AGG Intronic
900708172 1:4093747-4093769 CACCACAATCCCAGGAAGCTGGG - Intergenic
901046021 1:6396122-6396144 CACCGCAAGCTGAGGGAGCCGGG + Intergenic
901226283 1:7614683-7614705 CACCACCCCCAGAGACAGCCCGG + Intronic
902360448 1:15939582-15939604 CACCACTCCTAGAGGAAGTCTGG - Exonic
902947468 1:19852256-19852278 GACCACCACCAGAGTAATCCTGG + Intergenic
903050052 1:20593968-20593990 CTGGACACCCAGAGGAAGCCTGG + Intronic
903723765 1:25425675-25425697 CACCACACCTGCAGGAAGCCTGG - Intronic
904954140 1:34268842-34268864 CACCTCTTCCAGAGGAAGCATGG + Intergenic
905069204 1:35210523-35210545 CACCCCAACAAGACCAAGCCTGG + Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906139862 1:43527652-43527674 AACTTCAACCACAGGAAGCCAGG + Intronic
906156981 1:43619631-43619653 CCCCACCCCCACAGGAAGCCTGG + Intronic
907751707 1:57269361-57269383 CACCCCAATCAGAAGAAGCTGGG + Intronic
908434664 1:64093301-64093323 CCCCAGAGCCAGAGGCAGCCTGG - Intronic
909548308 1:76870859-76870881 CACCACAAGCAAAGGAAGAAAGG + Intronic
909666906 1:78144314-78144336 CACCTTAACCAGAAGAAGCTTGG - Intergenic
909994151 1:82258650-82258672 CACCACAACCAGCCAATGCCTGG - Intergenic
912831939 1:112960392-112960414 CATCAGAACCAGAGAAGGCCTGG + Intergenic
914136863 1:144909180-144909202 AACCAAAACCAGAGTGAGCCAGG + Intronic
914505921 1:148288653-148288675 GACCACGACTAGGGGAAGCCCGG + Intergenic
915611695 1:156998860-156998882 CAAGACATCAAGAGGAAGCCAGG + Intronic
915730215 1:158048130-158048152 CACCAACATCAGAGGAACCCAGG - Intronic
916584649 1:166139945-166139967 TACCACCACCAGAGGAACCTTGG + Intronic
917808881 1:178638414-178638436 CAACAAGGCCAGAGGAAGCCAGG - Intergenic
918011848 1:180594064-180594086 CAACAAAACCAGAAGAAGGCTGG - Intergenic
920699781 1:208209164-208209186 CATGAGAACCAGAAGAAGCCTGG + Intronic
922853222 1:228752097-228752119 CACCAGGACCCCAGGAAGCCAGG + Intergenic
1062919693 10:1270644-1270666 CACCCCAACCAGAGGAACTTAGG + Intronic
1063980213 10:11446472-11446494 CACCCCAGACAGAGGAAGCGTGG - Intergenic
1064627932 10:17280673-17280695 CTCCACCACCAGAAGAAGCAGGG - Intergenic
1065665860 10:28059717-28059739 CACCAGAGCAAGAAGAAGCCAGG - Exonic
1066616404 10:37299359-37299381 GACCACAAGCAAGGGAAGCCTGG + Intronic
1067347606 10:45447828-45447850 CAGCACAAACAGAGTAAGACAGG - Intergenic
1068934872 10:62625740-62625762 CTCCAGAGCCAGTGGAAGCCAGG + Intronic
1071378964 10:85038545-85038567 AACCACTGCCAGTGGAAGCCAGG - Intergenic
1071602087 10:86963260-86963282 CACAGCACCCAGAGGAAGCATGG - Exonic
1073755744 10:106578931-106578953 CATCCCAATCAGAGGAAGCAGGG + Intronic
1074411658 10:113234034-113234056 CACCAGGAGCAGAGGCAGCCAGG - Intergenic
1075312657 10:121427787-121427809 CACCTCAACCAAAAGAAGCCTGG - Intergenic
1075886236 10:125901728-125901750 CACCACCACTTTAGGAAGCCAGG - Intronic
1076765946 10:132633137-132633159 CACCACCACAAAAGGCAGCCAGG - Intronic
