ID: 947877279

View in Genome Browser
Species Human (GRCh38)
Location 2:233476111-233476133
Sequence GACTGTTGGGAGGAGTATGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947877279 Original CRISPR GACTGTTGGGAGGAGTATGA GGG Exonic
900553657 1:3269218-3269240 GACAGCTGGGAGGAGGAGGACGG + Intronic
901414328 1:9106319-9106341 GACTGTAGGGGGGAGCAGGAGGG - Intronic
901862507 1:12083915-12083937 GCCTTTTGGGAGGAGTGTGTGGG + Intronic
903472076 1:23594225-23594247 GACTGTTGTGAGGTGTAAGTGGG + Intronic
903832615 1:26183910-26183932 GCCTGTTGGGGGGGGTCTGAAGG - Intronic
904610391 1:31722884-31722906 GAGTGGAGGGAGGAATATGATGG + Intergenic
905014731 1:34770000-34770022 GTTTGTTGGCAGGAGAATGAGGG + Intronic
905199678 1:36307305-36307327 GACCGTTTGGGGGAGGATGATGG + Intronic
905304763 1:37009887-37009909 GACTGTTGGGGGGAGCTTGGAGG + Intronic
908332919 1:63088281-63088303 GACTGGTGGGAAGGGTAAGAGGG + Intergenic
910905813 1:92176410-92176432 GACTGTTGTGAGGATTAAGTGGG + Intronic
915106834 1:153540018-153540040 GACTTTGGGGTGGAGGATGAGGG + Intronic
915839110 1:159201273-159201295 GAGTGTTAGGAGGAGAGTGAAGG + Exonic
916343688 1:163764298-163764320 GCCTGTTGGGATGAGGACGAGGG + Intergenic
916453230 1:164941817-164941839 GAAGGGTGGGAGGAGCATGAGGG - Intergenic
916579888 1:166097507-166097529 GACTGTTGCGGGGAGCATGGTGG + Intronic
916865920 1:168858524-168858546 GCCTGTTGGGTGAGGTATGAGGG + Intergenic
917253255 1:173086215-173086237 CACTGTTGGCAGGAGAATGGAGG + Intergenic
918301767 1:183210730-183210752 GACTGTTATGAGGACTAAGAAGG - Intronic
920122676 1:203670549-203670571 GACTGTTGGGTGTAGGCTGATGG - Intronic
920174182 1:204089867-204089889 CACAGTTGGGAAGAGAATGAGGG - Intronic
921852877 1:219949599-219949621 GACTGTTGGGGGGAGCGGGAAGG + Intronic
923028327 1:230225162-230225184 GACTGTTTGGAGGATTATTAAGG + Intronic
923658715 1:235940436-235940458 GTCAGTTGGGAGGAGAATGAGGG - Intergenic
923660081 1:235950204-235950226 GGCTCTTGGCAGGAGTGTGAAGG + Intergenic
1063705240 10:8423931-8423953 GAAGGTTGGGAGGAGGGTGAGGG + Intergenic
1064252833 10:13719987-13720009 GATAGTTGGGAGGAGAATGGAGG - Intronic
1065997445 10:31071967-31071989 GTCTGATGGGAGAAGTAGGAGGG + Intergenic
1067708785 10:48632109-48632131 GAAGGTTGGGAGGAGGTTGAGGG - Intronic
1071491065 10:86136746-86136768 GATTGTTGGCAGGAGATTGAGGG - Intronic
1071774642 10:88771823-88771845 AACTATGGGGAAGAGTATGAGGG - Intronic
1073980332 10:109146735-109146757 GACTGTTGGGGTGAGGAGGAAGG + Intergenic
1078157126 11:8808736-8808758 GACTGTTGGGAGGAGCCAGTGGG - Intronic
1078370310 11:10739165-10739187 GAGTGCTGGCAGGAATATGAGGG + Intergenic
1079521012 11:21327187-21327209 GACTGTTGTGGGGTGTAGGAAGG + Intronic
