ID: 947885834

View in Genome Browser
Species Human (GRCh38)
Location 2:233570277-233570299
Sequence CTGTTTCAGGAGTGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947885834_947885852 29 Left 947885834 2:233570277-233570299 CCCCTCTGCCACTCCTGAAACAG No data
Right 947885852 2:233570329-233570351 TCCTCAACAGCCCACTCAATGGG No data
947885834_947885851 28 Left 947885834 2:233570277-233570299 CCCCTCTGCCACTCCTGAAACAG No data
Right 947885851 2:233570328-233570350 CTCCTCAACAGCCCACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947885834 Original CRISPR CTGTTTCAGGAGTGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr