ID: 947895308

View in Genome Browser
Species Human (GRCh38)
Location 2:233665892-233665914
Sequence TCTCATATGCAGGTGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947895308_947895315 7 Left 947895308 2:233665892-233665914 CCTCCCACCACCTGCATATGAGA 0: 1
1: 0
2: 1
3: 27
4: 246
Right 947895315 2:233665922-233665944 CTGTTCATACTCACCAACACTGG 0: 1
1: 1
2: 0
3: 19
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947895308 Original CRISPR TCTCATATGCAGGTGGTGGG AGG (reversed) Intronic
900947000 1:5836685-5836707 TCTCTTAAGCAGGTGGAGGCAGG - Intergenic
902123842 1:14191821-14191843 TCACACAGGCAGGTGATGGGTGG + Intergenic
902962367 1:19973993-19974015 TTTCATAGGTAGCTGGTGGGAGG - Intergenic
904319142 1:29685185-29685207 TCTGATCAGCAGGAGGTGGGGGG + Intergenic
904332585 1:29771913-29771935 TCTCATACACTGCTGGTGGGAGG + Intergenic
904480234 1:30788736-30788758 TCTGCCAGGCAGGTGGTGGGAGG + Intergenic
904955413 1:34279629-34279651 TCTGAAATCAAGGTGGTGGGAGG + Intergenic
906376027 1:45297369-45297391 TATGATATTTAGGTGGTGGGAGG + Intronic
906671675 1:47659823-47659845 TCTCAAATGTTGTTGGTGGGAGG + Intergenic
908097555 1:60755236-60755258 ACTCATATGCTGCTGGTGGGAGG - Intergenic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
911104484 1:94119052-94119074 TCACATAGGCAGGGGCTGGGAGG + Intronic
912506243 1:110158485-110158507 TCTCACATGAAGGTGGTAGCTGG + Intronic
913259235 1:116983334-116983356 TGTCACCTGCAGGTGCTGGGTGG - Intronic
913597985 1:120396018-120396040 TCTCAGCTGCAGGTCCTGGGTGG - Intergenic
914089344 1:144483302-144483324 TCTCAGCTGCAGGTCCTGGGTGG + Intergenic
914309267 1:146450913-146450935 TCTCAGCTGCAGGTCCTGGGTGG - Intergenic
914512417 1:148345644-148345666 TCTCAGCTGCAGGTCCTGGGTGG + Intergenic
914592844 1:149122224-149122246 TCTCAGCTGCAGGTCCTGGGTGG + Intergenic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
915837762 1:159191522-159191544 TCTTATATGTAGGTGGTGGCAGG + Intronic
916674540 1:167054573-167054595 TGTCCTCTGCAGCTGGTGGGTGG - Intronic
917598331 1:176552093-176552115 TCTCAGAGGCAGGTGAAGGGAGG - Intronic
918205611 1:182306393-182306415 TCTCATATTCTGCTGGTAGGTGG - Intergenic
918444390 1:184602258-184602280 TTTCACATGCTGGTGGTGGGAGG + Intronic
919025971 1:192170928-192170950 TCTCAAATGCAGGTGGTGAAAGG + Intronic
920196540 1:204230992-204231014 TCTAAAATCCAGGTGGTGGCAGG - Intronic
920749074 1:208657189-208657211 TCTCAGATTTAGTTGGTGGGAGG + Intergenic
921709592 1:218360466-218360488 TCTCACATGCACGTAGTGAGGGG + Intronic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922970309 1:229730495-229730517 TCTCAGATCCAGGTGATGGATGG + Intergenic
1063181688 10:3607226-3607248 TCTCCTCTGCAGGTTCTGGGGGG - Intergenic
1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG + Intergenic