1080978424 11:37370524-37370546 GGATGGTGGGAGGAGGATGAGGG + Intergenic
1081857309 11:46312007-46312029 GATTGTAGGGAGGGGTCTGAGGG + Intronic
1082872679 11:57958113-57958135 GATTGAGGGGAGAAGTATGAAGG + Intergenic
1084022486 11:66426064-66426086 GACTGTTGGGGGGATTCTGAGGG + Exonic
1085184051 11:74560266-74560288 AGCTGTTGGGAGAAGTGTGATGG - Intronic
1087631897 11:100660040-100660062 GAAGGTTGGGAGGGGTGTGAAGG + Intergenic
1089603365 11:119628084-119628106 GACTGCTGGGAGGGACATGATGG - Intronic
1089970138 11:122686658-122686680 GGCGTTTGGGAGGAGAATGAAGG + Intronic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1092481911 12:8867095-8867117 GACAGTTGGAAGGAGTATAAGGG - Intronic
1095958075 12:47818003-47818025 GACTATGGAGAGGAGAATGAAGG - Intronic
1096773232 12:53949649-53949671 GACTTCTGGGAGGAGGAGGAGGG + Intergenic
1096859794 12:54517004-54517026 AAATGTTGGGAGGGGAATGATGG + Intronic
1097465816 12:59923278-59923300 GAAGGTTGGGAGGAATGTGAGGG - Intergenic
1098115309 12:67169791-67169813 GACTGGTGTGAGTAGTATGAGGG + Intergenic
1101562926 12:105876488-105876510 GAGCGTTGGGAGGAGCATAAAGG + Intergenic
1102727808 12:115080937-115080959 GATTATTGGGAGGATTATGTGGG + Intergenic
1102748989 12:115275687-115275709 GAAGGGTGGGAGGAGGATGAGGG + Intergenic
1108506262 13:51115414-51115436 AACTGTAGGGAGGAAAATGATGG - Intergenic
1108541888 13:51452957-51452979 GGCTGTTGGGAGAAGTTTCAGGG + Exonic
1109042793 13:57361547-57361569 GAAAGGTGGGAGGAGGATGAGGG + Intergenic
1110803589 13:79729044-79729066 GAGTTTTGGGAGGAGTCTGTTGG + Intergenic
1112045653 13:95594903-95594925 GACAGTTTGGAGAAGAATGATGG + Intronic
1113364118 13:109660664-109660686 GAAGGCTGGGAGGAGGATGAGGG + Intergenic
1114345931 14:21795202-21795224 GAGAGTGGGGAGGAGTTTGAGGG - Intergenic
1115036390 14:28861975-28861997 GAAAGGTGGGAGGAGGATGAAGG - Intergenic
1115711877 14:36059663-36059685 GACAGGAGGGAGGAGTAGGAAGG - Intergenic
1116688578 14:48075286-48075308 GACCCATGAGAGGAGTATGAAGG + Intergenic
1119621070 14:76132231-76132253 GACTGTGCAGAGGATTATGATGG - Intergenic
1120325312 14:83016803-83016825 AAATGTTGGGAGGGGTGTGAGGG + Intergenic
1120665539 14:87302059-87302081 GAAGGTTGGGAGGAGTGTGAGGG + Intergenic
1124692695 15:31838870-31838892 GACTGTTGAGTGGATTATAAAGG - Intronic
1125676719 15:41505967-41505989 GCCTTTGGGGAGGTGTATGAGGG - Exonic
1126541054 15:49824661-49824683 GACTGTGGTGAGAAGAATGAAGG + Intergenic
1127557070 15:60098028-60098050 GAATGTTGGTAGGAATATAAAGG - Intergenic
1128565587 15:68698749-68698771 GGCTGTTGTGATGAGGATGAAGG + Intronic
1129694667 15:77733880-77733902 GAGTCTTGGAAGGAGTTTGAAGG - Intronic
