ID: 947889734

View in Genome Browser
Species Human (GRCh38)
Location 2:233606357-233606379
Sequence CATTTAACCAGTCTCTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947889731_947889734 8 Left 947889731 2:233606326-233606348 CCCATATTTTTATCAGCGTTTTG No data
Right 947889734 2:233606357-233606379 CATTTAACCAGTCTCTAAGAAGG No data
947889730_947889734 22 Left 947889730 2:233606312-233606334 CCTGGTGCTCATAGCCCATATTT No data
Right 947889734 2:233606357-233606379 CATTTAACCAGTCTCTAAGAAGG No data
947889732_947889734 7 Left 947889732 2:233606327-233606349 CCATATTTTTATCAGCGTTTTGG No data
Right 947889734 2:233606357-233606379 CATTTAACCAGTCTCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947889734 Original CRISPR CATTTAACCAGTCTCTAAGA AGG Intergenic
No off target data available for this crispr