ID: 947897092

View in Genome Browser
Species Human (GRCh38)
Location 2:233685460-233685482
Sequence CCAGTTCTCCAGAGCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947897092_947897097 -10 Left 947897092 2:233685460-233685482 CCAGTGCAGCTCTGGAGAACTGG 0: 1
1: 0
2: 2
3: 19
4: 200
Right 947897097 2:233685473-233685495 GGAGAACTGGGACTGGGATGTGG 0: 1
1: 0
2: 7
3: 47
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947897092 Original CRISPR CCAGTTCTCCAGAGCTGCAC TGG (reversed) Intronic
900368235 1:2320178-2320200 GCATCTCTCCAGACCTGCACAGG - Intergenic
902313895 1:15603291-15603313 CCGGTTCTCCTGAGCTGAGCAGG + Intergenic
905937493 1:41836403-41836425 CCTGGTCTCCAGAGCTGCTGAGG + Intronic
906043809 1:42811442-42811464 GCACATCTCAAGAGCTGCACGGG + Intronic
906098199 1:43238475-43238497 CCAGGTCTACACAGCTGCAGAGG - Intronic
907045651 1:51298579-51298601 CCAGCTCTCCAGGGATGTACAGG + Intronic
907556190 1:55346052-55346074 ACAGTTCTGCAGGGCTGCAGAGG + Intergenic
907802116 1:57779401-57779423 CCAATTCTCAAGAGCTGCAGAGG + Intronic
909703498 1:78553328-78553350 CCCATTCTCCAGAGCTGAGCCGG + Intergenic
911315563 1:96352855-96352877 CCTGGTCTCCAGAGCTGCTACGG + Intergenic
912721074 1:112020691-112020713 CCATTTCTCCTGGGCTCCACTGG + Intergenic
913219580 1:116648705-116648727 CCAGATCTCCAGACCTGAATAGG - Intronic
914880606 1:151543760-151543782 CCAGTTGTCCAGAGCAGGACAGG + Intronic
917674418 1:177305357-177305379 CCTGTTCTCCAGAGCCCCAGGGG - Intergenic
918016120 1:180633850-180633872 CCAGTTCTTCACAGAGGCACAGG + Intronic
919844925 1:201636059-201636081 CCAGATCTTCAGAGCTGCACTGG - Intronic
922182251 1:223244444-223244466 CCATTGCTCCCCAGCTGCACTGG - Intronic
922891826 1:229067603-229067625 GCAGGTCTGCAGAGCTGAACAGG - Intergenic
924204621 1:241698891-241698913 ACAGTTCTGCAGGGCTGCAAAGG + Intronic
1066673476 10:37863621-37863643 ACAGTTCTCCAGGGCTTTACAGG - Intergenic
1070226747 10:74515953-74515975 CCAGTTCTGGAGAGGTGCAGTGG + Intronic
1074782585 10:116812616-116812638 ACAGCTCTCCAGTGCTGTACAGG - Intergenic
1074787315 10:116852220-116852242 ACAGTTCTGCACAGCTGCAGAGG - Intronic
1075692055 10:124403546-124403568 CCAGGTCTGCAGTTCTGCACAGG + Intronic
1075989802 10:126825958-126825980 CTAGTGCTCCAGAGGTGCACTGG - Intergenic
1076038455 10:127221714-127221736 CCACTTCCCCTGAGTTGCACCGG - Intronic
1076207008 10:128611599-128611621 CCAGATCTCCAGGACAGCACTGG - Intergenic
1076281735 10:129252187-129252209 CCAGCTCTTCAGAGATGCTCTGG - Intergenic
1076539537 10:131205580-131205602 CCACGTCCCCAGGGCTGCACTGG - Intronic
1078412596 11:11139097-11139119 CCTCTACTCCAGAGCTACACAGG - Intergenic
1081575404 11:44316133-44316155 CCACTTCTCCAGAGCCGCCAGGG + Intergenic