1130423864 15:83775703-83775725 GACTGTTGTGAGCACTTTGATGG + Intronic
1130610877 15:85359991-85360013 GACTGTTGTGAGGTATATGAAGG + Intergenic
1133483798 16:6198115-6198137 GACTTTTGGGGGAAGGATGAGGG + Intronic
1133496192 16:6320092-6320114 GAAGGTTGGGAGGAGGTTGAGGG + Intronic
1134885783 16:17790240-17790262 GACTGATGGATGGAGGATGATGG + Intergenic
1135340634 16:21644287-21644309 TACTTTGGAGAGGAGTATGAAGG + Exonic
1139506763 16:67402048-67402070 GGCTGCTGGGAGGAGGAGGAAGG - Intronic
1140110098 16:71996825-71996847 CACTTTGGGTAGGAGTATGAAGG + Intronic
1140897571 16:79338444-79338466 CACTTTTGGGAGCAGAATGAAGG + Intergenic
1142361448 16:89629538-89629560 GCCTGCTGGGAGGAGCAGGAGGG - Intronic
1142939182 17:3367351-3367373 GAAGGGTGGGAGGGGTATGAGGG - Intergenic
1144051045 17:11497362-11497384 GACTGCTGTGAGGAGAAAGAGGG + Intronic
1146482354 17:33214841-33214863 GTCTGTTGGGAGGATTAAGAAGG - Intronic
1146767893 17:35540543-35540565 GAAGGGTGGGAGGAGGATGAGGG - Intergenic
1147745979 17:42694861-42694883 TACTGGTGGGAGGAGTGTGGGGG + Intronic
1148334176 17:46830683-46830705 GACTTTTGGGAGCATTTTGATGG + Intronic
1149484907 17:57035017-57035039 GATTGTTTGGAGGAGTCTGAAGG - Intergenic
1149575070 17:57706040-57706062 GACGGGTGAGAGGAGTCTGAAGG + Intergenic
1150473172 17:65454844-65454866 GACTGGCGGGTGGAGTATAAAGG - Intergenic
1151539270 17:74756962-74756984 GACTTCTGGGAGGAGGGTGAGGG + Intronic
1153474792 18:5487708-5487730 GACTTTTGGGAGGCTTAGGAGGG - Intronic
1155922736 18:31619398-31619420 GACTGTGGGGAGGAGAAAAAGGG + Intergenic
1157665142 18:49479728-49479750 GGCTGGAGGGAGGAGAATGAAGG - Intronic
1158407203 18:57170432-57170454 GACTGTTGTGAGGAGTCTTTTGG - Intergenic
1159174293 18:64813943-64813965 CACTGTTGGCAGGAGTAGGGCGG - Intergenic
1159509557 18:69378784-69378806 GACTATAGGAATGAGTATGAGGG - Intergenic
1160614584 18:80115084-80115106 CACTTTTGGGAGGAGTGTTAGGG + Intronic
1161059770 19:2209125-2209147 GACAGTGGGGAGGAGCAGGAAGG - Intronic
1161331592 19:3691012-3691034 GACCGTCGGGAGGAGTGGGAGGG + Intronic
1161975377 19:7605530-7605552 GACTGGCGGGAGGAGCTTGAGGG - Intronic
1162506636 19:11089793-11089815 GAGGGTCGGGAGGAGTCTGAGGG + Intronic
1163221169 19:15922252-15922274 GAATGTAGGGAGGAGGAGGATGG + Intronic
1166122451 19:40693713-40693735 GGCTGTTGGGAGGATAAAGAAGG + Intronic
1167148726 19:47696874-47696896 GGCTGTTGGGAGGATGATGGGGG + Intronic
1168108458 19:54178940-54178962 GACTGGGGGGTGGAGGATGAGGG + Exonic
926332599 2:11837842-11837864 GACTGTTGGGCCAAGTAAGATGG - Intergenic
927933142 2:27058576-27058598 GACTTTTGGGTGGAGTTCGAAGG - Exonic
928196883 2:29222569-29222591 GCCTTTGGGGAGGTGTATGAAGG - Exonic