1063721635 10:8588307-8588329 TCTCATTGGCAGGGGCTGGGTGG + Intergenic
1063903861 10:10763294-10763316 TCTCATGTGCAGTGAGTGGGAGG - Intergenic
1064305068 10:14158115-14158137 TGTCATATAAAGGTGGGGGGTGG + Intronic
1065094979 10:22271705-22271727 TCCCTCGTGCAGGTGGTGGGAGG + Intergenic
1065471441 10:26086023-26086045 ACTCATTTGCAGGTAGGGGGAGG + Intronic
1065482719 10:26211831-26211853 TTTCACTTGCAGGTGCTGGGCGG + Exonic
1067469862 10:46528369-46528391 TCTCATGTCCTGGTGGGGGGGGG + Intergenic
1067767053 10:49094771-49094793 TCTCAGTGGCAGGGGGTGGGGGG + Intronic
1069063057 10:63914247-63914269 ACTCATCATCAGGTGGTGGGGGG - Intergenic
1069197298 10:65569066-65569088 TCTCATACGTTGCTGGTGGGAGG - Intergenic
1070572178 10:77648572-77648594 ACTAACAGGCAGGTGGTGGGTGG + Intergenic
1071712681 10:88065009-88065031 TCTCAATTTCAGGTGGGGGGAGG + Intergenic
1071817587 10:89248810-89248832 TATCAACTGGAGGTGGTGGGTGG - Intronic
1074712656 10:116190329-116190351 TCTCATGTCCAGGTAGTGAGAGG - Intronic
1075426432 10:122345272-122345294 ACTCATATGCTGCTAGTGGGAGG + Intergenic
1076498692 10:130917121-130917143 GCTGAAATGCAGGTGGTGGCAGG - Intergenic
1077522226 11:3043216-3043238 TCTCAGATGCAGGTTGTGTAAGG - Intronic
1077580358 11:3413548-3413570 TATAAAATGGAGGTGGTGGGAGG - Intergenic
1078832438 11:14990983-14991005 TCTCATATCCATGGGGTGAGAGG + Intronic
1080470250 11:32538528-32538550 TCTCATCTGGGGGTGATGGGAGG + Intergenic
1080863033 11:36166949-36166971 TCACATACACAGGTGCTGGGTGG - Intronic
1084260928 11:67978079-67978101 TTTAATATCCAGGGGGTGGGAGG + Intergenic
1084681058 11:70666629-70666651 TCTCATCTGCATGTGGAGAGTGG - Intronic
1084811717 11:71616039-71616061 TTTAATATCCAGGGGGTGGGAGG - Intergenic
1085805364 11:79630946-79630968 TCTCATACACTGCTGGTGGGAGG + Intergenic
1087093981 11:94303021-94303043 GCGCATATGCAGGTGGAGGGAGG - Intergenic
1088023531 11:105150156-105150178 GCTCATATGAAGGTGTTGGCAGG + Intergenic
1089011501 11:115135792-115135814 TCTCTGATGCTGGTGGTTGGGGG - Intergenic
1089067234 11:115671009-115671031 TATCATATGCACTTGGTGGGTGG + Intergenic
1089335288 11:117718672-117718694 TCTCATATGATGGGGGGGGGGGG - Intronic
1089440479 11:118512014-118512036 TCTCATTTGCAGGTAATGGCTGG + Exonic
1090361372 11:126175158-126175180 TCTCCTGGGCAGGTGGCGGGGGG - Intergenic
1090855640 11:130607609-130607631 TGTCACATGGAGGTGGTGGGTGG + Intergenic
1091799384 12:3315315-3315337 TCACAGAAGCAGGTGGAGGGAGG + Intergenic
1092114445 12:5988979-5989001 TCACATTGGCTGGTGGTGGGTGG - Intronic
1092197868 12:6560777-6560799 TCTTTTCTCCAGGTGGTGGGGGG - Exonic
1092407951 12:8233969-8233991 TATAAAATGGAGGTGGTGGGAGG - Intergenic
1093752489 12:22816825-22816847 GCTCTTAGGCAGGTGCTGGGTGG + Intergenic
1095391261 12:41709436-41709458 ACTAATATGAAGGTGGGGGGAGG - Intergenic
1095697530 12:45158003-45158025 TCTAATATCCAGGGGGTGAGAGG + Intergenic