1081809092 11:45905346-45905368 ATAGTTCTCCAGAGCTGCGGGGG - Intronic
1083152229 11:60798928-60798950 GAAGGTCTCCAGAGCGGCACAGG + Intronic
1085636345 11:78162342-78162364 ACAGATCTCAAAAGCTGCACAGG + Intergenic
1086410250 11:86537933-86537955 CAGGTTCTTCAGACCTGCACAGG - Intronic
1089369098 11:117941472-117941494 CCAGTTCTCCCAGTCTGCACTGG + Intergenic
1094501112 12:31021681-31021703 TCATTTCTCTAGAGCTACACAGG + Intergenic
1098015757 12:66103092-66103114 CCAGCTCTCCTGAGCTCCAGAGG - Intergenic
1101346341 12:103889627-103889649 CCAGCTGTCCAGTCCTGCACAGG + Intergenic
1104358616 12:128111456-128111478 GCAGTTCTCAAGAGCAGCTCTGG - Intergenic
1105072378 12:133242589-133242611 CCACTTCTCCAGCTCTGCTCTGG + Intergenic
1111602735 13:90494963-90494985 CCAGTCCGCCGGCGCTGCACTGG + Intergenic
1113693460 13:112328203-112328225 TCAGCTCTCCAGAGCTGCCATGG + Intergenic
1117306654 14:54483427-54483449 CGCCTTCTCCAGAGCTGTACAGG + Intronic
1119963257 14:78883107-78883129 CCAGTTCACCAGGGCTGGAAAGG - Intronic
1120745796 14:88150181-88150203 CAAATTTTCCAGAGCTTCACAGG - Intergenic
1121335966 14:93077661-93077683 CCTGTGTGCCAGAGCTGCACAGG - Intronic
1122267093 14:100551813-100551835 CCACTTCTGCAGAGCAGCTCAGG - Intronic
1124365007 15:29064890-29064912 CCAATCCACCAGAGCTGCTCAGG - Intronic
1124492592 15:30167354-30167376 CCAGTTGTCCAGGGTCGCACAGG + Intergenic
1124657943 15:31523901-31523923 CGAGTCCTGCACAGCTGCACGGG + Intronic
1124750942 15:32370971-32370993 CCAGTTGTCCAGGGTCGCACAGG - Intergenic
1125132680 15:36302395-36302417 CCAGTTCTCCAGGTTTGCCCAGG + Intergenic
1125503579 15:40253758-40253780 CCAGATCTCCAGACCTGCTCAGG + Intronic
1125608601 15:40956282-40956304 CCAGTTCCCCAGAGCAGAGCTGG + Exonic
1127857265 15:62962796-62962818 CCAGTGTTCCAGAGCTGGCCGGG + Intergenic
1130221957 15:82027068-82027090 CTAGTACTCCAGAGCTCCAGAGG + Intergenic
1130578449 15:85114287-85114309 CCAGTTCTCCAGTGTTGCTTAGG + Intronic
1130742474 15:86615644-86615666 CCAGCTGTCCAGAGGTGAACCGG - Intronic
1132645225 16:996389-996411 CCAGGTCTCCAGAGCGGCTGGGG + Intergenic
1132675112 16:1118252-1118274 CCAGACCTCCAGAGCTGGCCAGG + Intergenic
1137781253 16:51099438-51099460 CCAGTTCTGCATAGCTGGAGAGG - Intergenic
1140781166 16:78298139-78298161 ACAGTTCTACAGGGCTGCAGAGG - Intronic
1142820223 17:2460293-2460315 CCAGCTCTCCAGAGCTGGGATGG + Intronic
1142941486 17:3383278-3383300 ACAGTCCTCCAGCGCTGGACTGG + Intergenic
1143689914 17:8552779-8552801 CCGGTTCTTCAGAGCAGCAGAGG - Intronic
1143697383 17:8630542-8630564 CCTGTCCTCCAGAGCCGCCCGGG + Intronic
1144511432 17:15880569-15880591 ACAGTGCTCCAGATCTGCTCTGG - Intergenic
1144588485 17:16503596-16503618 CCAGTTCTCCTGCCCTCCACTGG - Intergenic