929277364 2:40040968-40040990 AAGTGTTGGGAGGGGGATGAGGG - Intergenic
931440959 2:62290150-62290172 GGCTGTGGTGGGGAGTATGAAGG + Intergenic
932394762 2:71434950-71434972 GACTGATGGGGAAAGTATGATGG + Exonic
932771922 2:74505283-74505305 GATGGTTGGGGGGAGTCTGAAGG + Intronic
933168905 2:79103601-79103623 GACTGCTGGAGGGAATATGATGG - Intergenic
935823872 2:106922205-106922227 CACTGTAGGAAAGAGTATGAGGG - Intergenic
941593978 2:167452718-167452740 GATTTTTGGGAGGAAAATGATGG - Intergenic
944573463 2:201068529-201068551 TACGGATGGGAGGAGTGTGAAGG - Intronic
945391421 2:209269862-209269884 GACTGTGGGAAGGAGTGGGAAGG - Intergenic
947877279 2:233476111-233476133 GACTGTTGGGAGGAGTATGAGGG + Exonic
948946374 2:241222349-241222371 CACTGCTGGAAGGAGTAAGATGG - Intronic
1168799888 20:637639-637661 GACTGTTGGGAAGAGCATGGCGG + Intergenic
1169264610 20:4160322-4160344 GTATGTGGGGAGGAGTAAGATGG + Intronic
1170350450 20:15435023-15435045 GACGGGTGGGAGGGGTTTGAGGG + Intronic
1170973841 20:21141782-21141804 GTGTGTTGGGAGGAGTAATAAGG - Intronic
1171263753 20:23753690-23753712 TGCTGGTGGGTGGAGTATGAGGG + Intergenic
1173202696 20:40965923-40965945 GTCTCTTTGGAGGAGGATGAGGG + Intergenic
1175027317 20:55915859-55915881 GAAGGTTGGGAGGGGGATGAGGG + Intergenic
1177906154 21:26973410-26973432 GATTGTTGGCAGTAGTCTGATGG + Intergenic
1181359443 22:22323384-22323406 GAGTGATGGGAGGAGGGTGAGGG - Intergenic
1181369530 22:22405127-22405149 GAGTGATGGGAGGAGGGTGACGG - Intergenic
1183885422 22:40877003-40877025 GACTGACTGGAGGAGCATGAGGG - Intronic
1185310231 22:50150272-50150294 CACTGTGGGGCGGAGCATGAAGG + Intronic
949300053 3:2573388-2573410 TACTGCTGGGAGGAAGATGAAGG - Intronic
949901171 3:8815885-8815907 GACTGTGGGGGGGAGTGAGATGG - Intronic
950615513 3:14154966-14154988 GCCTGTTGGGAAGAGAATGCAGG - Intronic
950928623 3:16767476-16767498 GAGTGTTGTAAGGAGAATGATGG - Intergenic
951487377 3:23229000-23229022 GAATGTTGGGAGGGGGATGCTGG - Intronic
952099120 3:29991184-29991206 GACTGTTGGTAAGAATATGCAGG - Exonic
953040419 3:39250918-39250940 GGATGTTGGGAGGAATATGATGG + Intergenic
953282818 3:41575277-41575299 GAATGTTTGGAGTAGGATGAAGG + Intronic
953874231 3:46656549-46656571 GACAGTTGGGAGCAGAGTGAAGG + Intergenic
954653388 3:52178805-52178827 CACAGTTGGGAGCAGTATCAAGG + Intergenic
955302996 3:57801123-57801145 GACTGCTGGGATGAGAAGGAGGG - Intronic
956432911 3:69205561-69205583 GATGGTTGGGAGGAGTGGGAGGG - Intronic
958798936 3:98733816-98733838 GACAGTGGGGAGGAGCAGGAGGG + Intronic
963863055 3:150330578-150330600 GACTCTTGGGAGGGGTTTGCTGG - Intergenic
965802715 3:172511168-172511190 GATTGTTGGGAAAAGGATGATGG + Intronic
966912543 3:184567385-184567407 GAGTGTTGGGGGCAGGATGAGGG + Intronic
