ID: 947889731

View in Genome Browser
Species Human (GRCh38)
Location 2:233606326-233606348
Sequence CAAAACGCTGATAAAAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947889731_947889734 8 Left 947889731 2:233606326-233606348 CCCATATTTTTATCAGCGTTTTG No data
Right 947889734 2:233606357-233606379 CATTTAACCAGTCTCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947889731 Original CRISPR CAAAACGCTGATAAAAATAT GGG (reversed) Intergenic
No off target data available for this crispr