1097023106 12:56034732-56034754 TCTGAGATGCAATTGGTGGGTGG - Exonic
1097434850 12:59544073-59544095 TCTAATATGCAGGAAGGGGGTGG + Intergenic
1100600246 12:96106802-96106824 TTGCATATGCAGGTTGTGGCTGG + Intergenic
1102260072 12:111438145-111438167 TCACAAATGCAGGGGCTGGGTGG + Intronic
1104063487 12:125287218-125287240 TCTTATAAGAGGGTGGTGGGAGG - Intronic
1104297907 12:127534960-127534982 TCCCATGTGGGGGTGGTGGGAGG - Intergenic
1105330676 13:19412497-19412519 ACTCATCTGTTGGTGGTGGGTGG - Intergenic
1105956555 13:25288233-25288255 TCTCAAATGGTGGTGGTGGGGGG + Intergenic
1106432937 13:29698968-29698990 TCTCAAATGCTGGTTGTGGTAGG - Intergenic
1106810614 13:33355230-33355252 TCAGATGTGTAGGTGGTGGGTGG - Intergenic
1108007898 13:45970964-45970986 TCTCATCTGAAAATGGTGGGTGG + Intronic
1112352239 13:98645896-98645918 TCTCTTATGAAGGTGGTGTTGGG + Intergenic
1114436567 14:22711898-22711920 TCTAATATCCAGGTGGAGTGAGG + Intergenic
1114850236 14:26374493-26374515 TCTCATGTGGCGGGGGTGGGCGG - Intergenic
1116801196 14:49444915-49444937 TCTCATGTACTGGTAGTGGGAGG - Intergenic
1116958436 14:50946251-50946273 TCACACATGGTGGTGGTGGGGGG + Intergenic
1117507688 14:56418930-56418952 CCTGATATGCCAGTGGTGGGAGG - Intergenic
1117677231 14:58167155-58167177 TGTGAGGTGCAGGTGGTGGGTGG - Intronic
1117909701 14:60625213-60625235 TGACATAGGCAGTTGGTGGGTGG - Intergenic
1124180102 15:27465136-27465158 TCTCAGCTGCTGGTGGAGGGGGG + Intronic
1125488408 15:40128217-40128239 TCTAATATCCAGGTGGGGGGAGG + Intergenic
1125488931 15:40132114-40132136 TCTAATATCCAGGTGGGGGGAGG + Intergenic
1126569757 15:50138099-50138121 TCTCATACCCTGGTGGTGAGAGG + Intronic
1129852820 15:78804301-78804323 TCTCATGTGCCGGGGGTTGGGGG + Intronic
1129977944 15:79838282-79838304 TCTGATTTGCAAGTGGAGGGAGG - Intronic
1130008906 15:80131753-80131775 TATCAGATGCAGATGGTGGTGGG + Intronic
1132362313 15:101226672-101226694 TCTCATATGCTGGTGGAGCGAGG - Intronic
1134787287 16:16956140-16956162 TCACATCTGGAGGTGATGGGAGG - Intergenic
1135059406 16:19258254-19258276 TCTCAAATGTGGGAGGTGGGGGG + Intronic
1135867137 16:26114141-26114163 GCTCAGATGCAGGTGGTGTGGGG + Intronic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138394054 16:56690910-56690932 TCTTCTATGCAGGGAGTGGGAGG + Intronic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1140163345 16:72522693-72522715 TCTCATATATCAGTGGTGGGTGG - Intergenic
1140200806 16:72893285-72893307 TTTCATAGGGAGGTAGTGGGGGG - Intronic
1140690710 16:77480716-77480738 TCTGATATGAAAGTGGTTGGCGG - Intergenic
1141259455 16:82439649-82439671 TTTCACAGGCAGGTTGTGGGTGG + Intergenic
1141510097 16:84506268-84506290 TCTCAGGTGCAGGTACTGGGGGG + Intronic
1141844623 16:86598974-86598996 TCTCAAAAGCAGGTGGAGGCAGG - Intergenic
