ID: 947904376

View in Genome Browser
Species Human (GRCh38)
Location 2:233749674-233749696
Sequence TGTCAAGGACAGGATCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 872
Summary {0: 1, 1: 0, 2: 14, 3: 114, 4: 743}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947904365_947904376 17 Left 947904365 2:233749634-233749656 CCAAATCTCATCTTGAATTGTAA 0: 2206
1: 9725
2: 12425
3: 11533
4: 7780
Right 947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG 0: 1
1: 0
2: 14
3: 114
4: 743
947904361_947904376 23 Left 947904361 2:233749628-233749650 CCCCCACCAAATCTCATCTTGAA 0: 13
1: 217
2: 8691
3: 12524
4: 10661
Right 947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG 0: 1
1: 0
2: 14
3: 114
4: 743
947904363_947904376 21 Left 947904363 2:233749630-233749652 CCCACCAAATCTCATCTTGAATT 0: 217
1: 8669
2: 12013
3: 11176
4: 9172
Right 947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG 0: 1
1: 0
2: 14
3: 114
4: 743
947904364_947904376 20 Left 947904364 2:233749631-233749653 CCACCAAATCTCATCTTGAATTG 0: 85
1: 383
2: 1418
3: 2181
4: 2616
Right 947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG 0: 1
1: 0
2: 14
3: 114
4: 743
947904366_947904376 -7 Left 947904366 2:233749658-233749680 CCCCATAATCCCCACGTGTCAAG 0: 109
1: 565
2: 865
3: 800
4: 602
Right 947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG 0: 1
1: 0
2: 14
3: 114
4: 743
947904367_947904376 -8 Left 947904367 2:233749659-233749681 CCCATAATCCCCACGTGTCAAGG 0: 124
1: 812
2: 2133
3: 2938
4: 4030
Right 947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG 0: 1
1: 0
2: 14
3: 114
4: 743
947904369_947904376 -9 Left 947904369 2:233749660-233749682 CCATAATCCCCACGTGTCAAGGA 0: 10
1: 195
2: 981
3: 2333
4: 3101
Right 947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG 0: 1
1: 0
2: 14
3: 114
4: 743
947904362_947904376 22 Left 947904362 2:233749629-233749651 CCCCACCAAATCTCATCTTGAAT 0: 51
1: 484
2: 9423
3: 13717
4: 13677
Right 947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG 0: 1
1: 0
2: 14
3: 114
4: 743

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947904376 Original CRISPR TGTCAAGGACAGGATCTGGT GGG Intronic
900079557 1:845386-845408 AGTCAAGGACAGGCCCAGGTTGG + Intergenic
900780625 1:4615207-4615229 TTTCTGGGACAGGATCTGGGTGG - Intergenic
900833524 1:4982191-4982213 TGTCATGGGAAAGATCTGGTGGG - Intergenic
900879783 1:5372503-5372525 TGTCATGGACGGGACCTGGTGGG + Intergenic
901252644 1:7792354-7792376 TGTCAAGGGAGGGACCTGGTGGG - Intronic
902096120 1:13947419-13947441 TGTCAAGGAAGGGACCAGGTGGG - Intergenic
902415202 1:16234490-16234512 TGTCCAGCCCAGGATCTGATGGG - Intronic
902545700 1:17188887-17188909 TGTCAAGGGAAGAACCTGGTGGG - Intergenic
902705688 1:18202702-18202724 TATCAAGGGAAGGACCTGGTGGG - Intronic
902707403 1:18215132-18215154 TGTCAGGGGAGGGATCTGGTGGG - Intronic
903297950 1:22357487-22357509 TGTCGAGGGAGGGATCTGGTGGG - Intergenic
903498214 1:23786118-23786140 TGCCTTGGACAGGATCTGGCAGG + Intronic
903941608 1:26935605-26935627 TGTCATGGGAAGGACCTGGTGGG - Intronic
904367231 1:30021385-30021407 TGTCATGGGAAGGACCTGGTAGG - Intergenic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
905945442 1:41897814-41897836 GATCAAGGACAGCATGTGGTGGG + Intronic
905948200 1:41921329-41921351 TGTCATGGGAAGGACCTGGTGGG + Intronic
906664207 1:47607703-47607725 TGTCAGGGGAGGGATCTGGTTGG - Intergenic
907266235 1:53263150-53263172 TGTGAGGGACAGGATGTGGCAGG + Intronic
907688226 1:56635185-56635207 TGTCATGGGGAGGACCTGGTGGG + Intronic
907721457 1:56976075-56976097 TGTCATGGGAGGGATCTGGTGGG + Intergenic
907756998 1:57320138-57320160 TGTCAAGGGAAGGACCTAGTGGG + Intronic
907782759 1:57582417-57582439 TGTCAAGGGAGGGACCTGGTGGG - Intronic
907808266 1:57842761-57842783 TGTGGAGGAAAGGACCTGGTGGG - Intronic
908407614 1:63830592-63830614 TGTCAAGGGAGGGACCTGGTGGG - Intronic
908915937 1:69126423-69126445 TGTTGAGGGCAGGACCTGGTAGG - Intergenic
909085830 1:71169304-71169326 TGTCAGGGGAGGGATCTGGTGGG - Intergenic
909458982 1:75887149-75887171 TGTCAAGGGAGGGACCTGGTCGG + Intronic
909664987 1:78122652-78122674 TGTCAAGGGAGGGACCTGGTGGG - Intronic
909995977 1:82279588-82279610 TGTCAAGGGAAGGACCCGGTGGG - Intergenic
910135597 1:83965246-83965268 TGTCAAGGGAGGGACCTGGTGGG + Intronic
910367663 1:86484100-86484122 TGTCGAGGGAGGGATCTGGTGGG - Intronic
910546091 1:88420869-88420891 TGTCAAGGGAGGGTTCTGGTGGG - Intergenic
911346298 1:96700673-96700695 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
912084136 1:105977705-105977727 TGTCAAGGGCAGGACCAGGTGGG + Intergenic
912113358 1:106372049-106372071 TGTCAAGGGAAGGACCTGGTGGG - Intergenic
912467699 1:109885382-109885404 TGTCAAGGACAGGAGATAGAAGG - Intergenic
912614437 1:111084012-111084034 TGTCAAGGAAGGGACCTAGTGGG + Intergenic
912834747 1:112986255-112986277 TGTCAAGTACAGTATCTAGTGGG - Intergenic
914899835 1:151706059-151706081 TGTCAAGGACTGGGACTGGAGGG - Intronic
914917134 1:151825791-151825813 GGTCAAGGTCAAGATCTGTTGGG - Intronic
915885519 1:159717198-159717220 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
915988968 1:160493965-160493987 TGTCAAGGGAGGGACCTGGTGGG - Intronic
916302657 1:163293486-163293508 TGTCAAGGAAGGGACCTGGTGGG - Intronic
916322556 1:163521345-163521367 TGTCAGGGGAAGGACCTGGTGGG + Intergenic
916994066 1:170276745-170276767 TGTCAAGGACAAGACCTGGTGGG + Intergenic
918954391 1:191186818-191186840 TGTCAAGGAAGGGACATGGTGGG + Intergenic
918976061 1:191488101-191488123 TGTCATGGGAAGGACCTGGTGGG + Intergenic
919451264 1:197775347-197775369 TGTCACAGAAAGGCTCTGGTGGG - Intronic
919536620 1:198796217-198796239 TGTTAAGGAAGGGACCTGGTGGG - Intergenic
921484138 1:215696595-215696617 TCAGAAAGACAGGATCTGGTTGG + Intronic
921497411 1:215858351-215858373 TGTCAAGGGCAGGACCTGGTGGG + Intronic
921609590 1:217195443-217195465 TGTCATGGGAAGGACCTGGTGGG + Intergenic
921661747 1:217810912-217810934 TGTCAAGGGAGGGATCTGGCAGG - Intronic
921669758 1:217912626-217912648 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
921758212 1:218883170-218883192 TGTCAAGGGAGGGACCTGGTAGG - Intergenic
922683359 1:227619106-227619128 TGTCTAGGGAAGGGTCTGGTGGG - Intronic
923515712 1:234696255-234696277 TGTCAAGGGCAGAAACTGGTAGG - Intergenic
923878515 1:238076661-238076683 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
924020541 1:239776957-239776979 TGTCATGGAAGGGACCTGGTAGG - Intronic
924254342 1:242167491-242167513 TGTCATGGAAGGGACCTGGTGGG - Intronic
924929990 1:248721951-248721973 GGGCAAGGACAGCAGCTGGTAGG + Intronic
1063541848 10:6942019-6942041 TGTCAAGCACAGGTTGTGGAGGG + Intergenic
1063719428 10:8564840-8564862 TGTCAAGGAAGGGACCTGATGGG - Intergenic
1063808835 10:9680518-9680540 TGTAATGGAAGGGATCTGGTGGG + Intergenic
1064115258 10:12572208-12572230 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1065003768 10:21361300-21361322 TGTCGGGGGAAGGATCTGGTAGG - Intergenic
1065084599 10:22162249-22162271 TGTCATGGAAGGGACCTGGTTGG - Intergenic
1065184599 10:23159551-23159573 TCTGAAGGCCAGGATCTGCTGGG + Intergenic
1065217807 10:23467139-23467161 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1065401668 10:25309658-25309680 TGTCATGGGCATGACCTGGTTGG + Intronic
1065682096 10:28246777-28246799 TGTCAAGGGAGGGATCTAGTAGG - Intronic
1065751274 10:28890158-28890180 TGTCGAGGGAAGGATGTGGTGGG - Intergenic
1065949865 10:30642026-30642048 TGTCAAGGGAGGGACCTGGTAGG - Intergenic
1066050657 10:31632330-31632352 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1068150699 10:53126712-53126734 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1068390539 10:56390599-56390621 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1068463759 10:57360196-57360218 TGTCAAGGGCAGGTCCTGGTGGG + Intergenic
1068830270 10:61485945-61485967 AGTGAAAGACAGGATCTGGTAGG - Intergenic
1068948470 10:62753922-62753944 TATCAAGGGCAGGATCTGGTGGG + Intergenic
1069065871 10:63941424-63941446 TGGCAAGGACAGTTCCTGGTGGG + Intergenic
1069113706 10:64477625-64477647 TGTCAAGGGAGGGATCTGCTGGG - Intergenic
1069147600 10:64915385-64915407 TGTCATGAAAAGGACCTGGTGGG - Intergenic
1069798424 10:71067895-71067917 TGTTTAGAACAGGACCTGGTAGG + Intergenic
1071034974 10:81233788-81233810 TATCAAGGGCAGGACCTGGTGGG + Intergenic
1071375262 10:84995837-84995859 AGGCAAGTACAGGATCTTGTAGG + Intergenic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1072318779 10:94228730-94228752 TGTCAAGGACATGATCATTTGGG - Intronic
1073329650 10:102661761-102661783 TGACAATGACAGGATCTGAGTGG - Intergenic
1073761752 10:106636662-106636684 TGTCGAGGGAAGGACCTGGTGGG - Intronic
1073791662 10:106946385-106946407 TATCAAGGGAAGGATTTGGTGGG + Intronic
1073833234 10:107411013-107411035 TGTCAAGGGAAGGGTCTGGTGGG + Intergenic
1073859499 10:107721454-107721476 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1074037748 10:109757727-109757749 TGTCATGGAAGGGACCTGGTGGG + Intergenic
1074226304 10:111487845-111487867 TGTCAAGGAGGGGACCTCGTGGG + Intergenic
1074234366 10:111570182-111570204 TGTCAAGGGTGGGACCTGGTGGG - Intergenic
1074673358 10:115820888-115820910 TGTCTAGGGCAGGACCTGGTGGG + Intronic
1075167286 10:120080067-120080089 TGTCAGGGAAGGGACCTGGTGGG - Intergenic
1075978897 10:126720291-126720313 GTTCCAGGACAGCATCTGGTGGG - Intergenic
1076856635 10:133118684-133118706 TGTTGAGGGCAGGACCTGGTGGG - Intronic
1076871674 10:133197795-133197817 TGTCAGGTGCAGGAGCTGGTGGG - Intronic
1078308797 11:10218352-10218374 TGTCATGGGAGGGATCTGGTGGG - Intronic
1078375635 11:10791056-10791078 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1078379573 11:10828399-10828421 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1078584551 11:12571155-12571177 TGTCGAGGAAGGGACCTGGTGGG - Intergenic
1078686439 11:13536646-13536668 TGTCATGGAAGGGACCTGGTGGG + Intergenic
1078827921 11:14949517-14949539 TATAAATGACAGGATCTGGAGGG + Intronic
1078885922 11:15499777-15499799 TGTCAAGGGTGGGACCTGGTGGG - Intergenic
1078959396 11:16247689-16247711 TGTCATGGAAGGGACCTGGTGGG - Intronic
1079533342 11:21481635-21481657 TGTCAGAGACAGCATCTGGATGG + Intronic
1080132730 11:28815554-28815576 TGTCAAGGGAGGGATGTGGTGGG + Intergenic
