ID: 947876449

View in Genome Browser
Species Human (GRCh38)
Location 2:233470949-233470971
Sequence TGGGCTGCACCTGCGGGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947876442_947876449 -4 Left 947876442 2:233470930-233470952 CCATCTGATGTGCAGAAGCTGGG 0: 1
1: 0
2: 1
3: 23
4: 169
Right 947876449 2:233470949-233470971 TGGGCTGCACCTGCGGGGGTGGG 0: 1
1: 0
2: 5
3: 21
4: 281
947876438_947876449 30 Left 947876438 2:233470896-233470918 CCGGCGCTGTCCAGGTCCTTTAG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 947876449 2:233470949-233470971 TGGGCTGCACCTGCGGGGGTGGG 0: 1
1: 0
2: 5
3: 21
4: 281
947876439_947876449 20 Left 947876439 2:233470906-233470928 CCAGGTCCTTTAGTCAGCGTCAC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 947876449 2:233470949-233470971 TGGGCTGCACCTGCGGGGGTGGG 0: 1
1: 0
2: 5
3: 21
4: 281
947876440_947876449 14 Left 947876440 2:233470912-233470934 CCTTTAGTCAGCGTCACTCCATC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 947876449 2:233470949-233470971 TGGGCTGCACCTGCGGGGGTGGG 0: 1
1: 0
2: 5
3: 21
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947876449 Original CRISPR TGGGCTGCACCTGCGGGGGT GGG Exonic
900188048 1:1342195-1342217 TGGGCGGCATCTGAGGGGCTGGG - Intronic
900208167 1:1440307-1440329 AGGGCAGCACCTGCTGGGGACGG + Exonic
900354107 1:2251632-2251654 TGGGCAGCATCTGGGGGGGCTGG + Intronic
900368313 1:2320424-2320446 TGGGCTGCAAGGACGGGGGTGGG + Intergenic
900422496 1:2561660-2561682 CCAGCTGCACCTGCGGGAGTGGG - Exonic
900719413 1:4165567-4165589 TGGGCTGCATTTGCAGGGCTCGG - Intergenic
901230683 1:7640313-7640335 CTGCCTGCACCTGCGGGGTTGGG + Intronic
902400409 1:16154142-16154164 TCGGCTGCCCATGGGGGGGTGGG - Intronic
903518590 1:23929810-23929832 TGTGCTGTCCCCGCGGGGGTGGG + Intergenic
904495482 1:30884166-30884188 AGGACTGCACCTGCTGGGGAAGG + Intronic
905884992 1:41486967-41486989 TGTGCTGACCCTGCGGGGCTCGG - Intergenic
911492672 1:98589190-98589212 TAGGCTCCACCTCCGGGGGCAGG + Intergenic
912245884 1:107961368-107961390 TGGGCGGCACATGCTGGGGTTGG - Intronic
913215648 1:116617893-116617915 TGGGCTGCAGCTGTGGGAGGAGG - Intronic
915875146 1:159604286-159604308 TGGGCTCCACCTCTGGGGGCAGG + Intergenic
916040927 1:160960829-160960851 TGGCCTGCATCTGCAGGTGTGGG - Intergenic
916120617 1:161525213-161525235 TGGGCTGGACCGGCGGGGCGCGG + Exonic
916130381 1:161606845-161606867 TGGGCTGGACCGGCGGGGCGCGG + Intronic
916482340 1:165225850-165225872 TTGTGTGCACCTGCAGGGGTGGG - Intronic
917767837 1:178243257-178243279 TGGGCAGCACCAGCAGGGATCGG - Intronic
917974640 1:180230837-180230859 TGGGCTGGAGATGCGGGGTTCGG - Intronic
921292383 1:213670665-213670687 TGGGCTGCACCTGCCAGGCAAGG + Intergenic
1063339119 10:5245893-5245915 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
1063385953 10:5616456-5616478 TGGGCGGCACTCGGGGGGGTGGG - Intergenic
