ID: 947878105

View in Genome Browser
Species Human (GRCh38)
Location 2:233480941-233480963
Sequence CCGGGGGGCCATGGATCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947878087_947878105 20 Left 947878087 2:233480898-233480920 CCAGGCAGAGGGTGAGGCTGCGG 0: 1
1: 0
2: 8
3: 50
4: 513
Right 947878105 2:233480941-233480963 CCGGGGGGCCATGGATCTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 132
947878085_947878105 27 Left 947878085 2:233480891-233480913 CCAAGAGCCAGGCAGAGGGTGAG 0: 1
1: 0
2: 4
3: 63
4: 500
Right 947878105 2:233480941-233480963 CCGGGGGGCCATGGATCTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947878105 Original CRISPR CCGGGGGGCCATGGATCTGC GGG Intronic
900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG + Exonic
903938656 1:26913751-26913773 CCGGGAGGCCTTGGATGTTCTGG - Exonic
905106317 1:35565576-35565598 CCGGGAGGCCATGAGGCTGCAGG + Exonic
906319321 1:44806657-44806679 CCTGCTGGCCATGGACCTGCTGG + Exonic
914474444 1:148011731-148011753 CCGTGGGCCCATGGGTCTTCCGG + Intergenic
914513239 1:148352721-148352743 TGGGGTGGCCTTGGATCTGCTGG + Intergenic
919811447 1:201411395-201411417 CAAGGTGTCCATGGATCTGCGGG - Exonic
919914304 1:202130331-202130353 CCGGGGGCCCAGGGATGGGCAGG + Exonic
923036635 1:230289031-230289053 CTGGGGGGCCATGCTTGTGCTGG + Intergenic
1065857366 10:29841426-29841448 CCGGGAGGTCATGGATGTGGTGG - Intergenic
1069911322 10:71761607-71761629 CCATGGTGCCATGGAGCTGCAGG - Exonic
1070759917 10:79017675-79017697 CTGGGGGGCCCTGCATCTCCTGG - Intergenic
1070771482 10:79085003-79085025 CCAGGGGCCCTTGGCTCTGCCGG + Intronic
1070843851 10:79506495-79506517 CCGGGAGGACAAGGAGCTGCAGG + Intergenic
1072737958 10:97891810-97891832 CAGAGGGGCCTTGGAGCTGCAGG + Intronic
1075397859 10:122140963-122140985 CTGTGGGGCCTTGGATCTGAGGG + Intronic
1077456142 11:2682098-2682120 CTAGGGAGCCGTGGATCTGCAGG + Intronic
1082066551 11:47905533-47905555 CCGGGCGGCCACGGCTTTGCTGG + Intergenic
1083149623 11:60783642-60783664 CTGGGGGTCCCTGGATCTGGGGG + Intergenic
1083482681 11:62959783-62959805 CCAGGGTGACTTGGATCTGCTGG + Intronic
1083486262 11:62984621-62984643 CCAGGGTGACCTGGATCTGCTGG + Exonic
1090428887 11:126629564-126629586 CAGGGTGGACATGGATCTGGAGG - Intronic
1096341724 12:50806471-50806493 CCTGAGCCCCATGGATCTGCTGG - Intronic
1104627088 12:130366384-130366406 CAGAAGGGCCAGGGATCTGCCGG + Intronic
1104721802 12:131048558-131048580 CCGGGGCTCCATGGATTTGCGGG + Intronic
1109509463 13:63351146-63351168 CCTGGAAGCCATGGATTTGCTGG + Intergenic
1110548861 13:76789606-76789628 CCAGGGGGCCCTGAATCAGCTGG + Intergenic
1112564757 13:100543903-100543925 CTGGTGGGCCCAGGATCTGCTGG - Intronic