1076886102 10:133263181-133263203 CCCCCCATCCAGAGGAAGCAAGG - Exonic
1077141563 11:1027075-1027097 CAGGACACTCAGAGGAAGCCGGG + Intronic
1077243038 11:1521284-1521306 CAGCACAAGCAGAGGAAAACTGG + Intergenic
1081862144 11:46339380-46339402 GACCACGGCCAGAGGAAGCCTGG + Intronic
1083048606 11:59757196-59757218 CACCACCAGGAGAGGAACCCAGG + Intronic
1084431242 11:69112527-69112549 CACCAGAGCCTGAGGGAGCCAGG - Intergenic
1084643972 11:70443676-70443698 CACCACAGCCTCTGGAAGCCGGG + Intergenic
1084657717 11:70528828-70528850 CACAGCACCCAGAGGAACCCAGG + Intronic
1085737687 11:79053655-79053677 TCCCACCATCAGAGGAAGCCAGG + Intronic
1086963348 11:93002757-93002779 CACCACAGGCAGAACAAGCCTGG + Intergenic
1087977309 11:104565328-104565350 CCCCGCAAGCAGAGGGAGCCGGG + Intergenic
1089287334 11:117415992-117416014 TACCACAGCCAGAGGAAGACAGG + Intergenic
1089340564 11:117754581-117754603 CACCACCAGCAGAAGAAGCAAGG + Intronic
1089582411 11:119489596-119489618 GACGACAAGCAGAGGAACCCTGG - Intergenic
1091101255 11:132875839-132875861 CAAAACAACCAGAGGAACCCAGG - Intronic
1091783014 12:3225680-3225702 CTCCACAATAACAGGAAGCCAGG + Intronic
1092214501 12:6671634-6671656 CATCACATCCACAAGAAGCCGGG + Intronic
1094413087 12:30189045-30189067 CACCACTACCAGTAGAGGCCTGG + Intergenic
1101509279 12:105378321-105378343 CACAATAGCCAGAGGAAGACTGG + Intronic
1102113671 12:110384407-110384429 AACCAAAACCAAAGGAGGCCGGG + Intronic
1104965069 12:132505315-132505337 CACCACACCCCAAGGATGCCTGG - Intronic
1113058836 13:106299216-106299238 CACCACATCCTGAGGAGCCCGGG + Intergenic
1114473355 14:22978685-22978707 CACCACTACCTAAGGAAACCTGG + Intronic
1114673925 14:24428986-24429008 CACCAGAACCAAGGGCAGCCCGG + Exonic
1115376953 14:32686863-32686885 ATCCACAGCCAGAGGAAGTCAGG - Intronic
1116862038 14:50002819-50002841 CATCCCAACTAGAGGAAGCAAGG - Intronic
1119479889 14:74952585-74952607 CACCACAGCCAGAGACAGCATGG - Intronic
1121321646 14:92995059-92995081 CACCACCACCACTGGGAGCCGGG + Intronic
1121498597 14:94415489-94415511 CACCCCTACAAGAGGAAGGCTGG + Intergenic
1122174461 14:99906808-99906830 CAGCACGTCCTGAGGAAGCCTGG - Intronic
1122850017 14:104523026-104523048 CATCCCAAGCACAGGAAGCCAGG + Intronic
1122959682 14:105088633-105088655 CACAACCACCAGAGACAGCCCGG + Intergenic
1202871843 14_GL000225v1_random:172188-172210 CACCACCACTTTAGGAAGCCAGG + Intergenic
1124463419 15:29914394-29914416 CACCCCCACCTCAGGAAGCCTGG + Intronic
1129681032 15:77658406-77658428 CACCAGCACCAGAGCATGCCTGG - Intronic
1130580656 15:85134508-85134530 CACCACAGCCAGCGGATGCTGGG + Intronic
1130714143 15:86314994-86315016 CACCACAACCTTAGGAAGGTGGG - Intronic
1132627180 16:897032-897054 CACCAGACCCAAAGGGAGCCGGG + Intronic
1134220671 16:12351312-12351334 CCCCACAACCAGAGTAAACTGGG + Intronic
1135191241 16:20356451-20356473 GTCCACAACCAGAGGAAGCAGGG - Intergenic