1080182453 11:29441690-29441712 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1080245632 11:30176834-30176856 TGTCACGGGAAGGACCTGGTGGG - Intergenic
1080400141 11:31926957-31926979 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1080401218 11:31937748-31937770 TGTTGAGGGAAGGATCTGGTGGG - Intronic
1080621292 11:33989317-33989339 TGTCAAGGCAGGGATCTGGTGGG - Intergenic
1080745833 11:35107940-35107962 TGTCAAGGGAAGCATCTAGTAGG + Intergenic
1081425479 11:42921866-42921888 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1081680846 11:45001257-45001279 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1081994630 11:47355466-47355488 CATGAAGGACAGCATCTGGTGGG - Exonic
1082982152 11:59133476-59133498 TGTCAAGGGGGGAATCTGGTGGG - Intergenic
1084119713 11:67062055-67062077 TGTCGAGGGAAGGACCTGGTGGG - Intronic
1084609140 11:70190629-70190651 TGTCGAGGGCGGGACCTGGTGGG - Intergenic
1084793515 11:71489793-71489815 TGTCAAGAAATGCATCTGGTGGG + Intronic
1084810772 11:71609659-71609681 TGTTAGGGACAGTATCTCGTGGG + Intergenic
1085459260 11:76683294-76683316 TGTCAAGGGAGGGATCTGGTGGG + Intergenic
1085762535 11:79254776-79254798 TGTACAGGAAAGGATCTGGAAGG + Intronic
1085811204 11:79682938-79682960 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1086769658 11:90745800-90745822 TGTCAAGGAAGGGACCTGGTAGG + Intergenic
1087442702 11:98207215-98207237 TGTCAGGCATAGGATCTGGGCGG - Intergenic
1087497710 11:98910958-98910980 TGTCAAGGAAGGGACCTGGTGGG + Intergenic
1088162924 11:106895440-106895462 TGTCAAGGAAGGGACCTGATGGG + Intronic
1088326093 11:108602926-108602948 TGTTGAGGGCAGGACCTGGTGGG + Intergenic
1088787659 11:113197154-113197176 TGTCAAGCACGGGACCTGGTGGG - Intronic
1089219758 11:116860769-116860791 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1089640753 11:119845691-119845713 TGCCAAGGGCAGGCTTTGGTGGG + Intergenic
1089689340 11:120177386-120177408 TGTCAGAGACAGGACCTAGTTGG - Intronic
1089743077 11:120598466-120598488 TGTCAAGGAAAAGAACTGGTTGG - Intronic
1090543921 11:127740393-127740415 TGTGAAGGGTAGGACCTGGTGGG + Intergenic
1091139614 11:133223858-133223880 TGCTAATGACAGGAGCTGGTGGG - Intronic
1092637857 12:10470744-10470766 TGTGGAGGGCAGGACCTGGTGGG + Intergenic
1092941112 12:13408078-13408100 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1094037366 12:26085370-26085392 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1094071335 12:26417430-26417452 TGTCAAGGGAAGGACCTGGTGGG + Intronic
1094246007 12:28294340-28294362 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1094779199 12:33771224-33771246 TGCCAAGGACTGCATCTGGTTGG + Intergenic
1095308036 12:40661503-40661525 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1095522716 12:43086058-43086080 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1096807268 12:54148525-54148547 AGTCAGGGACTGGAGCTGGTGGG - Intergenic
1096887026 12:54728286-54728308 TGTTAGGGCCAGGACCTGGTGGG - Intergenic
1097441474 12:59613326-59613348 TGTCATGGAAGGGACCTGGTGGG - Intronic
1097538227 12:60900670-60900692 TGTCAAGGGAGAGATCTGGTGGG - Intergenic
1098090455 12:66895216-66895238 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1098142248 12:67462128-67462150 TGTACAGGTCAGGATATGGTTGG + Intergenic
1098408514 12:70153263-70153285 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1098544229 12:71693719-71693741 TGTCAAGGGAGGGACCTGGTAGG + Intronic
1098616895 12:72537339-72537361 TGTCAAGGAAGGGAACTGATTGG + Intronic
1099568025 12:84278002-84278024 TGTCAAGGGAGGGGTCTGGTGGG - Intergenic
1099574854 12:84365269-84365291 TGTCAAGGGAAGGACCTGGTGGG - Intergenic
1099740190 12:86624964-86624986 TGTCCAGGGAGGGATCTGGTGGG + Intronic
1100072362 12:90736180-90736202 TGTCAAGGGAAGGACCTGGTGGG - Intergenic
1100159543 12:91842527-91842549 TGTCAAGGGAGGGACCTGGTTGG + Intergenic
1100519016 12:95355780-95355802 AGTCAAACACAGGATTTGGTTGG + Intergenic
1100674461 12:96850914-96850936 TGTCAAGGAAGGGAACTGGTGGG - Intronic
1100709870 12:97244185-97244207 TGTCAAGGACGGGACCTGGTTGG - Intergenic
1100934581 12:99648441-99648463 TGTCACAGACAGCAGCTGGTCGG - Exonic
1100974576 12:100109047-100109069 TGTCAGGGGAAGGAGCTGGTGGG + Intronic
1101826611 12:108225389-108225411 TGTCATGGGAAGGACCTGGTGGG - Intronic
1102666882 12:114581691-114581713 TGTTAAGGGCGGGACCTGGTGGG - Intergenic
1103051023 12:117779574-117779596 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1103596931 12:122029818-122029840 GGTCAAGGACAGGAGGTGGCTGG + Intronic
1103859501 12:124000958-124000980 TGTCAAGGACAGCAGCTAGATGG - Intronic
1104378954 12:128290450-128290472 TGTCAAGGGAGGGACCTGGTCGG - Intronic
1104379249 12:128292355-128292377 TGTCAAAAACAGGTTCAGGTGGG - Intronic
1104483419 12:129128545-129128567 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1104496188 12:129241739-129241761 TGTGAAGCACAGTATCTGGCAGG - Intronic
1106046662 13:26148255-26148277 TGTCAAAGAAGGGACCTGGTAGG - Intronic
1106478457 13:30118003-30118025 TGTCAAGGGACGGACCTGGTTGG - Intergenic
1106499040 13:30309428-30309450 TGTCAAGGGCAGGGCCAGGTGGG + Intergenic