1144998992 17:19290319-19290341 CCAGTTCTGCAGAACAGAACAGG - Intronic
1145175591 17:20698287-20698309 ACAGTGCTCCAGATCTGCTCTGG - Intergenic
1145925064 17:28640731-28640753 CCAGTTCTCCCGAAATGCCCTGG + Intronic
1145973285 17:28969603-28969625 CCAATTGTCCAGAGCTTCACTGG + Intronic
1146173433 17:30649967-30649989 CCAGGCCTCCAGGCCTGCACTGG + Intergenic
1146346890 17:32065997-32066019 CCAGGCCTCCAGGCCTGCACTGG + Intergenic
1147768879 17:42854439-42854461 CCAGTTCTCCAGTCCTGCTCAGG - Exonic
1147771682 17:42872396-42872418 CCAGTTCTCCAGTCCTGCTCAGG - Intergenic
1152404299 17:80087707-80087729 CCAGCTCCTCCGAGCTGCACCGG - Exonic
1152524173 17:80878037-80878059 CCAGCTGTGCAGGGCTGCACTGG + Intronic
1152923674 17:83078368-83078390 CCAGTTATTCAGACTTGCACAGG + Intergenic
1154308266 18:13246301-13246323 CGAGATCCCCAGGGCTGCACAGG - Intronic
1155003328 18:21706701-21706723 CCAGCCCGCCAGCGCTGCACTGG + Intronic
1155857286 18:30849784-30849806 CCAGAGCTCCAGTGCTGCACTGG + Intergenic
1158110537 18:53935802-53935824 CCAGTTTTCCACAGCAACACTGG + Intergenic
1161453396 19:4358885-4358907 CCAGTTCTCCAGAACCACGCGGG - Intronic
1162988989 19:14290093-14290115 CCAGGCCTCCAGGCCTGCACTGG - Intergenic
1168224142 19:54982460-54982482 CCAGCTCTGCAAAACTGCACGGG - Exonic
926480130 2:13382453-13382475 CCAGTTCTCCATGGCTGGATAGG + Intergenic
926695149 2:15765859-15765881 CCAGCTCTGCAGAGCAGCCCTGG + Intergenic
927921678 2:26977447-26977469 CCAGTTCTCCAGTGTTCCAGGGG + Intronic
928729967 2:34220237-34220259 TCAGTTTTCCAGAGCTGTACTGG + Intergenic
931470917 2:62536984-62537006 CATGTTCCCCACAGCTGCACTGG + Intergenic
931914216 2:66935251-66935273 CCAGTGCTCCAGAGCTCCTTGGG + Intergenic
934942291 2:98511475-98511497 CCAGCTCTCTATACCTGCACAGG - Intronic
938701801 2:133886052-133886074 CCAGTGCTCCAGGGCTGAGCTGG + Intergenic
940202475 2:151166788-151166810 CCAGGTCTCCAGCGCTGGATAGG - Intergenic
941708216 2:168682596-168682618 CTCTTTCTCCAGAGCTGCAGAGG + Intronic
944146419 2:196512117-196512139 CCTGTTCTCCAGGTCTCCACAGG - Intronic
945121690 2:206463662-206463684 ACAGTCCTCCTGAGCTGAACAGG - Intronic
947681584 2:232038472-232038494 CCACTTCTGTAGAGCTCCACTGG - Intronic
947897092 2:233685460-233685482 CCAGTTCTCCAGAGCTGCACTGG - Intronic
948458952 2:238119960-238119982 CCAGTCCTGCCGTGCTGCACAGG + Intronic
948593550 2:239065786-239065808 GCTGTTCTCCGGACCTGCACTGG + Intronic
948676697 2:239601139-239601161 CCAGCGCTCCAGAGCTGCGTGGG - Intergenic
1168994776 20:2124996-2125018 CAAGTCCTGCAGAGCTGCAAGGG - Intronic
1169122505 20:3105843-3105865 CAAGATCTCCAGAGTGGCACAGG - Intergenic
1170550542 20:17472364-17472386 CCAGCACTCCCGAGCTGCAGAGG + Intronic