1135328992 16:21545678-21545700 CTCCACAGCCAGAGGAAACCTGG - Intergenic
1136339337 16:29631655-29631677 CTCCACAGCCAGAGGAAACCTGG - Intergenic
1137985505 16:53104048-53104070 CTCCACGACCAGAGCAAACCAGG - Intronic
1138330956 16:56214869-56214891 CACCGGACCCAGAGGAAGGCTGG - Intronic
1139743323 16:69054283-69054305 CTCCCCAACCAGCAGAAGCCTGG - Intronic
1140039472 16:71396612-71396634 CACCAAGGCCAGAGGTAGCCTGG + Intergenic
1141704818 16:85658922-85658944 CACCGCAGCCAGGGGAGGCCAGG - Intronic
1141889874 16:86919386-86919408 CACCACATCCTGAGGCTGCCTGG - Intergenic
1142042005 16:87900242-87900264 CTCCACAGCCAGAGGAAACCTGG - Intronic
1143363155 17:6387755-6387777 GGCCACAGCCAGAGGGAGCCTGG + Intergenic
1144409669 17:14988462-14988484 CACAACAACCAAAGGAACCAAGG + Intergenic
1144745370 17:17610437-17610459 CAACACAAACAAAGGAAGACAGG - Intergenic
1146057896 17:29590014-29590036 CACCCCAACCAGAGATAGACGGG - Intronic
1147120986 17:38334958-38334980 AACCAGAACAAGAGGAACCCTGG + Intronic
1147363942 17:39948080-39948102 CATCAAAGCCAGAGGAACCCGGG + Intergenic
1148149230 17:45386383-45386405 CGGCACCACCAGGGGAAGCCAGG + Intergenic
1150037956 17:61824983-61825005 CAGCACAAGAAAAGGAAGCCCGG + Intronic
1152861488 17:82698878-82698900 CACCACAGCCAATGGAGGCCCGG + Intergenic
1153727732 18:7974669-7974691 CACCACAAAGAGAGCCAGCCTGG - Intronic
1153971677 18:10232862-10232884 CACCACAACAAAAGGATGTCAGG - Intergenic
1155564950 18:27123800-27123822 CACCACCACCACAGCAAACCTGG + Intronic
1156602563 18:38626604-38626626 GACCACATACAGAGGATGCCTGG + Intergenic
1158273610 18:55742724-55742746 CACCAAAACCAGGGGAAGGAAGG + Intergenic
1161486673 19:4539644-4539666 CACCACAACCCTTGGAAGCCTGG + Intronic
1162195185 19:8979275-8979297 CAGCAGCACCAGGGGAAGCCAGG - Exonic
1162666491 19:12217672-12217694 CACCTCCACTAGAGGAAGACAGG - Intergenic
1163774580 19:19210545-19210567 CACCACGACCATAGGAAGGAAGG + Intergenic
1163949822 19:20572928-20572950 CACCATAACCTGAGGTATCCAGG - Intronic
1165490301 19:36119501-36119523 CATCTCAGCCAGAGGGAGCCTGG + Intronic
1165934466 19:39380808-39380830 CACCCCAACCCCAGGAGGCCAGG - Intronic
1165950915 19:39473528-39473550 CACCAGAACCTGGGGAACCCTGG - Intronic
1166259408 19:41627309-41627331 CACCACAAACAGAGGTACTCTGG + Intronic
1167763993 19:51468318-51468340 CACCACACCCTCAGGAACCCAGG + Intergenic
1167931127 19:52866402-52866424 CAACACACTCAGAGGCAGCCAGG + Intronic
925201912 2:1974250-1974272 CACCACACTCAGAGGTGGCCGGG - Intronic
925743903 2:7029001-7029023 CCCCACAAGGAGAGGAAGTCCGG + Intronic
925961587 2:9022104-9022126 AACCACAATGTGAGGAAGCCAGG - Intergenic
926326212 2:11786535-11786557 CACCACAATCAGAAGCAGGCAGG - Intronic
927258594 2:21062802-21062824 CACCACAAGCAGAGCCAGACAGG - Intergenic
932126428 2:69149252-69149274 CACCACAGCCAGAGGGAACTGGG + Intronic
932512168 2:72303831-72303853 CACTTCAATCAGAGGCAGCCTGG - Intronic