1107130403 13:36888200-36888222 TGTCGAGGGAGGGATCTGGTGGG + Intronic
1107554321 13:41504253-41504275 TGTCATGGGAGGGATCTGGTGGG - Intergenic
1108472169 13:50778320-50778342 TGTCAGGGAAGGGACCTGGTAGG - Intronic
1108850779 13:54726933-54726955 TGTCATGGAAGGGAACTGGTGGG + Intergenic
1108860972 13:54858312-54858334 TGTCAAGGGTGGGACCTGGTGGG + Intergenic
1109391937 13:61705087-61705109 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1109672361 13:65626003-65626025 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1109675048 13:65664197-65664219 TGTCCAGGGAGGGATCTGGTGGG - Intergenic
1109681995 13:65763730-65763752 CGTCAAGGAAGGGACCTGGTGGG - Intergenic
1110166480 13:72448785-72448807 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1110666237 13:78120465-78120487 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1110955231 13:81545829-81545851 TGTCATGGGAGGGATCTGGTGGG - Intergenic
1110966723 13:81708984-81709006 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1110997820 13:82136256-82136278 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1111015646 13:82377979-82378001 TGTCATGGACAGGACCATGTGGG + Intergenic
1111175829 13:84595424-84595446 TGTCGAGGACAGGACCTAATGGG + Intergenic
1111221151 13:85207040-85207062 TGTTGAGGGCAGGACCTGGTGGG + Intergenic
1111263475 13:85775325-85775347 TGTCAAGGGCAGGGCCAGGTGGG + Intergenic
1111477607 13:88773315-88773337 TGTCATTGAAAGGACCTGGTGGG - Intergenic
1111614456 13:90645076-90645098 TGTCAAGGGCAGGGGCAGGTAGG - Intergenic
1111642029 13:90980792-90980814 TGTCAAGAGAAGGACCTGGTGGG + Intergenic
1111671282 13:91333489-91333511 TGTCAAGGAAGGAAGCTGGTGGG - Intergenic
1111803010 13:93003585-93003607 TGTTGAGGAAAGGATCTGGTGGG - Intergenic
1111909366 13:94293282-94293304 TGTCAAGGGAGGGAACTGGTAGG + Intronic
1112254987 13:97821318-97821340 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1112937678 13:104821567-104821589 TGTCGAGGGCGGGACCTGGTGGG - Intergenic
1112941477 13:104867068-104867090 TGTCATGGGAGGGATCTGGTGGG - Intergenic
1112967364 13:105213003-105213025 TGTCAAGGGAGGGAACTGGTGGG + Intergenic
1113147449 13:107223642-107223664 TTTCAAGGACAGTTTCTCGTTGG + Intronic
1113502076 13:110783719-110783741 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1114147315 14:19993094-19993116 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1114160624 14:20162561-20162583 TGTCAAGGGTAGGACCAGGTGGG - Intergenic
1114936646 14:27547639-27547661 TGTCATGGAAGGGACCTGGTGGG + Intergenic
1114961251 14:27892691-27892713 TGTCAAGTACAGAACCAGGTGGG - Intergenic
1115065825 14:29258271-29258293 TGTCAAGGGAAGGAACTGGTGGG - Intergenic
1115289125 14:31751096-31751118 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1116047816 14:39765746-39765768 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1116126717 14:40797607-40797629 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1116494365 14:45543360-45543382 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1116696243 14:48182150-48182172 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1116696521 14:48184173-48184195 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1116705418 14:48291381-48291403 TGTCAAGAATAGTATCTGGTAGG - Intergenic
1116725395 14:48556304-48556326 TGTCGAGGGAAGGACCTGGTGGG - Intergenic
1116802617 14:49459011-49459033 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1117907364 14:60604552-60604574 TGTCATGGAAGGGACCTGGTGGG + Intergenic
1117908372 14:60613204-60613226 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1118261637 14:64252762-64252784 TGTCAAGGGAGGGATCTGGTGGG - Intronic
1118945648 14:70384584-70384606 TGTCATGGGAAGGACCTGGTGGG + Intronic
1118956922 14:70491018-70491040 TGTTGAGGAAAGGACCTGGTGGG - Intergenic
1119619980 14:76124735-76124757 TGTCAATGACTGGAGCTGGGAGG + Intergenic
1120192566 14:81452489-81452511 TGTCAGGCACAGAATCTGCTAGG + Intergenic
1120216369 14:81684612-81684634 AGTCTAGTACAGGATCTGATGGG + Intergenic
1120272975 14:82337695-82337717 TGCAAAGGACAGGATAGGGTTGG - Intergenic
1120326689 14:83038289-83038311 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1120346632 14:83298756-83298778 TGTCGAGGGAAGAATCTGGTGGG - Intergenic
1120447087 14:84612624-84612646 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1120491831 14:85188066-85188088 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1120559983 14:85979487-85979509 TGTCATGGGCGGGATCTGGTGGG - Intergenic
1120661514 14:87256658-87256680 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1120661821 14:87258919-87258941 TGTCAAGGGAAGGACCTGGTGGG + Intergenic
1120712400 14:87806582-87806604 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1121150434 14:91628498-91628520 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1121663657 14:95654958-95654980 TGTCAAGGGATGGACCTGGTAGG + Intergenic
1121818749 14:96948712-96948734 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1123127882 14:105962361-105962383 TGTCAAGGGGTGGACCTGGTGGG + Intergenic