1171784326 20:29448810-29448832 CCAGGTCGCCAGGGCTGCATGGG - Intergenic
1173814150 20:45974253-45974275 CTAGCTCTTCAGAGCTGCTCTGG - Intergenic
1174299491 20:49571111-49571133 CCAGTCCTGCAGAGGTGCTCCGG - Intergenic
1175792159 20:61746501-61746523 TCAGTTCTCCTGTGCAGCACAGG - Intronic
1175817089 20:61888829-61888851 CCAGTTCTACACAGCTGACCAGG - Intronic
1176144064 20:63557716-63557738 CCACAGCTCCAGAGCTGCTCCGG - Intergenic
1177153950 21:17482662-17482684 CCAGCTCTGCAGAGCTCCTCGGG + Intergenic
1177923776 21:27188013-27188035 CCAGGTCTAGAGAGCTTCACTGG + Intergenic
1179657547 21:42854511-42854533 CCGGTTCTGCAGACCTGCAGGGG - Intronic
1180618436 22:17144108-17144130 CCAGCTCTCCTGGGCAGCACTGG + Intronic
1181273601 22:21674939-21674961 CCTTTTGTCCAGAGCTGCACAGG + Intronic
1181531205 22:23518506-23518528 CGAGGTCTTTAGAGCTGCACAGG + Intergenic
1182772919 22:32808814-32808836 CAAATTCTCCAAAGCTGCATGGG + Intronic
1183352360 22:37341363-37341385 TCCGTCCTCCACAGCTGCACAGG - Intergenic
1184015324 22:41781690-41781712 GCAGTGCTCCTGAGCAGCACAGG + Exonic
949710265 3:6862979-6863001 CCATGGCTCCTGAGCTGCACTGG + Intronic
950869843 3:16219258-16219280 ACAGTTCTCCAGGGCTGCAGTGG - Intronic
951118987 3:18901264-18901286 CCAGTTTTTGTGAGCTGCACTGG + Intergenic
951853730 3:27171128-27171150 CAAGTTCTCCTGACCTTCACTGG - Intronic
954365715 3:50145094-50145116 CCAGTTCTCCAGAGAGGGGCCGG - Intergenic
954397826 3:50302416-50302438 CCAGTTCCAGGGAGCTGCACGGG - Exonic
954416181 3:50394564-50394586 ACAGCTATCCAGAGCTCCACAGG + Intronic
954979890 3:54735737-54735759 CTAGTACCTCAGAGCTGCACAGG + Intronic
956152559 3:66258959-66258981 CAAGTGCTCCATAGCTGCATGGG + Intronic
956499866 3:69870786-69870808 CCAGGTCTCCAGAGCTGGACTGG - Intronic
960056864 3:113282172-113282194 CCAGCTCTCCCTGGCTGCACCGG - Intronic
962364881 3:134772270-134772292 CCAGCCCTGCACAGCTGCACGGG - Intronic
962413290 3:135160493-135160515 TCAGTACCCCAGATCTGCACAGG + Intronic
962462746 3:135629798-135629820 CATGTTCTCCAGAGCTGAAAAGG - Intergenic
962811203 3:138960743-138960765 CCAGCTCTCAGGAGCTGCTCTGG - Intergenic
965833386 3:172824259-172824281 CCAGTTCTGCATGGCTGCACAGG + Intergenic
966428792 3:179809563-179809585 CCAATTCTTCAGAGCGTCACAGG + Exonic
966542848 3:181111032-181111054 CCATTTCTCCCGATCTTCACTGG + Intergenic
968705535 4:2075758-2075780 CCAGCTCCCCAGAGCTGTCCTGG - Intronic
973635494 4:52858523-52858545 CCAGTTCTGCAGTGCTGCTCTGG + Intergenic
976807472 4:89064085-89064107 CCAGTGCTCCTGACATGCACTGG + Intronic
978521265 4:109618179-109618201 ACAGTCCTCCAATGCTGCACTGG - Intronic
979285427 4:118918519-118918541 CCAATTCTCCAGAGAAGCAAAGG - Intronic