1063385970 10:5616493-5616515 TGGGCGGCACTCGGGGGGGTGGG - Intergenic
1063385979 10:5616512-5616534 TGGGCGGCACTCGGGGGGGTGGG - Intergenic
1063831430 10:9958095-9958117 TAGGCTGCACCTCTGGGGGCAGG + Intergenic
1065179038 10:23106690-23106712 GAGGCTGCACCTGCAGGGGAGGG - Intronic
1066653718 10:37681279-37681301 TGGGCTGCCCCTGCTTGTGTTGG - Intergenic
1066664217 10:37766163-37766185 TAGGCTCCACCTGTGGGGGCAGG + Intergenic
1070112110 10:73496024-73496046 TGCACTGCGCGTGCGGGGGTGGG + Exonic
1072990257 10:100185979-100186001 TCGGCTGCACGTGCGGGCGGGGG - Exonic
1074434682 10:113424084-113424106 TGGGCTGCAGGTGCTGGGGAAGG + Intergenic
1077305887 11:1868551-1868573 TGGGCTGGCCCTGAGGGGGCTGG + Intronic
1077538276 11:3134749-3134771 TGGGCTTCAGCTGCGTGAGTGGG + Intronic
1078355445 11:10628741-10628763 TGGGCCTCACCTGGCGGGGTGGG + Exonic
1078571108 11:12458680-12458702 TGGGCTGCCACAGAGGGGGTAGG - Intronic
1078695616 11:13628690-13628712 TAGGCTCCACCTCTGGGGGTAGG - Intergenic
1080210601 11:29780995-29781017 TGGGCTGACTCTGAGGGGGTAGG - Intergenic
1080810951 11:35703308-35703330 TAGGCTCCACCTGTGGGGGCGGG + Intronic
1081713791 11:45234408-45234430 TGGGCTGCAGGTGGAGGGGTGGG - Intronic
1083677637 11:64335411-64335433 AGGGATGCCCGTGCGGGGGTGGG + Intergenic
1084872649 11:72108592-72108614 TGAGCTCCACCTGTGGGGATAGG - Exonic
1087545908 11:99583410-99583432 TAGGCTCCACCTCTGGGGGTAGG - Intronic
1087634795 11:100689934-100689956 TGGGCTGCAGCTGCTTGGATAGG + Intronic
1089169369 11:116501410-116501432 TGGGCTGCAGCTGCTTGGGTGGG - Intergenic
1089352335 11:117828677-117828699 TGGGGAGCAGCTGCGGGGCTGGG + Intronic
1090240725 11:125179657-125179679 AGGGCTGCACCTGTGGGGAGAGG + Intronic
1090381116 11:126328412-126328434 TGAGGTGCACCTGCAGGGATGGG - Intronic
1090632402 11:128661308-128661330 TGGGCTGGACCTGTGGGGGCTGG + Intergenic
1091653171 12:2324570-2324592 TGAGCTGCACCTGCTGGAGCAGG + Intronic
1091776683 12:3189260-3189282 TGGGCTGCACCTTGAGGGGCTGG + Intronic
1092446717 12:8564750-8564772 GGGGCGGCACCTGCGGGGCAGGG - Intergenic
1094861892 12:34476845-34476867 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
1095591329 12:43907022-43907044 TAGGCTCCACCTGTGGGGGCAGG + Intronic
1096959225 12:55560969-55560991 TAGGCTCCACCTGTGGGGGCAGG + Intergenic
1098404396 12:70108758-70108780 TGAGCTGCAGCTGCTGGGGCTGG + Intergenic
1099512428 12:83554695-83554717 TAGGCTCCACCTCTGGGGGTGGG - Intergenic
1099773802 12:87098942-87098964 TGGGCTCCACCTCTGGGGGCAGG + Intergenic
1100663828 12:96729270-96729292 TAGGCTGCACCTCTGGGGGCAGG - Intronic
1101150204 12:101877138-101877160 CGCGCTGCTGCTGCGGGGGTCGG - Intergenic
1102457896 12:113082217-113082239 TGGGCAGCATCTGCGTGGGTGGG - Intronic
1103539202 12:121654243-121654265 TGGGCGGGGCCGGCGGGGGTGGG + Intronic
1103941834 12:124505442-124505464 TGGGCTGCACCTGTAGGAGCAGG + Intronic