1123408400 15:20038492-20038514 TGTCAAGGGATGGACCTGGTGGG + Intergenic
1123517724 15:21045133-21045155 TGTCAAGGGATGGACCTGGTGGG + Intergenic
1123696717 15:22884061-22884083 TGTCAAGGGTGGGAGCTGGTGGG - Intronic
1124201472 15:27681993-27682015 TGGAAAGAACAGGATATGGTGGG - Intergenic
1125206689 15:37161438-37161460 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1125854056 15:42932251-42932273 TGTCAAGGGCGGGAGCAGGTGGG + Intergenic
1126362876 15:47864269-47864291 TGTCAAGGGAGGGAGCTGGTGGG + Intergenic
1126378453 15:48020351-48020373 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1126930187 15:53639168-53639190 TATGAAGGAAAGGATGTGGTAGG - Intronic
1127137431 15:55939206-55939228 TGTCAAGGGAGGGAACTGGTGGG + Intronic
1127743988 15:61944973-61944995 TGTCAAGGGAGGGAACTGGTAGG + Intronic
1129444409 15:75606757-75606779 TTTCAGGGTCAGGATGTGGTTGG + Intronic
1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG + Intergenic
1131429132 15:92372289-92372311 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1131448740 15:92521261-92521283 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1131519448 15:93102431-93102453 TGTCAAGGACAGGCTTCTGTGGG - Intergenic
1133045444 16:3086123-3086145 TGTCAAGGGAAGGACCTGGTAGG - Intergenic
1133077792 16:3293140-3293162 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1133390380 16:5405285-5405307 TGTCATGGAAAGGACCTGGTGGG + Intergenic
1133450280 16:5898244-5898266 TGTCATGGAAGGGACCTGGTAGG - Intergenic
1133536950 16:6711454-6711476 TGTCAAGGGAGGGACCTGGTAGG + Intronic
1133697201 16:8276083-8276105 TGTCAAGGGAAGGGCCTGGTGGG - Intergenic
1133703759 16:8333776-8333798 TGTCGAGGGCAGGACCTGGTGGG + Intergenic
1133748411 16:8705376-8705398 TGTCAAGGGAGGGATCTGGTGGG - Intronic
1134090236 16:11387607-11387629 TGCCGAGGACAGGAGCTGGAAGG + Intronic
1134262144 16:12660020-12660042 TGTCAAGGGACGGACCTGGTGGG - Exonic
1134274010 16:12759607-12759629 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1134277875 16:12792635-12792657 TGTCATGGGAAGGACCTGGTGGG + Intronic
1134296712 16:12952567-12952589 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1134556569 16:15170878-15170900 TGTCAAGGGAAGGACCTGGTGGG - Intergenic
1134917148 16:18082591-18082613 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1135408610 16:22216316-22216338 TGACAATGACAGGAGCTGCTAGG - Intronic
1135862308 16:26067744-26067766 TGTCATGGGGAGGAGCTGGTGGG + Intronic
1136653621 16:31695282-31695304 TGTCAAGGGAAGGACCTGGTGGG - Intergenic
1137888788 16:52136094-52136116 TGTGAAGGGAAGGACCTGGTAGG + Intergenic
1138310251 16:56017468-56017490 TGTCAAGGGAGGGACCTGGTTGG - Intergenic
1138460347 16:57144101-57144123 TGTCAAGGGTAGGGTCTGGATGG + Intronic
1138579300 16:57929779-57929801 TGTCAAGGGACGGACCTGGTGGG - Intronic
1138967980 16:62109485-62109507 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1139139157 16:64240125-64240147 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1139283822 16:65792902-65792924 TGTCAAGGAAGGGACCTGGTGGG - Intergenic
1139372808 16:66479264-66479286 TCTAAAGGACAGGAACAGGTGGG + Intronic
1139425408 16:66876760-66876782 TGTCAAGGGAGGGATCTGGTGGG - Intergenic
1141474708 16:84265049-84265071 TGTCAAGGGCACGGTCAGGTGGG - Intergenic
1141739254 16:85879799-85879821 TGTCAAGAAAGGGAGCTGGTGGG - Intergenic
1141839202 16:86563799-86563821 TGTCAAGAACATGATCTGTTGGG - Intergenic
1142674286 17:1504008-1504030 TGTCAAGGACAGTATCTTGAAGG - Intronic
1143034281 17:3985634-3985656 TGTCAAGGTCAGAGTCTGGAAGG + Intergenic
1143334116 17:6159617-6159639 GGTCAAGGCCAGGGTCGGGTTGG - Intergenic
1144000743 17:11052462-11052484 TGTCAAGGGAGGAATCTGGTGGG - Intergenic
1144079147 17:11746599-11746621 TGTCGAGGGAGGGATCTGGTGGG - Intronic
1144289275 17:13809816-13809838 TGTCAAGGAGGGTACCTGGTGGG + Intergenic
1144498112 17:15763007-15763029 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1145161487 17:20578048-20578070 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1145304444 17:21665558-21665580 GTTCAGGGACAGGAACTGGTGGG + Intergenic
1145757760 17:27405201-27405223 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1146995951 17:37321256-37321278 TGTCAAGGTCAGATTCTGGGAGG - Intronic
1147016895 17:37499222-37499244 TGTCAAGGGCAGGACCAGGTGGG - Intronic
1148081908 17:44971488-44971510 TGTCAAGGACAGCAATGGGTAGG - Intergenic
1148129886 17:45256289-45256311 TGTCAAGGGTAGGGGCTGGTGGG + Intronic
1148222244 17:45871222-45871244 TGTCGAGGGCAGGACCTGGTGGG + Intergenic
1148472776 17:47905841-47905863 TCTAAAGGACAGGAGCTGGCCGG + Intronic
1148529238 17:48373361-48373383 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1149122912 17:53191279-53191301 TGTCAAGGCCAGGACCAGGTGGG - Intergenic
1149398100 17:56265438-56265460 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1149848409 17:60020971-60020993 TGTCAAGGGAGGAATCTGGTGGG - Intergenic
1149861760 17:60125553-60125575 TGTCAAGGGAGGAATCTGGTGGG + Intergenic
1150086757 17:62277538-62277560 TGTCAAGGGAGGAATCTGGTGGG - Intronic
1150115415 17:62544490-62544512 TGTCAGGGGAAGGGTCTGGTGGG - Intronic