1144132259 17:12257986-12258008 TGTCACATACAGGTGTTGGGAGG - Intergenic
1144323973 17:14159504-14159526 TCTCATAGGCAGGTTCTGGAGGG + Intronic
1145263078 17:21366243-21366265 TCTCGAATGCCGGAGGTGGGGGG - Intergenic
1146525522 17:33564047-33564069 TCACATATTCCTGTGGTGGGAGG + Intronic
1148328159 17:46796051-46796073 TCCCATCCGCAGGTGGTAGGTGG + Intronic
1149984963 17:61340322-61340344 ACACAGATGCAGGGGGTGGGTGG + Intronic
1152079558 17:78178267-78178289 CTTCAGATGCTGGTGGTGGGTGG - Intronic
1152624739 17:81383087-81383109 CCTCAAATGCAGGTGGGGTGGGG - Intergenic
1153198395 18:2625358-2625380 TCTCCTCTGCAGGCTGTGGGAGG + Intergenic
1153810135 18:8745050-8745072 TCTCAAAATCAGGAGGTGGGAGG - Intronic
1155542887 18:26885846-26885868 TCTGATATCCAGGTGAGGGGAGG - Intergenic
1156271968 18:35543677-35543699 TCTCATATGATGCTGGTAGGGGG - Intergenic
1156451111 18:37266921-37266943 ACTGAGATGCTGGTGGTGGGGGG + Intronic
1158439502 18:57462034-57462056 TCTCCTAGGCTGCTGGTGGGAGG - Intronic
1160762815 19:794157-794179 TCTAAGCTTCAGGTGGTGGGTGG + Intergenic
1161284804 19:3463629-3463651 CCTCCTATGCCGGGGGTGGGGGG - Intronic
1162898231 19:13778228-13778250 TCCCATATGGAGGTAGGGGGTGG - Exonic
1164756140 19:30691250-30691272 TTTCATGTGCATGTGGGGGGTGG - Intronic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
928400132 2:30971759-30971781 TCACATATTCAGGTGCAGGGTGG - Intronic
929585920 2:43114345-43114367 GCTTATAGGCAGGTGGTGGGAGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931934928 2:67186443-67186465 TCTTCTATGCAGGTGCAGGGTGG + Intergenic
932499995 2:72174827-72174849 TTTCATATACAGGTGCTTGGCGG + Intergenic
932931558 2:76046048-76046070 TCTCCTATGTCGGTGGTGGGGGG + Intergenic
933412170 2:81940352-81940374 TCTCTTGTGGAGGGGGTGGGGGG - Intergenic
933506623 2:83183843-83183865 TCTCATATCCATGAGGGGGGAGG + Intergenic
934507493 2:94905565-94905587 TCTAATATCCAGGTGGGGGGAGG + Intergenic
934507509 2:94905638-94905660 TCTACTATGCAGGGGGTGGGGGG + Intergenic
936072521 2:109380785-109380807 CTGCCTATGCAGGTGGTGGGGGG - Intronic
936738143 2:115471485-115471507 TCTCAGAAGCCGGTGGTGGAAGG - Intronic
937305083 2:120866111-120866133 TTTCTTATGCAGGAGGCGGGGGG - Intronic
937363276 2:121243725-121243747 TCTCATATAGAGGTGGCGGGGGG - Intronic
938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG + Intergenic
938360151 2:130679967-130679989 TCTGAGATGCAGGTGGTGCCAGG - Intergenic
938436554 2:131286674-131286696 TCTGAGATGCAGGTGGTGCCAGG - Intronic
938768829 2:134482648-134482670 TCTCATCTGCTGGTTGGGGGTGG - Intronic
939283867 2:140102448-140102470 TCTGAAATCCAGGTGGTGGCAGG - Intergenic
941651123 2:168093827-168093849 CCTCATTTGTGGGTGGTGGGGGG + Intronic
941769831 2:169333269-169333291 TCACATATCCAGGTCGTGGCAGG - Intronic
941936379 2:170984450-170984472 TCTCTTCTCCAGGTGGTGGCTGG - Intergenic