933582965 2:84148007-84148029 CACCATAATCAGAGGCAGCTTGG + Intergenic
934662979 2:96153008-96153030 CACCACAGCCAGAGAGAGCTGGG + Intergenic
940058012 2:149534041-149534063 GACCACAGCCAGAGGAAGTCTGG + Intergenic
941873697 2:170411817-170411839 CTCCACAGCCAGATGCAGCCAGG - Intronic
943769588 2:191702054-191702076 CAACACAAACAGAGGAAGACAGG + Intergenic
944912499 2:204324134-204324156 CACCAAAAGCAGAGGAGGCTTGG + Intergenic
944936558 2:204575652-204575674 CCCCACAGCCAGAGAGAGCCAGG - Intronic
945191843 2:207196806-207196828 CACCACCACCAAAGGAAGCCGGG + Intergenic
945911779 2:215658119-215658141 AAACACAACCAGAAGAAGGCAGG + Intergenic
946002218 2:216492083-216492105 CCCCACAACCAGAAGAGGTCCGG - Intergenic
947876008 2:233468728-233468750 CACCACAACCAGAGGAAGCCAGG + Intronic
948586907 2:239025567-239025589 GACCAGACACAGAGGAAGCCAGG - Intergenic
948721700 2:239904874-239904896 CACCACAAGCCAAGGAAGCCTGG - Intronic
949000227 2:241609085-241609107 GACTGCAACCACAGGAAGCCAGG + Intronic
1173498627 20:43536319-43536341 CCCCACACCCCCAGGAAGCCCGG - Intronic
1174017513 20:47500843-47500865 CACAGCAGCCAGAGGAATCCTGG - Intergenic
1175417295 20:58810308-58810330 CACCACAGGAACAGGAAGCCAGG - Intergenic
1175985672 20:62763153-62763175 CCCCACAACCACAGGACCCCTGG - Intergenic
1176103913 20:63376865-63376887 CACCTCAACCTGGGGATGCCAGG + Intronic
1178599838 21:33985913-33985935 CAGCACCCCCAGCGGAAGCCAGG - Intergenic
1178808378 21:35858709-35858731 TACAACAACAAGAGGAACCCAGG + Intronic
1180286246 22:10747251-10747273 CACCACCACTTTAGGAAGCCAGG - Intergenic
1181729513 22:24834367-24834389 CACAAAAACCAGTGGAAGGCTGG - Intronic
1182186906 22:28413553-28413575 CACCAATACCAGAGGCAGCTTGG + Intronic
1182678244 22:32057220-32057242 CTTCACAATCAGAGGCAGCCAGG - Intronic
1183932094 22:41241024-41241046 CACCTCAGCCTGGGGAAGCCTGG - Intergenic
1183976044 22:41512948-41512970 CAGCACATCCTGAGGAGGCCAGG - Intronic
949981313 3:9503413-9503435 CACCAAAACCACAGTAATCCCGG + Intronic
950859951 3:16139183-16139205 CCCCACAAACAGAGAAAACCTGG + Intergenic
951191471 3:19776878-19776900 CATCACAACTAGAGGCAGCCTGG - Intergenic
952629799 3:35453017-35453039 CACCCCCACCAGTAGAAGCCAGG + Intergenic
952722404 3:36546809-36546831 AATCACAAAGAGAGGAAGCCTGG - Exonic
957998889 3:87727041-87727063 CATCACAAGCACAGGAAGTCAGG + Intergenic
958617754 3:96517162-96517184 CATCTTAACCAGAGGAAGCTGGG + Intergenic
959470070 3:106739129-106739151 CACCACAAACCCAGGAAGCCAGG - Intergenic
961645670 3:128391513-128391535 CACCACACCCTGAGCAGGCCTGG - Intronic
962520532 3:136194710-136194732 CACCACCACCAGATGAACCGAGG + Intronic
963122136 3:141785364-141785386 CACCACACCCAGCGCAAGCCAGG - Intronic
967222211 3:187256896-187256918 AACCACAGCCATAGCAAGCCTGG + Intronic
967291151 3:187921497-187921519 CACTCCATCCAGAGGCAGCCTGG + Intergenic