1150932418 17:69599537-69599559 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1151189174 17:72385476-72385498 TGACAATCACAGGATCTGGGTGG - Intergenic
1151230360 17:72680393-72680415 TGTCACGGAAGGGACCTGGTGGG + Intronic
1151712851 17:75816822-75816844 TGTACAGGACAGGACCTGGCTGG - Exonic
1153101844 18:1480539-1480561 TGTCAAGGCCAGGACCTGGTGGG - Intergenic
1153206346 18:2707077-2707099 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1153557894 18:6335638-6335660 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1153571491 18:6477694-6477716 TGTCAAGAACAGAACCTGGAAGG - Intergenic
1153642605 18:7169699-7169721 TGTCAGGGACAGCACCTGGGGGG - Intergenic
1154372218 18:13774660-13774682 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1154474006 18:14734601-14734623 TGTTGTGGACAGGACCTGGTGGG + Intronic
1154500785 18:14996858-14996880 TGTTGAGGAAAGGACCTGGTGGG + Intergenic
1154950889 18:21208757-21208779 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1155791407 18:29975233-29975255 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1156125750 18:33903342-33903364 TGTCAAGGGAAGGACCTGGTGGG - Intronic
1156259229 18:35429160-35429182 TGTCAAGGGAGGAATCTGGTGGG - Intergenic
1156333144 18:36144477-36144499 TGTCAAGGGAAGGATCTGGTGGG - Intronic
1156530718 18:37812435-37812457 TGTCATGGGTGGGATCTGGTGGG + Intergenic
1156719892 18:40057437-40057459 TGTCAAGGGCAGGACCAGGTGGG + Intergenic
1157166417 18:45362013-45362035 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1157737741 18:50065595-50065617 TGTCAAGGGAGGGACCTGGTAGG - Intronic
1158166405 18:54546233-54546255 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1158751852 18:60271178-60271200 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG + Intergenic
1159358483 18:67368636-67368658 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1159697164 18:71574852-71574874 TGTCAAGGGAGGGATCCGGTGGG - Intergenic
1159760626 18:72420756-72420778 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1160281521 18:77495130-77495152 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1160573954 18:79838160-79838182 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1160891160 19:1379476-1379498 TGCCAGGGACAGGCTCAGGTGGG - Intergenic
1163068027 19:14813820-14813842 TGTCAAGGAAGGGGCCTGGTGGG - Intronic
1164130175 19:22354772-22354794 TGTCCAGGAAATGCTCTGGTTGG + Intergenic
1165571211 19:36776296-36776318 TGTCAAGGTCGGGAACAGGTAGG - Exonic
1166874651 19:45890282-45890304 AGTCAAGAACAGGAACTGTTAGG + Exonic
1166917956 19:46208605-46208627 TGTCAGGGGAAGGATCTGGTAGG + Intergenic
1167006164 19:46777713-46777735 TGGTATGGGCAGGATCTGGTGGG - Intronic
1167217651 19:48175503-48175525 TGTCAAGGGCTGGATCTGGCAGG + Intronic
1167696638 19:51019125-51019147 TCTCATGGCCAGGATCTGCTGGG + Exonic
925117856 2:1395664-1395686 TGTCAAGGGAGGGACCTGGTGGG + Intronic
925254447 2:2470974-2470996 TGTCAAGGGCAGGACAAGGTGGG + Intergenic
925410486 2:3637085-3637107 TGTCAGGAACACGGTCTGGTGGG - Intronic
925446765 2:3932983-3933005 TGTCATGGAAGGGACCTGGTAGG - Intergenic
925494726 2:4434669-4434691 TGTCAAGGGAGGGAGCTGGTAGG - Intergenic
925511700 2:4634273-4634295 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
925524698 2:4787103-4787125 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
925594628 2:5543164-5543186 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
925711026 2:6740212-6740234 TGTCAAGGGAGGGATCTGGTGGG + Intergenic
926459526 2:13111474-13111496 TGTCATGGGAGGGATCTGGTGGG + Intergenic
926484451 2:13437701-13437723 TGTCAAGGATGGGACCTGGTGGG - Intergenic
926689150 2:15720909-15720931 TGTCAAGGGAGGGACCTGGTGGG + Intronic
926778525 2:16446056-16446078 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
926807848 2:16727995-16728017 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
927237212 2:20885206-20885228 TGTCATGGGAAGGACCTGGTGGG + Intergenic
927342048 2:21993503-21993525 TGTCATGGAAAGGACCCGGTGGG - Intergenic
927524264 2:23722748-23722770 TGTCTTGGAGAGGATCTGTTTGG - Intergenic
929434152 2:41914505-41914527 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
929668097 2:43849497-43849519 TGTCGAGGGAGGGATCTGGTGGG - Intronic
929925724 2:46206541-46206563 TGTCAGGGGAAGGACCTGGTGGG + Intergenic
930168674 2:48229456-48229478 TGTCCAGGGAAGGACCTGGTGGG + Intergenic
930927646 2:56838659-56838681 TGCCAAGGGCGGGACCTGGTGGG - Intergenic
931038761 2:58273447-58273469 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
931639089 2:64365673-64365695 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
931967269 2:67547520-67547542 TGTCATGGAAGGGACCTGGTGGG - Intergenic
932267818 2:70383396-70383418 TGTCAGGGGAAGGAGCTGGTGGG + Intergenic
933000954 2:76922476-76922498 TGTCAGGGGAAGGGTCTGGTGGG - Intronic
933356612 2:81218203-81218225 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
934103306 2:88673623-88673645 TGTCAAGGGAAGGACCTGATGGG + Intergenic
935324819 2:101926346-101926368 TGTCAAGGAAGGGACCTGGTAGG + Intergenic