942317096 2:174706665-174706687 TCTAATATTCAGGTGGGGAGAGG - Intergenic
946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG + Exonic
946414734 2:219534251-219534273 TGACAGATGCAGGTGGTGTGGGG - Intronic
947202724 2:227629289-227629311 ACTCAAATGCAGGTTGTGTGTGG - Intronic
947889879 2:233608039-233608061 TCTCATATGCTTGTGGTGGGAGG - Intergenic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
947929926 2:233956002-233956024 TCTCATCTGGGGGTGATGGGTGG - Intronic
949046465 2:241874639-241874661 GCTCGGATGCAGGTGGTGCGGGG + Intergenic
1170108690 20:12780984-12781006 ACTTATATGCTGCTGGTGGGAGG - Intergenic
1170498304 20:16948393-16948415 TCTGAGATCAAGGTGGTGGGAGG - Intergenic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1172114657 20:32566516-32566538 TCCCAAATACAGGGGGTGGGAGG + Intronic
1172547569 20:35773246-35773268 TCTCATTTCCAGGTGGCGAGTGG + Intronic
1173587534 20:44194393-44194415 TTTCATATGAAGGTGTTAGGAGG - Intergenic
1174116133 20:48227651-48227673 CCTCATCTGTAAGTGGTGGGTGG - Intergenic
1175661371 20:60815910-60815932 CCTCAAATGAAGGTGGTGGTGGG - Intergenic
1176268990 20:64225665-64225687 ACTCAGAAGCAGGTGGTGGGAGG + Intronic
1177708838 21:24743954-24743976 TCTAAAATGAAGGTGTTGGGAGG - Intergenic
1179574052 21:42295994-42296016 TGTCTTAAGAAGGTGGTGGGCGG + Intronic
1179943232 21:44653337-44653359 GTTCATATGCAGGTGGCGGGAGG - Intronic
1180564216 22:16649350-16649372 ACTCATCTGTTGGTGGTGGGTGG + Intergenic
1180656966 22:17430003-17430025 TCTCATACACTGTTGGTGGGGGG - Intronic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1181995089 22:26871468-26871490 TCTCATCTACTGTTGGTGGGAGG - Intergenic
1184098087 22:42327390-42327412 TCTCATTGGCAGGTTGGGGGAGG - Intronic
1185244337 22:49765277-49765299 TCTCAGAGGCAGGAGCTGGGGGG + Intergenic
951456326 3:22896291-22896313 TCTCAAAAAAAGGTGGTGGGGGG - Intergenic
951742792 3:25942797-25942819 TCTCATCTACTGCTGGTGGGAGG - Intergenic
953227983 3:41038012-41038034 TCTGAAATGCAGGTGGGGTGGGG + Intergenic
954453237 3:50582967-50582989 TGACATATGCTGGTGGTGGTGGG - Exonic
955517305 3:59739200-59739222 TCTCTTTTGCATGTGGTGTGAGG + Intergenic
956647758 3:71473620-71473642 TTTCATTTGCGGGTGGTGGCGGG - Intronic
956862603 3:73339439-73339461 TCACATAGGCAGGGGTTGGGGGG - Intergenic
957053228 3:75426145-75426167 TATAAAATGGAGGTGGTGGGAGG - Intergenic
957254935 3:77824953-77824975 TCTCTTCTGTAGGGGGTGGGGGG + Intergenic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
961068425 3:123897012-123897034 TCTTAAATGCAGGTGGGAGGTGG - Intergenic
961301598 3:125925399-125925421 TATAAAATGGAGGTGGTGGGAGG + Intergenic
961460161 3:127045122-127045144 GCTCAGGTGCAGGTGGAGGGTGG + Intergenic
961649263 3:128409385-128409407 TCCCGTGTGCACGTGGTGGGTGG + Intergenic