1104009235 12:124917432-124917454 TGGGCTGCAGCTGGGGAGGGCGG + Intergenic
1104634035 12:130426693-130426715 GGGGCTGTGCCTGTGGGGGTGGG + Intronic
1104752167 12:131246585-131246607 TGGGCTGCATCTCCCGAGGTCGG + Intergenic
1105507838 13:21025442-21025464 TGGTTGGCACCTGAGGGGGTCGG + Intronic
1108118690 13:47160153-47160175 TCAGCTGCACCTGGGAGGGTGGG - Intergenic
1108168059 13:47712686-47712708 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
1108340652 13:49495976-49495998 TGTGCTGCAGCTGCGGGTGGCGG - Exonic
1109320605 13:60805468-60805490 TAGGCTGCACCTCTGGGGGCAGG - Intergenic
1110219650 13:73059492-73059514 CGGGCTGCGCCTGCGGGCGGTGG - Exonic
1110436532 13:75482368-75482390 TGGGCTGCAGCTGCGGCGGGAGG - Intergenic
1115925201 14:38425447-38425469 TGGGCTGCACTGCCTGGGGTTGG + Intergenic
1116092447 14:40326744-40326766 TAGGCTGCACCTCTGGGGGCAGG + Intergenic
1116741954 14:48766906-48766928 TGGCATGAACCTGGGGGGGTGGG - Intergenic
1117513008 14:56471797-56471819 TGTGCTGCAACTGCTTGGGTAGG + Intergenic
1122977916 14:105178526-105178548 TGGGCTGGGCCTGCTGGGGGAGG + Intronic
1125228780 15:37427690-37427712 TAGGCTCCACCTGTGGGGGCAGG + Intergenic
1131929053 15:97418913-97418935 TGGGCTCCACCTCTGGGGGCAGG - Intergenic
1131930258 15:97433233-97433255 TGGGCTCCACCTCTGGGGGCAGG + Intergenic
1132599058 16:765826-765848 TGGGCAGCACCCCTGGGGGTGGG + Intronic
1132802846 16:1762757-1762779 TGGGCAGCAGCTGCAGGGGAAGG + Intronic
1132923339 16:2411936-2411958 TGGGCTGCATCTGCGGAGGTGGG - Intergenic
1133728155 16:8556257-8556279 TGGGCTGGAGCAGCGGGGGCTGG - Intergenic
1134093844 16:11405906-11405928 TGGGCTGGAGCTGGGTGGGTGGG - Intronic
1134253567 16:12592294-12592316 TAGGCTCCACCTGTGGGGGCAGG + Intergenic
1135420482 16:22302667-22302689 TGGGCTGCACCTGCGGGGAAAGG - Intronic
1135615085 16:23904170-23904192 TGGCCTGCAGCTAAGGGGGTGGG + Intronic
1135828132 16:25748447-25748469 TGAGCTGCAGGTGTGGGGGTGGG - Intronic
1139586909 16:67909738-67909760 GGGGAGGCACCTGCGGGGGCAGG + Intronic
1139650786 16:68361158-68361180 TGGGCTGCAGCTGCAAGGGCTGG + Exonic
1141857627 16:86694630-86694652 TGAGCTGCACCTGCGGGAGAGGG - Intergenic
1142812034 17:2399948-2399970 TGGGCTGCGCGTCCGGGGTTTGG - Intronic
1144157227 17:12517612-12517634 TGGGCCCCACCTTCTGGGGTGGG - Intergenic
1145191665 17:20846430-20846452 TGGTCTGCAGCTCCTGGGGTGGG - Intronic
1145282340 17:21477229-21477251 GGTGCTGGACCTGCTGGGGTGGG - Intergenic
1145401878 17:22546427-22546449 TGGTCTGCAGCTCCTGGGGTGGG - Intergenic
1145775688 17:27526818-27526840 TGGGCTCCTCCTCCGGGGGGAGG + Intronic
1146376057 17:32295332-32295354 TTGGCTGCACCTGCGGGGGAGGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147401283 17:40181419-40181441 TGGGCAGCCACTGCGAGGGTGGG - Intronic
1148079589 17:44960358-44960380 TGGCCCGCACCTGCGGGTGGGGG + Exonic
1148240472 17:45996697-45996719 GGGGCTGCGCCTGGAGGGGTAGG + Intronic