967073676 3:185983552-185983574 GAATTTTGGGAGGCATATGAAGG - Intergenic
967963915 3:194945685-194945707 GGCTGTTGGGAGGGGCAGGAGGG + Intergenic
969975904 4:11101189-11101211 GACTGTTGGGAGGCCAATGTGGG + Intergenic
971528443 4:27653027-27653049 CACTGTTGGAAGGGGCATGAGGG + Intergenic
972529564 4:39949465-39949487 GACTGTGGGGAGGAATATGAGGG + Intronic
979794918 4:124834504-124834526 GGCTGTTGGGGGGAACATGATGG - Intergenic
980523503 4:133960712-133960734 GGCTGTTAGGGGGAGCATGATGG + Intergenic
981529479 4:145738007-145738029 GAGTGTTGGGAGGAATTTTAAGG + Intronic
982402585 4:154984610-154984632 GACTATGGGAAGGAGGATGAAGG - Intergenic
983437835 4:167738019-167738041 GACTGTTGTGAGGAGGAAGGTGG + Intergenic
984691251 4:182728373-182728395 ATCTATTGGTAGGAGTATGAAGG - Intronic
985586453 5:740128-740150 GAGTGGTGGGAGGAGGGTGATGG + Intronic
985601041 5:832305-832327 GAGTGGTGGGAGGAGGGTGATGG + Intronic
987171128 5:15259295-15259317 GACTATTGGTAAGTGTATGAGGG - Intergenic
988462277 5:31450682-31450704 GAGTGTTGGGAGGGGGGTGAGGG + Intronic
991948335 5:71923361-71923383 AAGTGTTGGAAGGAGTATGAAGG + Intergenic
993364753 5:87021829-87021851 GAAGGTTGGGAGGAGGGTGAGGG - Intergenic
993447935 5:88037600-88037622 GAAGGTTGGGAGGGGGATGAGGG - Intergenic
995478111 5:112568369-112568391 GTCAGTTGGGAGGAGTCTTAGGG - Intergenic
997420466 5:133762992-133763014 AACTGTTAGGAAGAGGATGAAGG - Intergenic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
1000338852 5:160261618-160261640 GAGTGTTGGGGGGAGTATGGGGG - Intronic
1001428221 5:171638871-171638893 GGCTGTTGGAAGGACTAAGAGGG + Intergenic
1001911933 5:175527303-175527325 GACTTTTGGAAGGGGTGTGAAGG - Exonic
1002568591 5:180127768-180127790 GACTGTTGTGAGGAGGACTAGGG - Intronic
1005219494 6:23570696-23570718 GAATATAGGGAGGAATATGAAGG - Intergenic
1005518619 6:26578278-26578300 GGATGATGGGAGGAGGATGAGGG - Intergenic
1006036010 6:31212732-31212754 CATTGCTGGAAGGAGTATGAAGG + Intergenic
1006373478 6:33659276-33659298 GCCTGTGGGGTGGAGAATGAGGG - Intronic
1007421462 6:41722397-41722419 GTCTGCTGGGAGGGGTGTGAGGG - Intronic
1007902144 6:45422401-45422423 GACTGCCGGGCGGAGTCTGATGG - Intronic
1008110231 6:47484109-47484131 AAAAGCTGGGAGGAGTATGAGGG - Intronic
1009462603 6:63932686-63932708 TTCTGTTGGGTGGAGTGTGAGGG - Intronic
1010771697 6:79839494-79839516 GAGGGTTGAGGGGAGTATGATGG - Intergenic
1011560197 6:88606377-88606399 GACTGTGGGGCAGAGTTTGATGG - Intergenic
1013254619 6:108372002-108372024 GCCTTTTGGGAGGACTAGGAGGG - Intronic
1016525733 6:144999866-144999888 GTATGTTGGGAGGTGTATTATGG - Intergenic
1021498603 7:21304332-21304354 GAGGGGTGGGAGGAGGATGAGGG + Intergenic