935351264 2:102153561-102153583 TGTCCAGGGAGGGATCTGGTGGG + Intronic
935425671 2:102916370-102916392 CATCAAGGAAGGGATCTGGTGGG - Intergenic
935437195 2:103047441-103047463 TGTCAGGGGAGGGATCTGGTGGG - Intergenic
935568197 2:104631752-104631774 TGTCAAGGGAGGGATCTGGTGGG - Intergenic
935807148 2:106760382-106760404 TGTCAAGGGCAGGACCTGGTAGG + Intergenic
935900818 2:107790764-107790786 TGTCAAGGAAGGGACCTGGTGGG - Intergenic
936629491 2:114186399-114186421 TGTCAGGGGAAGGACCTGGTAGG + Intergenic
936822852 2:116543754-116543776 TGTCAAGGATGGGACCTGGTGGG - Intergenic
937032652 2:118753330-118753352 TGTCTGGGACAGGATGTGATGGG - Intergenic
937359717 2:121220324-121220346 TGGAAAGGACAGGATGGGGTGGG - Exonic
937491525 2:122372960-122372982 TGTCAAGGGAAGGAACTGGTGGG - Intergenic
937742082 2:125367056-125367078 TGTCATGGAAGGGAGCTGGTGGG + Intergenic
937828094 2:126389496-126389518 TGTCTAGGGAAGGACCTGGTGGG + Intergenic
938499986 2:131827187-131827209 TGTTGAGGAAAGGACCTGGTGGG + Intergenic
938564526 2:132506737-132506759 TGTCATGGGAGGGATCTGGTGGG - Intronic
938725411 2:134104376-134104398 AGTCAAGGACAGGATGGGGAGGG + Intergenic
939445857 2:142309771-142309793 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
939480205 2:142738860-142738882 TGTCATGGATGGGACCTGGTTGG - Intergenic
939727467 2:145740687-145740709 TGTCAGGGAAGGGACCTGGTAGG - Intergenic
941394203 2:164954980-164955002 TGCTAAGTACAGGATCTGTTAGG + Intronic
941698145 2:168575515-168575537 TGTTAAGGGAGGGATCTGGTGGG - Intronic
941705275 2:168651724-168651746 TGTCAAGGGAGGGACCTGGTGGG - Intronic
942192377 2:173483001-173483023 TGTAAATGACAGGATCTCATAGG + Intergenic
942825323 2:180168957-180168979 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
942825573 2:180170828-180170850 TATCAAGGAAGGGACCTGGTAGG - Intergenic
943455814 2:188105155-188105177 TGTCATGGGCGGGACCTGGTGGG - Intergenic
943487428 2:188503524-188503546 TGTCGAGGGAGGGATCTGGTGGG - Intronic
944024413 2:195146023-195146045 TGTTGAGGAAGGGATCTGGTGGG + Intergenic
945372021 2:209030932-209030954 TGTCGTGGAAGGGATCTGGTGGG - Intergenic
945480565 2:210340118-210340140 TGTCATGGAAGGGACCTGGTGGG - Intergenic
945530999 2:210952023-210952045 TGTCGAGGGAGGGATCTGGTTGG - Intergenic
945973094 2:216249549-216249571 TGTCAAGGCAGGGACCTGGTGGG - Intergenic
946124037 2:217544014-217544036 TGTCAAGGGAGGGATCTGGCGGG - Intronic
946863562 2:224022814-224022836 TGCCAAGGGCAGGACCAGGTGGG + Intronic
947255625 2:228160604-228160626 TGTCATGGGAGGGATCTGGTGGG - Intronic
947274958 2:228380199-228380221 TGTCGAGGGAGGGATCTGGTGGG + Intergenic
947325286 2:228967851-228967873 TGTCAGGGGAAGGACCTGGTGGG + Intronic
947529804 2:230901588-230901610 TGTCAAAGGCAGAATCTGCTGGG + Intergenic
947902963 2:233738038-233738060 TGTTGAGGACAGGACATGGTGGG + Intronic
947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG + Intronic
947904644 2:233751586-233751608 TGTTAAGGATGGGACCTGGTGGG + Intronic
948292548 2:236836797-236836819 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
948696238 2:239734445-239734467 TGTCAAGGGAGGGACCTGGTAGG - Intergenic
1169986448 20:11450509-11450531 TGTCAAGGGAAGGACCTGGTGGG - Intergenic
1170648457 20:18217291-18217313 TGTCATGGAACGGACCTGGTGGG + Intergenic
1170971475 20:21121062-21121084 TGTCGAGGAAAGGACCTGGTGGG - Intergenic
1171306064 20:24107407-24107429 TGTCAGGAACAGGATCTTCTGGG - Intergenic
1171521961 20:25782990-25783012 GTTCAGGGACAGGAACTGGTGGG + Intronic
1171554864 20:26072893-26072915 GTTCAGGGACAGGAACTGGTGGG - Intergenic
1172432984 20:34907950-34907972 TGTGAAGGACAGGGACTGGCAGG - Intronic
1172744943 20:37199649-37199671 TGTGAAAGACAGCATCTGGTGGG + Intronic
1173957502 20:47045530-47045552 TTTTAAGGACAGGATGTGGTAGG - Intronic
1174918098 20:54674292-54674314 TGTCGAGGAAAGGGCCTGGTGGG + Intergenic
1175269102 20:57721269-57721291 GGGCAAGGACAGGTTCTGGCTGG + Intergenic
1175376342 20:58527318-58527340 TGTCATGGGAGGGATCTGGTGGG - Intergenic
1175629883 20:60526672-60526694 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1175914345 20:62418841-62418863 CGGCAAGGAGAGGGTCTGGTGGG - Intronic
1176675863 21:9776578-9776600 TTTCAAGGACATGATATGGGAGG - Intergenic
1177200759 21:17953025-17953047 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1177275671 21:18910120-18910142 TGTCAAGGGAAGGATCTGGTGGG + Intergenic
1177285782 21:19047817-19047839 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1177328875 21:19629828-19629850 TGTCAAGGGAGGTATCTGGTGGG + Intergenic
1177674853 21:24283983-24284005 TGTCAAGGCAGGGAACTGGTAGG + Intergenic
1177803363 21:25849496-25849518 TGTCAAGGGAAGGACCTGGTGGG + Intergenic
1178013835 21:28318705-28318727 TGTCAAGGGCAGGACCTGGTAGG + Intergenic
1178033147 21:28551280-28551302 TGCCAAGGAAGGGAACTGGTGGG + Intergenic
1178198662 21:30378154-30378176 TGTCAAGGAAGGGACCTGGTGGG + Intronic
1178374027 21:32051523-32051545 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1178627953 21:34233822-34233844 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1178945148 21:36940821-36940843 TGTCAAGGGACGGACCTGGTGGG + Intronic