980149990 4:129033675-129033697 GTGTTTCTCCAGAGCTGCACAGG - Intronic
980979359 4:139641010-139641032 AGAGCTCTCCACAGCTGCACTGG - Intergenic
981616331 4:146648137-146648159 CCAGTTCTCCAGAGCTTTCCCGG - Intergenic
982375708 4:154688548-154688570 CCACTCCTCCAGAACTGCCCAGG + Intronic
983239427 4:165214779-165214801 CCAATTTTCCAGAGCTGAAAAGG - Intronic
985828159 5:2207979-2208001 GCACTTCTCCAGAGCTGTGCTGG - Intergenic
986574930 5:9202130-9202152 AGTGTTCTCCAGAGCTGCCCGGG - Exonic
988482323 5:31640346-31640368 CCAGAGCTCCAGACCTGCCCTGG + Intronic
989494900 5:42101092-42101114 ACAGTTCTGCAGGGCTGGACAGG - Intergenic
990753015 5:59038998-59039020 TCAGTTCTCAAGCGCTTCACGGG + Intronic
991488854 5:67164700-67164722 CCAGTTCTCCCCAGCAGCAGTGG + Exonic
992478541 5:77127442-77127464 ACAGTTCTGCATAGCTGCAGAGG - Intergenic
994822210 5:104668190-104668212 CTAGTGCTCCAGAGTTGCAGGGG + Intergenic
995368578 5:111392202-111392224 CCAGTTCTGCATGGCTGCAGAGG + Intronic
996697778 5:126417858-126417880 CCAGTTTTCCAGACTTGCAGGGG - Intronic
997381397 5:133440801-133440823 CCACTTCTCCACACCTCCACTGG + Intronic
997868510 5:137486351-137486373 CCAGCTCGCCAGAACTGCTCTGG + Intronic
1001431863 5:171668258-171668280 CCAGTTCTCCAGGTCTACACTGG - Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1002306773 5:178288133-178288155 ACAGATCTCCAGGGCTGCCCTGG - Intronic
1002774602 6:318085-318107 CCTGTTCTACAGAGCTGCTGTGG + Intronic
1005989793 6:30895772-30895794 TCAGCTCTCCAGAGCTAGACAGG + Intronic
1008086743 6:47253367-47253389 CCAGTGCTGCAGAGCTGCGTAGG + Exonic
1009767906 6:68105730-68105752 CCAGCTCTCCAGAGCTTAAAAGG + Intergenic
1011048861 6:83120176-83120198 AAACTTCTCCAGAGCTTCACAGG - Intronic
1012404144 6:98875549-98875571 CCAACTCTGCAGAGCAGCACCGG - Exonic
1014628549 6:123760738-123760760 ACAGTTCTGCAGGGCTGCAGAGG + Intergenic
1014722110 6:124929552-124929574 CTAGTTCTACATAGTTGCACTGG - Intergenic
1015181320 6:130365579-130365601 CCAGTTCTCCGGAGCGGCTGGGG - Intergenic
1015946914 6:138512354-138512376 CGAGTTCTCCATAGATGCTCTGG - Intronic
1015999568 6:139029213-139029235 CCAGTTCTGCAGAGCTGGGTGGG + Intronic
1016932889 6:149427267-149427289 CCATTTCTCCTGAGGTGCAATGG + Intergenic
1018017225 6:159723508-159723530 CCAGTTCTCCAAAGGAGCTCTGG + Intronic
1019197202 6:170289795-170289817 CCAGAGCTCCAGACCTGCACGGG + Exonic
1022273896 7:28837846-28837868 CCAATTCTGCACAACTGCACTGG + Intergenic
1024283551 7:47738336-47738358 CCAGCTCTCCAGAGATGCTAAGG - Intronic
1024623368 7:51182904-51182926 CCAGTTCGGCCGAGCTCCACTGG + Intronic
1026385710 7:69845677-69845699 CCAGTTCTCTAAAGCTGTGCTGG + Intronic
1029602815 7:101579461-101579483 ACAGTTCTGCATAGCTGCAGAGG + Intergenic