1114482104 14:23042339-23042361 GTCTGGGGCCATGGATCTGCAGG - Exonic
1119204465 14:72783853-72783875 CCGTGGGCCCAGGGCTCTGCAGG - Intronic
1121440388 14:93945159-93945181 CCAGAGGGACATGGATGTGCAGG + Intronic
1129176072 15:73840678-73840700 CAGAGTGGCCTTGGATCTGCTGG - Intergenic
1129295820 15:74599506-74599528 CCGGGGGCACATGGCTCAGCCGG + Intronic
1130764658 15:86857749-86857771 CCTGGGGGCCAGGGATGTCCTGG - Intronic
1131265627 15:90913577-90913599 CCCGGGTGCCCTTGATCTGCTGG + Intronic
1131440309 15:92454730-92454752 CCAGGGGCCCCTGGCTCTGCTGG + Intronic
1133502245 16:6377409-6377431 CTGGGGGGCCATGGATTTCTGGG + Intronic
1133530525 16:6651236-6651258 CAGGGAGGGCATGGATGTGCAGG - Intronic
1135268854 16:21051764-21051786 CTGGGTGGCCAAGGATGTGCAGG - Exonic
1135991650 16:27222228-27222250 CCGAGGGGCCATGGGCGTGCTGG + Intergenic
1136866904 16:33766544-33766566 TCTGGGGTCCATGGTTCTGCAGG - Intergenic
1139365745 16:66432517-66432539 CAGGGGTTTCATGGATCTGCGGG - Intronic
1140742332 16:77952566-77952588 CCAGGGGCTCATGGCTCTGCAGG - Intronic
1141643357 16:85354575-85354597 CTGGGGGGCCAGGGTTCTGCTGG - Intergenic
1142352852 16:89587793-89587815 ACGGGGGGCCGTGTATCTGTGGG - Intronic
1142352869 16:89587857-89587879 ACGGGGGGCCGTGTATCTGTGGG - Intronic
1142352888 16:89587932-89587954 ACGGGGGGCCGTGTATCTGTGGG - Intronic
1142352903 16:89587985-89588007 ACGGGGGGCCGTGTATCTGTGGG - Intronic
1142352911 16:89588012-89588034 ACGGGGGGCCGTGTATCTGTGGG - Intronic
1142352921 16:89588050-89588072 ACGGGGGGCCGTGTATCTGTGGG - Intronic
1142359286 16:89619110-89619132 CAGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359314 16:89619171-89619193 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359355 16:89619262-89619284 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359383 16:89619322-89619344 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1203105258 16_KI270728v1_random:1349658-1349680 TCTGGGGTCCATGGTTCTGCAGG + Intergenic
1203128256 16_KI270728v1_random:1612710-1612732 TCTGGGGTCCATGGTTCTGCAGG - Intergenic
1142522131 17:512477-512499 CCGGCGATCCATGGATCTGTGGG - Exonic
1144731671 17:17529641-17529663 CCGAGGGGCCATGGCACAGCGGG + Intronic
1145249341 17:21288830-21288852 CCGGGGGTCCTGGGCTCTGCTGG + Intronic
1147876209 17:43622426-43622448 CCTGTGGGCCATGGATGTGAGGG + Intergenic
1148437337 17:47694427-47694449 CCGGGGGCCCAGGGCTCGGCCGG + Intronic
1148864110 17:50619709-50619731 CCAGGGAGCCCTGGATCAGCAGG - Exonic
1154501333 18:14999328-14999350 CCGTGAGGCCGTGGAACTGCGGG + Intergenic
1160256218 18:77250539-77250561 CCCGCGGGCCATGGAGCTGGCGG + Exonic
1160397052 18:78580244-78580266 CCCGGGGGCCCTTCATCTGCAGG - Intergenic
1160588014 18:79923261-79923283 ACGGGGGGCCATGGACAGGCGGG + Intronic