1148793046 17:50184300-50184322 TGGGCTGCAGCTGTGGAGGAGGG + Exonic
1148852510 17:50561747-50561769 CGGGCCGCACCGCCGGGGGTCGG + Intronic
1149444752 17:56705025-56705047 TGGGCTGGGCCTGGGTGGGTAGG - Intergenic
1151553405 17:74834752-74834774 TGGGCTTCACCTGAGGGGTGAGG + Intronic
1151675448 17:75595122-75595144 TGGGCTGAGCCTGCTGGGGTGGG + Intergenic
1151745035 17:76007387-76007409 GGTGCTGCACCTGCAGGTGTGGG + Exonic
1151991777 17:77579684-77579706 TGGGAAGCACCTGCAGGGGAGGG - Intergenic
1152782782 17:82233568-82233590 CTGGCTGCACCAGCGGGGGTGGG - Intronic
1154349006 18:13567447-13567469 GGGGCTGCAGCGGCGGGGGGTGG - Intronic
1155042531 18:22076553-22076575 TGGGCTGCACCAGCTGCAGTAGG + Intergenic
1155505940 18:26532732-26532754 TGGCCTGCTTCTGTGGGGGTGGG + Intronic
1160211108 18:76880730-76880752 TGGGCAGCACCTGCACGTGTGGG + Intronic
1160682661 19:418945-418967 TGAGCTGCACCTGCGTGGCGTGG - Exonic
1160792668 19:929724-929746 CGGGCTGCAGCTGCGGGCCTGGG + Exonic
1160901770 19:1432420-1432442 TGGGCAGCTCCTGCTGGGCTGGG + Intronic
1160955942 19:1691761-1691783 AGGGCTGCAAATTCGGGGGTGGG - Intergenic
1161055418 19:2188492-2188514 GGGCCTGCACCTGTGCGGGTGGG - Intronic
1161298959 19:3533594-3533616 GGGCCTGCACCTGCAGGGCTGGG - Intronic
1161476907 19:4491274-4491296 AGGGCTGCGCCGGGGGGGGTGGG - Intronic
1161597116 19:5156250-5156272 TGGGGGGCAGCTGCAGGGGTCGG - Intergenic
1162017007 19:7851421-7851443 GGAGCTGCTCCTGCAGGGGTGGG - Exonic
1162094767 19:8303834-8303856 TGGTATGCACCTGCGGGGCTGGG - Exonic
1162444353 19:10713105-10713127 TGAGCTGCAGCTGCGGGGAGGGG - Exonic
1162551833 19:11362271-11362293 TGGGCACCACCTGCAGGGCTAGG - Intronic
1165734090 19:38164791-38164813 TGGCCGGCAACTGCGGGGGCAGG - Exonic
1165830602 19:38728541-38728563 TCTGCTGCATCTGCCGGGGTGGG + Intronic
1166383779 19:42369360-42369382 TGGGCTACACCTGGAGGGGGTGG + Intronic
1166436841 19:42774552-42774574 TAGGCTCCACCTCTGGGGGTAGG - Intronic
1166676627 19:44745302-44745324 GGGGCTGCCCCTGCGGGTGGGGG + Intergenic
1168437948 19:56337168-56337190 TAGGCTCCACCTGTGGGGGCAGG - Intronic
927055591 2:19363007-19363029 CGGGCTGCACCGGCGGCGGGTGG + Intergenic
927271358 2:21214172-21214194 TGGGCTCCACCTCTGGGGGCAGG - Intergenic
927283920 2:21336479-21336501 TGGGCTTCACCTCTGGGGGCAGG + Intergenic
927528569 2:23771980-23772002 TGGGCTGCTCCTCCTGGGGCTGG + Intronic
927924638 2:27002641-27002663 TGTGTTGCACCTGGGGGTGTGGG + Intronic
928174307 2:29023628-29023650 TGGGCTGCTCCAGTGGGGGTGGG + Intronic
933299898 2:80529929-80529951 TGGCCTGCTCCTACGGGTGTTGG + Intronic
933716767 2:85367329-85367351 GGAGCTGCACCAGCAGGGGTTGG + Intronic
933782351 2:85811315-85811337 TGGGGGGCGCCTGCGGGGGCGGG - Intergenic
936095894 2:109529766-109529788 GGGGCTCAACCTGAGGGGGTGGG + Intergenic
938718497 2:134043296-134043318 TAGGCTGCACCTCTGGGGGCAGG + Intergenic