961886869 3:130102456-130102478 TATAAAATGGAGGTGGTGGGAGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963892718 3:150653593-150653615 TGTCATGTGCGGGTGGAGGGAGG - Intergenic
964344495 3:155742835-155742857 TTTCATTTGCTGATGGTGGGAGG + Intronic
965901336 3:173644964-173644986 GCTCAGAGGCTGGTGGTGGGAGG + Intronic
968795965 4:2704657-2704679 ACTCAGATGCTGCTGGTGGGTGG - Intronic
968798053 4:2722283-2722305 TCTCGGGTGCAGGTGGTGTGGGG + Intronic
968853032 4:3096394-3096416 TCTCTTCTGCTGGTGCTGGGTGG - Intronic
968996034 4:3946461-3946483 TATAAAATGGAGGTGGTGGGAGG - Intergenic
969460427 4:7326096-7326118 GCTCAGAGGCAGGTGGTGAGGGG + Intronic
969757952 4:9162238-9162260 TATAAAATGGAGGTGGTGGGAGG + Intergenic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
971025683 4:22586470-22586492 TCTAATATCCAGGTGAGGGGAGG - Intergenic
972436359 4:39039292-39039314 CTTCATATGCAGGGGGAGGGTGG + Intergenic
973801666 4:54484463-54484485 TCTCATCTGCATGGGGTGGTTGG - Intergenic
975417456 4:74121496-74121518 TCCCATGTGCAGGTGATGGGAGG - Intronic
975487805 4:74953776-74953798 TCTCAGATGTCGGTGGTGGTGGG - Intronic
976479514 4:85523990-85524012 TTTCATATAGAGGTGGTGGTGGG + Intronic
976745412 4:88398404-88398426 TCTGAAATGGTGGTGGTGGGGGG - Intronic
984689594 4:182710675-182710697 TGACATATGCAAGTGGTAGGAGG - Intronic
985717553 5:1471207-1471229 TCTCAAATGCAGGTCTTGGCAGG - Intronic
986010849 5:3713892-3713914 TCTCACAAGAAGCTGGTGGGAGG + Intergenic
988060334 5:26159319-26159341 TCCAATTTGCAGGGGGTGGGTGG + Intergenic
988537722 5:32083966-32083988 TTTCATATTCAGGCCGTGGGCGG - Intronic
996329550 5:122312906-122312928 TTTCATCTGCAGGTGGTAAGTGG + Intronic
998814869 5:146002902-146002924 CCTCAGATGCAGGGGGTAGGAGG - Intronic
999661874 5:153873125-153873147 TCTAATATAAAGGTGGTAGGTGG + Intergenic
1000612147 5:163386061-163386083 CCTCTTATGCAAGTGCTGGGGGG + Intergenic
1001303753 5:170556517-170556539 TCTCCTCTCCAGGAGGTGGGGGG + Intronic
1001768789 5:174276753-174276775 TCTCAAATGCAGGTGACGGTGGG + Intergenic
1006307301 6:33231189-33231211 ATTTATATGCATGTGGTGGGAGG - Intergenic
1009049393 6:58259848-58259870 TCTAATATCCAGGGGGTGAGAGG - Intergenic
1009059786 6:58385198-58385220 TCTCATAAGAGGGAGGTGGGAGG - Intergenic
1009224948 6:61013082-61013104 TCTAATATCCAGGGGGTGAGAGG - Intergenic
1009228210 6:61036473-61036495 TCTAATATTCAGGTGGGGAGAGG - Intergenic
1009947331 6:70354948-70354970 GCTTATAATCAGGTGGTGGGTGG + Intergenic
1012435870 6:99214914-99214936 TCTCATAAGCAGTTGGTTGATGG - Intergenic
1012531087 6:100237275-100237297 GCTCCAATGCAGGCGGTGGGAGG - Intergenic
1012775588 6:103490485-103490507 TCTAATATTCAGGTGGGGAGAGG + Intergenic
1013270075 6:108537260-108537282 TCTAGTGTGGAGGTGGTGGGTGG + Intergenic
1016889243 6:148989213-148989235 TTTCATTTGCGGGGGGTGGGGGG - Intronic