1161542625 19:4861227-4861249 GCAGGGAGCCAGGGATCTGCCGG - Intronic
1162321185 19:9971221-9971243 CCTGGGGGCCCTAGATCTCCGGG + Exonic
1163308300 19:16496327-16496349 TCGGGGCGCCATTGGTCTGCGGG + Exonic
1166077646 19:40423072-40423094 CCTGGGTGCCTTGGACCTGCTGG - Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
926753739 2:16219791-16219813 CAGGAGGGCCATGGGTCTGTGGG + Intergenic
927491778 2:23525751-23525773 CGGGTGGGCCCTGGCTCTGCTGG - Intronic
927886850 2:26724097-26724119 CCAGGGGGCCCTGGAGCTTCTGG - Intronic
930198393 2:48530398-48530420 CCGGGAGGCCATCCCTCTGCGGG - Intronic
934761053 2:96857513-96857535 CCTGAGGGGCATGGAGCTGCAGG - Intronic
938500503 2:131829497-131829519 CCGTGAGGCCGTGGAACTGCGGG + Intergenic
946618020 2:221530573-221530595 CTGGGGGCCCATGGACCTCCTGG + Intronic
947878105 2:233480941-233480963 CCGGGGGGCCATGGATCTGCGGG + Intronic
1169037314 20:2463843-2463865 CCGGGGGCCCAGGGATCGGCAGG - Exonic
1170460488 20:16573107-16573129 CCGGTGGGCCAGGGACCAGCCGG + Intronic
1171346593 20:24470165-24470187 GCGGCGGGCCAAGGCTCTGCGGG + Intronic
1173227326 20:41169492-41169514 GCGGGGGGTCTTGGATGTGCCGG + Exonic
1175815093 20:61879186-61879208 CAGGGGGGCAGTGGCTCTGCTGG - Intronic
1175860907 20:62149519-62149541 GATGGGGGCCATGGAGCTGCAGG + Intronic
1177201403 21:17960737-17960759 CCGGGGAGCCATCGATGTGTAGG - Intronic
1179516856 21:41914509-41914531 CCGGGGGGCCTTGGATTCTCTGG - Intronic
1179723623 21:43329896-43329918 CCGTGTGTCCAGGGATCTGCTGG + Intergenic
1180159347 21:45992170-45992192 CCGGGGGGCCCAGGCTCTCCCGG - Exonic
1180560272 22:16609864-16609886 GCGGGGGTCCGGGGATCTGCAGG - Intergenic
1184572898 22:45337812-45337834 CCTGAGGGCCATGTGTCTGCAGG + Intronic
1184671050 22:46012521-46012543 CCGGGGGCCCATGTGGCTGCCGG - Intergenic
1184755801 22:46515113-46515135 CCGGGGGGGGTTGGCTCTGCTGG - Intronic
1184827873 22:46965363-46965385 ACGGTGAGCCATGGATGTGCAGG + Intronic
1185282013 22:49976170-49976192 CTGTGGGGCCATGGGGCTGCTGG + Intergenic
953816483 3:46162673-46162695 CCAGGGGGGTATGGATCTGTAGG + Intergenic
954329509 3:49882077-49882099 CAGGGGGGCCATGGAGCAGGAGG - Intergenic
961552499 3:127677235-127677257 CCGGGAGGACATGGCGCTGCTGG + Exonic
963081891 3:141402394-141402416 CCGGGGGTCCATGGTGCTTCCGG - Intronic
963870752 3:150410648-150410670 CCGGGGGGCCATGGCTTCGCTGG - Exonic
967054175 3:185813805-185813827 CCAGGGGGCAATGGGGCTGCAGG + Intronic
968631076 4:1651824-1651846 CCGGGGCTGCATGGATCTGAGGG + Intronic
969130782 4:4989836-4989858 CGGGTGGGCCATGTATGTGCAGG + Intergenic
969257888 4:6015004-6015026 CCTGGGGTCCATTGATCTTCTGG + Intergenic
979382278 4:120021005-120021027 CCTGGAGGCCATGGATTTGTAGG + Intergenic