940729108 2:157369075-157369097 TGGGCTCCACCTCTGGGGGCAGG + Intergenic
944127230 2:196307975-196307997 TCTGCAGCACCTGCGGGGCTGGG + Exonic
946530915 2:220569517-220569539 TTGCCTGCACCTGCTGGGGGTGG + Intergenic
947820936 2:233068978-233069000 TGGGCTCCAATTGAGGGGGTGGG + Intronic
947876449 2:233470949-233470971 TGGGCTGCACCTGCGGGGGTGGG + Exonic
948119448 2:235518057-235518079 TGCGCTGCACCTTCGGAGGCTGG - Intronic
948466730 2:238155765-238155787 TGGGCTGCTCCTGCAGGGGGAGG + Intergenic
948479134 2:238239559-238239581 TGGCCTGCACCTGCGCGGGCGGG + Exonic
948729484 2:239953929-239953951 TGGGTTCCACCTGCTGGGCTGGG + Intronic
948981205 2:241495872-241495894 TGGGCAGCAGCTCTGGGGGTGGG - Intronic
1169195824 20:3681618-3681640 TGGGCTGCCCCCGAGGGGGAGGG + Intronic
1170478118 20:16736902-16736924 TGGGCTCCACCAGCGGGCTTTGG - Intronic
1172794144 20:37525530-37525552 TGGCCTGCACCTGCACGTGTGGG + Intronic
1175222430 20:57425189-57425211 TGAGCTGCTCCTCTGGGGGTGGG + Intergenic
1175929364 20:62486388-62486410 TGGCCTCCCCCTGGGGGGGTGGG - Intergenic
1176194416 20:63830855-63830877 TGGGGGGCACCCGCGGGGGCCGG + Intronic
1176204026 20:63878534-63878556 TGGGCTGCAGCAGTGGGGGCAGG - Intronic
1178361004 21:31948518-31948540 TGGGCTGTAGCTGAGGGGGCAGG + Intronic
1179519141 21:41930920-41930942 GTGGCTGAACCTGCGGGGGAAGG + Intronic
1179644567 21:42767568-42767590 CGGGCTGCACCTGCTGGTTTGGG - Intronic
1180219304 21:46347909-46347931 TGGGTTGCACCTGCTGTGGGTGG + Intronic
1180935472 22:19622502-19622524 AGGGCTGGACCTGGTGGGGTGGG + Intergenic
1183311080 22:37109773-37109795 TGGGGTGCCCATGCGGGGGTGGG - Intergenic
1183930853 22:41235312-41235334 TGGGCTGAACCTGCGGGTGGGGG - Exonic
1184029729 22:41885097-41885119 TGGGCAGCACCTGATGGGGAAGG - Intronic
1184592810 22:45496449-45496471 TGAGGTGCACCTGGAGGGGTGGG + Intergenic
1185015506 22:48340347-48340369 TGGGCTTCACCTGGAGGGCTTGG + Intergenic
1185292616 22:50034781-50034803 TGGGATGCACGGGTGGGGGTGGG + Intronic
1185336390 22:50272453-50272475 TGGCCAGGACCAGCGGGGGTGGG - Intergenic
949406529 3:3719924-3719946 TAGGCTGCACCTCTGGGGGCAGG + Intronic
951125902 3:18983029-18983051 TGAGCTGCACTTCCTGGGGTTGG + Intergenic
953219795 3:40959464-40959486 TGGGCTCCACCTCTGGGGGCAGG - Intergenic
954305327 3:49722501-49722523 TAGGCTGCAGCTGTGGGAGTGGG + Exonic
955652715 3:61211555-61211577 TGGGCTCCACCTCTGGGGGCAGG + Intronic
956396852 3:68835010-68835032 TGGCCTACACATGCAGGGGTGGG + Intronic
957723255 3:84031814-84031836 TGGCCTGCATCTGCGTGGGTGGG + Intergenic
958019764 3:87980985-87981007 GCTGCTGCACCTGGGGGGGTGGG + Intergenic
959522316 3:107334286-107334308 TAGGCTCCACCTCCGGGGGCAGG + Intergenic
960747029 3:120901791-120901813 TGGGCTCCACCTCTGGGGGCAGG - Intergenic
961003591 3:123390175-123390197 TGAGCTGCATCTGCTGGGGAAGG - Intronic
961074334 3:123967697-123967719 TGGGCTGCACCTGCAGGGGATGG - Intergenic
961107938 3:124258097-124258119 TGGGGAGCAGCTGCGGGAGTTGG + Intronic
961309295 3:125984438-125984460 TGGGCTGCACCTGCAGGGGATGG + Intergenic
962442053 3:135429464-135429486 TGGGCTCCAGCTGCTGGTGTAGG + Intergenic
962500060 3:135982169-135982191 TGGGCTGCACATGTGGCAGTTGG + Intronic
962676587 3:137762623-137762645 TGGGCTCCACCTCCGAGGGCTGG - Intergenic
964532755 3:157685747-157685769 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
968258096 3:197297695-197297717 CGGGCTGCTCCAGCGGGGGCCGG + Intronic
968616227 4:1579007-1579029 GGCTCTGCGCCTGCGGGGGTGGG - Intergenic
969514542 4:7639048-7639070 TGGGCTGCATCTGCAGGGAGGGG + Intronic
969703324 4:8779507-8779529 AGGGCTGCGCCTGCAGAGGTGGG - Intergenic
972969028 4:44549448-44549470 TGGGCTGCTCATGAGGGAGTAGG + Intergenic
973569478 4:52223816-52223838 TAGGCTCCACCTCTGGGGGTAGG - Intergenic
976388332 4:84484131-84484153 TGGGATTCTCCTGCGGGGTTGGG + Intergenic
980544785 4:134244615-134244637 TGGGCTGAAGCTTCGGGGCTGGG + Intergenic
981165247 4:141549842-141549864 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
982413337 4:155104052-155104074 AGGGCTCCACCTTCAGGGGTGGG + Intergenic
983877329 4:172892841-172892863 TGGGCTGCCCCTGAGGGAGGAGG - Intronic
984778631 4:183505000-183505022 TGGGCTGGTGCTGCGGGGGCGGG + Exonic
985653350 5:1117191-1117213 TGGGCCTGGCCTGCGGGGGTGGG + Intergenic
985744354 5:1637862-1637884 TGGCCTGCACCTGCTGGGGGTGG - Intergenic
987012411 5:13781136-13781158 TGGGCTGCATCAGACGGGGTGGG + Intronic
989134146 5:38136436-38136458 TCGGCTGCAGCTGCTGGGATGGG + Intergenic
990350053 5:54907027-54907049 TGGGCTGCATGTGGGCGGGTTGG + Intergenic
991241905 5:64470360-64470382 TAGGCTCCACCTCAGGGGGTAGG - Intergenic
991242718 5:64477635-64477657 TAGGCTCCACCTCAGGGGGTAGG + Intergenic
992080634 5:73232556-73232578 TGGGCTGCAGCTGCAGGGTCGGG + Intergenic
992435898 5:76755916-76755938 TGGGCTGCAGCTGCTGCAGTGGG + Intergenic
998034215 5:138900282-138900304 TGGGCTGCTGCTGCGTTGGTGGG + Intronic
998760198 5:145424201-145424223 TAGGCTGCACCTCTGGGGGCAGG - Intergenic
998877006 5:146610023-146610045 TGGGCTCCACCTCTGGGGGCAGG + Intronic
1001095780 5:168774436-168774458 AGGGTTGCACCTGCAGGGGATGG + Intronic
1001544677 5:172563625-172563647 TGGACAGCACCTGGGGGTGTGGG - Intergenic
1002027741 5:176406792-176406814 TGGCCTGCACCTGCAGGGGGAGG - Intronic
1003921523 6:10837964-10837986 TGGGATGCACCAGCGAGGGCTGG + Intronic
1004832832 6:19495682-19495704 TGGGCTCCACCTCTGGGGGCAGG + Intergenic
1006728171 6:36215032-36215054 TTGGCTGCAGCAGAGGGGGTGGG + Intronic
1006907894 6:37545371-37545393 CGGGCTGGCCCTGCGGGGTTTGG + Intergenic
1007462844 6:42030709-42030731 TGGACTCCACCTGCCGGGCTGGG - Intronic
1008239911 6:49097916-49097938 TAGGCTCCACCTCCGGGGGCAGG + Intergenic
1010460688 6:76111080-76111102 TGGGCTCCACCTCTGGGGGCAGG - Intergenic
1010763450 6:79750822-79750844 AGGGCTCCACCTGAAGGGGTTGG + Intergenic