1017032095 6:150233199-150233221 TTTAATCAGCAGGTGGTGGGTGG + Intronic
1017904943 6:158751543-158751565 TTTCTTTTGCAGGTGGTGGGTGG + Intronic
1019422094 7:955173-955195 TCCCATCTGTGGGTGGTGGGCGG - Intronic
1019798377 7:3069220-3069242 TCTCAGATCTAGGTGTTGGGAGG - Intergenic
1020981837 7:15078589-15078611 TTTCATCTGGAAGTGGTGGGAGG + Intergenic
1021000404 7:15323470-15323492 TGTCATATGGAGATGGTAGGAGG + Intronic
1021265516 7:18516499-18516521 TCTCATGTGAAGGAGGTGAGAGG - Intronic
1022062484 7:26811641-26811663 TATCACCTGCAGGTGGAGGGGGG - Intronic
1022951622 7:35344489-35344511 TCTCATATATTGCTGGTGGGAGG + Intergenic
1023822106 7:43986184-43986206 GCTCATATACAGCTGGTGAGTGG - Intergenic
1023873270 7:44274037-44274059 TCTCATCCGGAGGTGGTAGGGGG - Intronic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1026385334 7:69841456-69841478 TCCCCAATGCTGGTGGTGGGAGG - Intronic
1030787340 7:113678542-113678564 TCTGATTTTCAGGTGGTGGGAGG + Intergenic
1036578366 8:10049984-10050006 TGTCCTATGGAGGTGGAGGGAGG + Intergenic
1038260042 8:25984889-25984911 TCTCAGTTTCAGGAGGTGGGTGG - Intronic
1038637566 8:29300039-29300061 TGTAATATACAGGTTGTGGGAGG + Intergenic
1038723388 8:30058210-30058232 TCTGATATCCAGGTGGTAGCAGG + Intergenic
1039436491 8:37563021-37563043 TTTGATATGCAGTTGGTGGATGG - Intergenic
1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG + Intergenic
1043633246 8:82363479-82363501 ACACATATGCATGGGGTGGGGGG - Intergenic
1044519507 8:93182035-93182057 TCTCATAAACATTTGGTGGGAGG + Intergenic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1046969266 8:120203340-120203362 TCTCAGATGGGGGTGGGGGGGGG + Intronic
1047731742 8:127734413-127734435 TCTCTTTTGGAGGTGGTGGAGGG + Intergenic
1047996056 8:130337356-130337378 AATCAAATGCAGGTGGTTGGTGG - Intronic
1050560149 9:6826950-6826972 TCTAATATGAAGGATGTGGGTGG + Intronic
1051054661 9:12970753-12970775 TCACATACACAGGTTGTGGGTGG + Intergenic
1052680936 9:31691762-31691784 TCACATATAAAGGTGGTGGATGG + Intergenic
1055208007 9:73756743-73756765 TCTCATATTAAATTGGTGGGGGG + Intergenic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1057811832 9:98263459-98263481 CCTCATAGGGAGGTGGTTGGGGG - Intergenic
1060206222 9:121684399-121684421 GCTGATATCCAGGTGCTGGGAGG - Intronic
1060792442 9:126495673-126495695 TCTCACAGGTGGGTGGTGGGTGG - Intronic
1187793297 X:22974482-22974504 TCTCATATGCTGGTGAGGGGAGG - Intergenic
1188281529 X:28275937-28275959 TCTCATATACTGCTGGTGGTAGG - Intergenic
1189102482 X:38205943-38205965 TCTTATATGCATGTGCAGGGTGG - Intronic
1192970223 X:76220974-76220996 TTTCCTGTGGAGGTGGTGGGCGG + Intergenic
1197891890 X:131277126-131277148 GCTCATATGCTGGTGGGGGGTGG + Exonic
1198380410 X:136078170-136078192 ACTCATTTTCAGGGGGTGGGGGG + Intergenic
1201305041 Y:12542642-12542664 CCTCATCTGCAGGTTGCGGGTGG + Intergenic