968625801 4:1626172-1626194 CACCAGGAGCAGAGCAAGCCAGG + Intronic
968706983 4:2083706-2083728 CACCACACACAGAGAAAGCAGGG + Intronic
971460970 4:26896053-26896075 CTCAACAACCAGAATAAGCCTGG - Intronic
971514170 4:27466073-27466095 CCCCAAAACCAGAGTAAGCCTGG - Intergenic
973636425 4:52865486-52865508 CACGACCACCACAGGCAGCCGGG - Exonic
975634341 4:76431717-76431739 CACCATAAGCAGATGCAGCCAGG - Intergenic
978347388 4:107786367-107786389 CAACAGAACCATAGGATGCCTGG + Intergenic
981548485 4:145918655-145918677 AACCACACATAGAGGAAGCCTGG + Intronic
982092537 4:151892842-151892864 CAAAAGAACAAGAGGAAGCCTGG - Intergenic
983247231 4:165301982-165302004 AACCACAACCAGAGAAGTCCAGG - Intronic
985779006 5:1860101-1860123 CTCCACACCCAGAAGATGCCTGG - Intergenic
986883595 5:12206219-12206241 CATCACAACTAGAGGAACCATGG - Intergenic
990299004 5:54432032-54432054 CATCAAAACCACAGGAGGCCGGG + Intergenic
991365195 5:65860644-65860666 CTCCAGAATCAGAGGTAGCCAGG - Intronic
992324675 5:75649001-75649023 CAACACAAATGGAGGAAGCCAGG - Intronic
992823141 5:80518672-80518694 TACTAAAACCAGAGGAACCCAGG - Intronic
993280657 5:85920955-85920977 CACCATACACAGAGGAACCCAGG + Intergenic
997581346 5:135019394-135019416 CACCACACCCGGAGGTAGGCTGG + Intergenic
998049493 5:139020129-139020151 CACCACCAACACAGGGAGCCAGG + Intronic
998054234 5:139060887-139060909 CACCAGGACAAGAGGAACCCTGG + Intronic
998223963 5:140311955-140311977 CACCACAGCAAGTGAAAGCCTGG + Intergenic
998463517 5:142325800-142325822 CAACTCAGCCAGAGGAAGCCTGG + Intronic
998811811 5:145974075-145974097 GACTACAACCTGAGCAAGCCTGG - Intronic
999864407 5:155684861-155684883 TACCAGAACCACAGGAATCCAGG + Intergenic
1000097770 5:157986419-157986441 CAGCACAAGTGGAGGAAGCCAGG + Intergenic
1000887474 5:166763613-166763635 CTCCACAACATGAGGAAGCCTGG + Intergenic
1001489330 5:172144653-172144675 CACCACATTCGAAGGAAGCCTGG + Intronic
1003555058 6:7131949-7131971 CACGACAATCACAGGAACCCAGG - Intronic
1004646063 6:17561782-17561804 AACAACAACCAGAGCAATCCTGG + Intergenic
1005905725 6:30260339-30260361 CACACCATCCAGAGGAAGCATGG + Intergenic
1005952407 6:30641776-30641798 CATCTCATCCAGAGGAACCCAGG + Intronic
1007286049 6:40748226-40748248 CACCAAAACCAGAGGGAGCCTGG - Intergenic
1010773341 6:79857920-79857942 CAGCACAACCAGAAGAAACCAGG + Intergenic
1019363217 7:616533-616555 GACCACAGCCTGAGGAAGCCAGG - Intronic
1019694177 7:2435666-2435688 CACCACACACAGAGGACACCAGG - Intergenic
1019889001 7:3930319-3930341 CTCCACACCCAGGTGAAGCCAGG - Intronic
1020287871 7:6699480-6699502 CACCCCAGCCAGATGAATCCAGG + Intronic
1020482400 7:8678488-8678510 AGCAACAACCAGAGGAAGCTAGG - Intronic
1023969650 7:44981411-44981433 CAGCACCAACAGAGCAAGCCTGG - Intergenic
1024991746 7:55240133-55240155 CAGCACAACGAGCGCAAGCCTGG - Intronic
1026390423 7:69896054-69896076 CAACACTAGCAGAGGGAGCCAGG - Intronic