985485008 5:143528-143550 CTGGGGTCCCATGGGTCTGCAGG - Intronic
985555541 5:556189-556211 CAGGGAAGCCATGGATCTGGTGG - Intergenic
987144595 5:14980107-14980129 CTGGAGGGCCATAGAACTGCTGG + Intergenic
990514484 5:56518951-56518973 ACGTGGGGGCATGGATCTGTGGG - Intronic
1000037524 5:157460311-157460333 CCCGGGCCCCATGGAGCTGCGGG + Exonic
1001191582 5:169637316-169637338 CCAGGGGGCCATGGCTGGGCCGG - Exonic
1002198701 5:177514804-177514826 CCAGGATGCCATGGGTCTGCCGG + Exonic
1012252284 6:96992212-96992234 CCCGGGAGCCATGGATCCCCTGG - Intronic
1013293498 6:108738674-108738696 CCAGTTGGCCATGGATGTGCCGG + Intergenic
1019437904 7:1031390-1031412 CCGGGGGGGCAGAGACCTGCAGG + Intronic
1019437917 7:1031427-1031449 CCGGGGGGGCAGAGACCTGCAGG + Intronic
1019437928 7:1031464-1031486 CCGGGGGACCAGAGACCTGCAGG + Intronic
1019437942 7:1031501-1031523 CCGGGGGGGCAGAGACCTGCAGG + Intronic
1019437999 7:1031686-1031708 CCGGGGGGGCAGAGACCTGCAGG + Intronic
1019512741 7:1426124-1426146 CCTGGGGGCCGGGGCTCTGCAGG - Intergenic
1019888024 7:3922241-3922263 TCGGGCAGCCATGGATCTGGGGG + Intronic
1027940977 7:84678991-84679013 ACGGGCTGCTATGGATCTGCTGG + Intergenic
1033214397 7:139483267-139483289 CTGGGCGCCCATGGAGCTGCAGG - Exonic
1033246443 7:139720361-139720383 CCCTGGGCCCATGGATCTGCTGG + Intronic
1034256208 7:149725944-149725966 TCGGGGGGCCAGGGGCCTGCTGG - Exonic
1035685971 8:1523603-1523625 CTGGGGGCCTCTGGATCTGCAGG + Intronic
1037915118 8:22768486-22768508 CCGTGGGGCCTTGGATTGGCAGG - Intronic
1040109745 8:43562029-43562051 CCGGGGGGCCATGGAGTCCCTGG - Intergenic
1040110494 8:43565033-43565055 CCAGGGGGCCATGGAGTTCCTGG - Intergenic
1042849386 8:73201059-73201081 CCTGGGGTCAAGGGATCTGCGGG + Intergenic
1046184079 8:110690354-110690376 CCGGCCGGCCATGCAGCTGCAGG - Intergenic
1047547962 8:125838592-125838614 CCTGGGGGCCATGGATCTCTGGG + Intergenic
1049311364 8:141935543-141935565 CCTGGGGGCCATCGTTCTGTTGG - Intergenic
1049849166 8:144821560-144821582 CCGAGGGGCCCTGGAGCTGCCGG - Intergenic
1053417085 9:37953618-37953640 CGGGGTGGCCATGGATGGGCAGG - Intronic
1060187839 9:121574774-121574796 CAGGGGGGCCTCGGTTCTGCTGG + Intronic
1061391178 9:130318016-130318038 CCTGGGGGCCAGGGCTCTGCAGG + Intronic
1061700325 9:132410537-132410559 CCGCGGGGCCAGGGCGCTGCGGG - Intronic
1062117141 9:134815591-134815613 CCGGGGGGGCCAGGATCTCCAGG - Exonic
1062321569 9:135992881-135992903 CCGGGCGGGCGTGGCTCTGCCGG + Intergenic
1062499193 9:136845071-136845093 CCGTGAGGCCGTGGAACTGCGGG - Exonic
1062543299 9:137051066-137051088 ACTGGGGGCCATGGACCTGGGGG - Exonic
1203783739 EBV:115617-115639 CCGGGGGGCCCAGGATCTATAGG + Intergenic
1200063977 X:153496081-153496103 CAGGGGGCCCAGGGATCTGCAGG + Intronic