ID: 947889282

View in Genome Browser
Species Human (GRCh38)
Location 2:233602813-233602835
Sequence CTTTCTGGGCAGAGGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947889273_947889282 14 Left 947889273 2:233602776-233602798 CCTTACTGTCTTTCCTTGGGCCA No data
Right 947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG No data
947889275_947889282 -6 Left 947889275 2:233602796-233602818 CCATGAAATGCCAATTCCTTTCT No data
Right 947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG No data
947889274_947889282 1 Left 947889274 2:233602789-233602811 CCTTGGGCCATGAAATGCCAATT No data
Right 947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947889282 Original CRISPR CTTTCTGGGCAGAGGGCATT TGG Intergenic
No off target data available for this crispr