1011299849 6:85862873-85862895 TAGGCTGCACCTCTGGGGGCAGG - Intergenic
1013099400 6:106974568-106974590 AGGGCCTCACCTGCGTGGGTAGG + Intronic
1013437701 6:110128718-110128740 TGGTCTGCAGCTGGGGGGTTGGG - Intronic
1017191213 6:151654682-151654704 TGGGCTGCAGCTCTGGGGGCAGG - Intergenic
1017758260 6:157548342-157548364 TGGATTGCACCTGCCGGTGTGGG + Intronic
1018055004 6:160044379-160044401 AGGGCTGCACGTGCTGGGTTTGG + Intronic
1018400540 6:163415365-163415387 GGGGCCGCCCCGGCGGGGGTCGG - Intronic
1019045827 6:169144934-169144956 TGGGCTGCTCCTGTGGGGCTGGG + Intergenic
1019262395 7:88766-88788 AGGGCTGCAGCCGCGGAGGTGGG - Intergenic
1019379296 7:712665-712687 TGGCCTGAACCTGCGCCGGTGGG - Intronic
1019395564 7:816281-816303 GGGTCTGCACCTGCTGGGGGGGG - Intergenic
1020025557 7:4897559-4897581 AGGCCTGCACCTGCAGAGGTGGG + Intergenic
1020142941 7:5622427-5622449 GGGGCTGCACCTGCGGGCCTGGG - Intronic
1020645646 7:10811487-10811509 TAGGCTCCACCTCTGGGGGTAGG - Intergenic
1021998577 7:26202415-26202437 CGGGCTTCAGCGGCGGGGGTCGG + Intronic
1022352703 7:29580473-29580495 TAGGCTCCACCTCCGGGGGCAGG + Intergenic
1022360095 7:29649411-29649433 GGGGCTGCACGTGCGGGCTTGGG + Intergenic
1022727228 7:32992251-32992273 TGGGTTTCCTCTGCGGGGGTGGG - Intronic
1023839150 7:44086160-44086182 TGGTCTGGACCTGTGGGGGGTGG - Intergenic
1024242005 7:47442899-47442921 TGAGCTGCACCTGCCTGAGTGGG - Intronic
1024801759 7:53087447-53087469 TGGGCTGCAGGTGCCTGGGTTGG + Intergenic
1025184116 7:56843970-56843992 TAGGCTCCACCTCTGGGGGTAGG - Intergenic
1025687812 7:63732998-63733020 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
1026859130 7:73773721-73773743 TGGGCTGCACCTGTTGGGCAGGG + Intergenic
1029319250 7:99743104-99743126 TGGGCTGCACTTGGGTGGGCAGG - Intergenic
1029324213 7:99792104-99792126 TGGGCTGCACTTGGGTGGGCAGG - Intergenic
1029443320 7:100600122-100600144 TGGGCTGCGGCTGTGGGGCTGGG + Exonic
1031706330 7:124984928-124984950 TGGGCTCCACCTCTGGGGGCAGG - Intergenic
1031721425 7:125181418-125181440 TGGGCTCCACCTCTGGGGGCAGG - Intergenic
1034963174 7:155374686-155374708 GCGGCTGCCCCTGCGGGGTTCGG + Intergenic
1034968282 7:155404605-155404627 TGGGCAGCCCCTGCTGGGGCTGG + Intergenic
1036393501 8:8346461-8346483 TGGGCAGCAGCTGCAGGGCTGGG - Intronic
1036614006 8:10374320-10374342 TTGGCTGCACCAGCGGGAGTGGG + Intronic
1037883848 8:22586053-22586075 TGGGCCGCAGCTGCTGGGGACGG + Intronic
1040928817 8:52713896-52713918 TGGGCAACACCTGCCGGGGCGGG + Intronic
1042980198 8:74518384-74518406 TGAGCTGCACTTCCTGGGGTTGG - Intergenic
1045293462 8:100852863-100852885 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
1046397932 8:113664974-113664996 TTTTCTGCACCTGCGTGGGTGGG + Intergenic
1047512847 8:125528931-125528953 TGGGTTGCACCAGCCTGGGTTGG + Intergenic
1047536544 8:125725335-125725357 TGGGCTGCACCTGCCAGGAGGGG - Intergenic