1026901608 7:74040450-74040472 GACCACACCCAGGGAAAGCCAGG + Intronic
1027242792 7:76343790-76343812 CACCACCACGTGAAGAAGCCTGG + Intronic
1029634370 7:101774096-101774118 CATGACAGCCAGAGGAAGTCAGG + Intergenic
1030821386 7:114096169-114096191 CAGCACAACCAAGGAAAGCCGGG + Intronic
1031068940 7:117140906-117140928 CACCACAAACAGAGGAGGGAAGG + Intronic
1033461991 7:141555099-141555121 TAGAAAAACCAGAGGAAGCCTGG + Intronic
1034218118 7:149423082-149423104 GACCTGAACGAGAGGAAGCCCGG + Intergenic
1034228410 7:149500324-149500346 CAACACACCCAGAAGGAGCCTGG + Intergenic
1035638393 8:1163922-1163944 CACCTCACCCGGAGGAAGCCAGG - Intergenic
1035945111 8:3953975-3953997 CATCACCACCAGAGGAAGGAAGG - Intronic
1037522464 8:19693214-19693236 CACCACAAGCAGAGAAAGGCAGG - Intronic
1037657014 8:20893231-20893253 TAACACAGCCAGAGGAAACCTGG - Intergenic
1037724501 8:21472315-21472337 GACCACAAGCAGAGGAAGGAAGG + Intergenic
1039644669 8:39267667-39267689 CACCCCAAACAGAGGAAAGCAGG + Intronic
1041169705 8:55128995-55129017 CAGCACAACCACAGGAGACCTGG + Intronic
1043749004 8:83911528-83911550 CAGCAGAAACAGAGGAATCCTGG - Intergenic
1044785474 8:95788274-95788296 CCCCACTATAAGAGGAAGCCTGG - Intergenic
1047494810 8:125401980-125402002 CACCACAGCCAGAGGTACACCGG + Intergenic
1051938872 9:22480027-22480049 CCCCATAACCAGTGGAGGCCAGG - Intergenic
1052746952 9:32450187-32450209 CACCCCTCCCAGAGGCAGCCAGG - Exonic
1053353949 9:37431017-37431039 AACCACAGCCAGACAAAGCCAGG - Intronic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1057141536 9:92729457-92729479 CACCAAAATAAGAGAAAGCCTGG + Intronic
1057215195 9:93224068-93224090 AATCAAAACCAAAGGAAGCCTGG - Intronic
1057217789 9:93239001-93239023 GAGCACACACAGAGGAAGCCAGG + Intronic
1059313896 9:113407980-113408002 GACTACAAGAAGAGGAAGCCTGG + Exonic
1060301805 9:122378373-122378395 TACCAGAACCAGAAGTAGCCAGG - Intronic
1060465144 9:123897430-123897452 CCCTACAACCAGAGGAAGTGTGG + Intronic
1061814655 9:133187367-133187389 CACCAGATTCAGAGGAAGTCAGG - Intergenic
1061819533 9:133218572-133218594 CACCACAAACAGAGGGAAACTGG + Intergenic
1061987245 9:134136639-134136661 CACCCCAACCCGAGGCAGCCAGG + Intronic
1203732603 Un_GL000216v2:104407-104429 CACCACCACTTTAGGAAGCCAGG - Intergenic
1188639740 X:32486071-32486093 CAGGACAACAAGAGGAAACCTGG - Intronic
1196203413 X:112911746-112911768 CACTGCAACCTGAGGAATCCAGG + Intergenic
1199250054 X:145650834-145650856 CACCACTACCAGTGACAGCCAGG + Intergenic
1200120604 X:153788534-153788556 CACCACACTCAGAGGCAGGCGGG + Intronic
1202168263 Y:22015131-22015153 CACCACACCATGAGGGAGCCAGG + Intergenic
1202223098 Y:22571237-22571259 CACCACACCATGAGGGAGCCAGG - Intergenic
1202320017 Y:23624423-23624445 CACCACACCATGAGGGAGCCAGG + Intergenic
1202550751 Y:26045633-26045655 CACCACACCATGAGGGAGCCAGG - Intergenic
1202628344 Y:56883260-56883282 CACCACCACTTTAGGAAGCCAGG + Intergenic