1022282743 7:28927440-28927462 GAGAGTTGGGAGGAGTTTTAGGG + Intergenic
1023329330 7:39098144-39098166 GAATTTTGGGAGGAGAATAAAGG - Intronic
1026828272 7:73596995-73597017 GACTCTTGGGAGGGGCAGGATGG - Intronic
1026938789 7:74274699-74274721 GACTGTGGGTAGGAGAAGGAAGG + Intergenic
1028009492 7:85622902-85622924 GAATGATGGGAAGAGTATGTGGG - Intergenic
1028461117 7:91094016-91094038 GACTATTGGGAGGAGGGGGAGGG + Intronic
1030052009 7:105546316-105546338 GTCTGTCAGGAGGAGTAGGAAGG + Intronic
1030077193 7:105746901-105746923 GACTGCGGGCAGGAGTAGGAGGG + Intronic
1030363598 7:108621806-108621828 GATTGTTGGGAATAGAATGATGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034403561 7:150885030-150885052 GAAGGTTGAGAGGAGGATGAGGG + Intergenic
1036476740 8:9100147-9100169 GACTGATGGGGAAAGTATGATGG + Intronic
1037032745 8:14128933-14128955 GACGGTGGAGAGGAGGATGAGGG + Intronic
1039524490 8:38202068-38202090 GACTCTTGAGAGGAGCATGGAGG + Intronic
1041021949 8:53646986-53647008 GTCTGTTGGGAGGCTTATGTGGG - Intergenic
1041139148 8:54796236-54796258 GATTGTTGTGAGGATTATGTGGG + Intergenic
1041314547 8:56547353-56547375 GACTGTTTTGAGGAGTAATAAGG - Intergenic
1042477858 8:69269356-69269378 GAGGGTTGGGAGGAGAGTGAGGG - Intergenic
1042897488 8:73686587-73686609 GAAGGTTGGGAGGGGAATGAGGG + Intronic
1045589276 8:103575819-103575841 GATTGTGGGGAGGAGCATCATGG - Intronic
1049228531 8:141470004-141470026 GACAGATGGGAGCAGTAGGATGG - Intergenic
1051401371 9:16687021-16687043 GAGTGTTGAGAGGAAAATGAGGG - Intronic
1052208653 9:25873876-25873898 GAATATTGGGAGGAAGATGAGGG - Intergenic
1055289820 9:74770896-74770918 GGCTTTTGGGAGAAGTATTACGG - Intronic
1055734927 9:79316726-79316748 TACTGGTGGGAGGAGAATAATGG - Intergenic
1056881231 9:90395853-90395875 GACAGTGGGGAGGAGAAAGAAGG - Intergenic
1057577384 9:96254279-96254301 TGCTGTTGGCAGGAGGATGAGGG - Intronic
1057950717 9:99367243-99367265 GACTGTTGGGAGGAAAAACATGG + Intergenic
1059706772 9:116831206-116831228 GAAGGGTGGGAAGAGTATGAGGG + Intronic
1060512291 9:124242879-124242901 GACCATCTGGAGGAGTATGAAGG - Intergenic
1060934585 9:127507822-127507844 GACTGTTGCCAGGAGGATGCTGG - Intronic
1191766612 X:64705305-64705327 GAATGTTAGGAGGAGCATGTCGG - Intergenic
1192954973 X:76059914-76059936 GAAAGTTGGGAGCAGGATGAGGG + Intergenic
1194013978 X:88597065-88597087 AAAGGTTGGGAGGAGGATGAGGG - Intergenic
1197376931 X:125691664-125691686 ACCTGTGAGGAGGAGTATGAGGG - Intergenic
1200203605 X:154299625-154299647 GACTTTGGGGAGGAGAATGAAGG - Intronic
1200872850 Y:8122011-8122033 GGCAGATGGGAGGAGTAGGAAGG + Intergenic
1201463072 Y:14249644-14249666 GACTGTAGGGAGGAGAGGGAAGG + Intergenic