1048090691 8:131237227-131237249 TGGGCTCCACCTCTGGGGGCAGG - Intergenic
1048093170 8:131262635-131262657 TGGGCTCCACCTCTGGGGGCAGG + Intergenic
1048363744 8:133720290-133720312 TGGGCAGCACCTGCAGCGGGGGG - Intergenic
1049284419 8:141766931-141766953 CGGACAGCACCTGCTGGGGTGGG + Intergenic
1049688269 8:143947914-143947936 TGGGCTGCTCCTGGCAGGGTAGG + Intronic
1049728959 8:144166207-144166229 TGGGCTGCACCTTCATGGATGGG - Intronic
1050374132 9:4953292-4953314 TAGGCTCCACCTCTGGGGGTAGG - Intergenic
1051357702 9:16254870-16254892 TCAGCTGCACCTGCGGCCGTTGG + Intronic
1051378909 9:16435517-16435539 TTGGCTGCTCCTGCTGGGGGTGG - Intronic
1053029972 9:34767294-34767316 TGGGCTCCACCTCTGGGGGAAGG - Intergenic
1053416820 9:37951985-37952007 TGGGCTGGACCTCGTGGGGTTGG + Intronic
1053450417 9:38189385-38189407 TGGTCTGCACCTTGGGGGTTGGG - Intergenic
1060406709 9:123376434-123376456 TGGGGCCCACCTGCGGGGGCAGG - Intronic
1061013790 9:127970696-127970718 TGGACTGTACCTGGAGGGGTGGG - Intronic
1062326606 9:136015408-136015430 TGGGCTGCACCTGGCAGTGTTGG - Intronic
1062425775 9:136505591-136505613 TGGACTACAGCTTCGGGGGTGGG - Exonic
1062697434 9:137882645-137882667 TGGCCTGCACATGGTGGGGTGGG + Intronic
1203651811 Un_KI270751v1:132237-132259 TAGGCTCCACCTCTGGGGGTAGG - Intergenic
1185455308 X:307503-307525 GGGGCTGTACCTGCAAGGGTGGG + Exonic
1185923443 X:4120304-4120326 TGGGCTGCACCTACAGGGATGGG - Intergenic
1189323157 X:40098083-40098105 AGCGCTGCGCCTGCGGGGGGAGG - Intronic
1190374412 X:49775086-49775108 TGAGCTGCACTTCCTGGGGTTGG + Intergenic
1190603027 X:52111667-52111689 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
1190921696 X:54859520-54859542 TAGGCTCCACCTGTGGGGGCAGG - Intergenic
1191157977 X:57296008-57296030 TGGGCTCCACCTCTGGGGGCAGG + Intronic
1192071274 X:67943076-67943098 TAGGCTCCACCTCTGGGGGTAGG + Intergenic
1192214649 X:69150131-69150153 GGGGCTGCAGCTCCGGGGGCAGG + Intergenic
1192218076 X:69177772-69177794 TGAGCGGAACCTGCAGGGGTTGG - Intergenic
1192598950 X:72441085-72441107 TAGGCTCCACCTCCGGGGGCAGG + Intronic
1192719435 X:73677318-73677340 TGGGCTCCACCTCTGGGGGCAGG - Intronic
1192942329 X:75925557-75925579 TAGGCTCCACCTGTGGGGGCAGG + Intergenic
1192955857 X:76069343-76069365 TAGGCTCCACCTGTGGGGGCAGG + Intergenic
1194813525 X:98415538-98415560 TAGGCTCCACCTCCGGGGGCAGG + Intergenic
1194864907 X:99053849-99053871 TGGGCTGCAGCTTCAGGGGGTGG + Intergenic
1195233672 X:102876764-102876786 TAGGCTCCACCTCCGGGGGCAGG - Intergenic
1195418051 X:104641710-104641732 TGGGCTGCAGCTGCCGGTCTTGG - Intronic
1196359526 X:114836171-114836193 TAGGCTCCACCTCCGGGGGCAGG - Intronic
1200116825 X:153773145-153773167 AGGGCTTCTCCTACGGGGGTTGG + Intronic
1200385007 X:155881459-155881481 TGGGGTGCGCCTGCGGGAGGCGG + Intronic
1201072902 Y:10165662-10165684 TAGGCTCCACCTCTGGGGGTAGG - Intergenic