1031996521 7:128235583-128235605 CCAGGTACCCAGGGCTGCACAGG - Intergenic
1034757068 7:153632556-153632578 AGAGTTCTCCAGTGCTGCAGAGG + Intergenic
1034784634 7:153914404-153914426 CCAGTTCTCCATACCTTCCCTGG + Intronic
1034884329 7:154786617-154786639 ACAGTTCTGCAGGGCTGCAGAGG - Intronic
1035474513 7:159132592-159132614 CCATTTCTCCAGAAAGGCACGGG - Intronic
1035478743 7:159164297-159164319 CCATTTCTCCAGAAAGGCACGGG + Intergenic
1035492971 7:159296030-159296052 CCACTTCTCCAGCTCTGCTCTGG + Intergenic
1036140183 8:6200628-6200650 CCAGTTCTCCAGTTCTGCTGGGG - Intergenic
1037893316 8:22635706-22635728 TCAGCTGTCCAGAGCTGCGCAGG + Intronic
1039581687 8:38671947-38671969 CCAGCTCTGCAGGGCTGCACTGG + Intergenic
1049592608 8:143469407-143469429 CCAGACCTCCACAGCTGCAGTGG - Intronic
1049959785 9:727438-727460 CCTGTAATCCAGAGCTGCTCGGG - Intronic
1051797474 9:20888871-20888893 ACAGTTCTACATAGCTGCAGAGG - Intronic
1055935149 9:81597838-81597860 CCAGTTCACCACAGCTGCGAAGG - Intronic
1056852672 9:90097497-90097519 CCAGCTCTGCAGAGCTGCTGTGG + Intergenic
1056900937 9:90598927-90598949 CCAGTTCTCCAGAGAAGAAAAGG + Intergenic
1058344138 9:103939567-103939589 CCAGTTCTCCAAACCCGAACTGG + Intergenic
1060923369 9:127438256-127438278 CCAGGCCTCCAGAACTACACTGG + Intronic
1060946150 9:127570060-127570082 TCAGATCTCCTGATCTGCACTGG + Intronic
1061249258 9:129416940-129416962 CGAGGTCTTTAGAGCTGCACAGG - Intergenic
1061899461 9:133665658-133665680 CCACTTCCCCACAGCTCCACAGG + Intronic
1062064446 9:134518569-134518591 CCAGGTCTCCAGGCCTGGACAGG + Intergenic
1062476064 9:136728106-136728128 CCAGTTCTCGAGCGCCTCACCGG - Intergenic
1188577713 X:31672843-31672865 CTCATTCTCCAGAGCTTCACTGG + Intronic
1189210756 X:39280216-39280238 GCAGATCTCCAGTGCTGCACTGG + Intergenic
1189260307 X:39673747-39673769 CCAGTTCCCCAGAGCTCTAGGGG - Intergenic
1189286516 X:39855642-39855664 CCAGTTCCCCAAAGCCCCACTGG + Intergenic
1190750118 X:53354816-53354838 TCAGTTCCCCAGATCTCCACTGG - Intergenic
1191192272 X:57679481-57679503 CCAGCTCTGCAAAACTGCACGGG + Intergenic
1191211310 X:57888426-57888448 ACCGTTCTGCAGAGCTGCAGAGG + Intergenic
1193316645 X:80072599-80072621 ACAGTTCTGCACAGCTGTACAGG + Intergenic
1194822049 X:98521961-98521983 CAAGTTAGCCAGAGCTGCAGAGG + Intergenic
1197324761 X:125078998-125079020 CAAGTTCTCCAGAGTTACACAGG + Intergenic
1199682889 X:150239649-150239671 GCAGTTCACCAGGACTGCACAGG + Intergenic
1199696608 X:150346943-150346965 TCAATCCTCCAGGGCTGCACAGG + Intergenic
1199998022 X:153038983-153039005 CCACTACTCCATAGCTGCTCGGG - Intergenic
1201765287 Y:17569161-17569183 CCATTTTTCCAGAGCTAGACTGG + Intergenic
1201836265 Y:18336828-18336850 CCATTTTTCCAGAGCTAGACTGG - Intergenic