1179043262 21:37823471-37823493 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1179267502 21:39817221-39817243 TGTCATGGGAAGGACCTGGTGGG + Intergenic
1179271835 21:39857624-39857646 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG + Intergenic
1180254682 21:46617348-46617370 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1181269469 22:21650836-21650858 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1181871987 22:25906899-25906921 GGTCAAGGGAAGGACCTGGTGGG - Intronic
1182811645 22:33121975-33121997 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1184297491 22:43534141-43534163 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1184613371 22:45620963-45620985 TGTCAAGGAAGGGACCTGGTGGG - Intergenic
1184906751 22:47493035-47493057 TGTCATGGAAAGGAACTGGTGGG + Intergenic
949261292 3:2105629-2105651 TGTCAAGGGTGGGACCTGGTAGG - Intronic
950531521 3:13554865-13554887 TGTCAAGGACAGGAGGTAGGAGG - Intronic
951246260 3:20345088-20345110 TGTCAAGGGAGGGAGCTGGTGGG - Intergenic
951385135 3:22032481-22032503 TGTCAAGGGAAGAACCTGGTGGG - Intronic
952667498 3:35924130-35924152 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
956018765 3:64911884-64911906 TTTAAAGGACAAAATCTGGTCGG + Intergenic
956252764 3:67252287-67252309 TGTCGAGAAGGGGATCTGGTGGG + Intergenic
956905428 3:73760423-73760445 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
956916051 3:73872119-73872141 TGTTGAGGGAAGGATCTGGTGGG + Intergenic
956956354 3:74345284-74345306 AGTCAAGCGCAGGTTCTGGTGGG + Intronic
957134855 3:76273761-76273783 TGTCATGGGAGGGATCTGGTGGG - Intronic
958710350 3:97709702-97709724 TGTCAAGGGAGGGATTTGGTGGG + Intronic
959569012 3:107861965-107861987 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
959788520 3:110329759-110329781 TGTCAAGGGAAGGGCCTGGTAGG + Intergenic
959878324 3:111413107-111413129 TGTCAAGGGAGGGACCTGGTGGG - Intronic
959917753 3:111836857-111836879 TGTCAAGGGAGGGACCTGGTGGG - Intronic
960399632 3:117180472-117180494 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
960435276 3:117618931-117618953 TGTCAAGGGTAGTACCTGGTGGG + Intergenic
960540580 3:118857359-118857381 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
960550348 3:118969435-118969457 CGTAAAGGACAGGTTCAGGTTGG + Intronic
960554186 3:119009379-119009401 TGTCAAGGGAGGGACCTGGTGGG + Intronic
960581303 3:119281494-119281516 TGTCAAGGGCGGGACCTGTTGGG + Intergenic
960902336 3:122564911-122564933 TGACAAGGACAGCAGCTGGCAGG - Intronic
961099498 3:124186577-124186599 TGCTTAGGACAGGTTCTGGTTGG - Intronic
962637237 3:137343574-137343596 TGTCAAGGAAGGGACCTGATGGG - Intergenic
962650447 3:137483476-137483498 TGTCAAGGGAAGGACCTGGTGGG + Intergenic
963006868 3:140734628-140734650 TGTCGAGGAAGGGACCTGGTGGG + Intergenic
963267003 3:143249736-143249758 TGTCAAGGGAAGGACCTGGTGGG - Intergenic
963516713 3:146317841-146317863 TGTCATGGGAGGGATCTGGTGGG - Intergenic
963831585 3:150014810-150014832 AGTCCTGGAAAGGATCTGGTAGG - Intronic
963898096 3:150707087-150707109 TGTTGAGGGCAGGACCTGGTGGG - Intergenic
963937063 3:151064829-151064851 TGTCAAGGGTGGGACCTGGTGGG + Intergenic
964026322 3:152079231-152079253 TGTCAAGGGAAGGACCTGGTGGG - Intergenic
964299211 3:155269642-155269664 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
964390634 3:156193740-156193762 TGTCGAGGAAGGGACCTGGTAGG - Intronic
964509129 3:157431046-157431068 TGTCAAGGGAGGGACCTGGTGGG + Intronic
964933893 3:162058800-162058822 TGTCAAGGAAAGGACCTGGTGGG - Intergenic
965031202 3:163370293-163370315 TGTCATGGCAAGGACCTGGTGGG - Intergenic
965190805 3:165526612-165526634 TGTCATGGGAGGGATCTGGTGGG - Intergenic
965278109 3:166714099-166714121 TGTCAAGGGAGGGGTCTGGTGGG - Intergenic
965326509 3:167310695-167310717 TGTCAAGGGAGGGACCTGGTGGG - Intronic
966100244 3:176260074-176260096 TGTCATGGGAGGGATCTGGTGGG + Intergenic
966346769 3:178989497-178989519 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
966538996 3:181068108-181068130 TGTCAGGGACATGATGGGGTTGG + Intergenic
967208601 3:187146657-187146679 TGTCAAGCAAGGGACCTGGTGGG - Intronic
967255631 3:187589206-187589228 TGTTGAGGGCAGGACCTGGTGGG - Intergenic
967348173 3:188481976-188481998 TGTCAAGGGAGGGATCTGGTGGG + Intronic
967788986 3:193527212-193527234 TGTCAAGGGAGGGACCTGGTGGG + Intronic
968530652 4:1089673-1089695 TGTCAAGGGAGGGATCCGGTGGG + Intronic
969618825 4:8268825-8268847 TGTTAATGGCAGGTTCTGGTCGG - Intergenic
969890421 4:10255008-10255030 TGTCAAGAAGATAATCTGGTCGG + Intergenic
970061390 4:12038328-12038350 TGTTGAGGACAGGACCTGTTGGG + Intergenic
970150420 4:13083290-13083312 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
970196927 4:13560418-13560440 TGTCAAGGGAAGAACCTGGTGGG - Intergenic
970482263 4:16488229-16488251 TGTCATGGAAGGGACCTGGTGGG - Intergenic
970540602 4:17074480-17074502 TGTCGAGGGAAGGAACTGGTGGG - Intergenic
970611319 4:17727740-17727762 TGTCAAGGGAAGGACTTGGTGGG - Intronic
970815419 4:20150585-20150607 TGTCATGGGAGGGATCTGGTAGG - Intergenic
971278601 4:25221947-25221969 TGTCATGGGAGGGATCTGGTGGG - Intronic
972031517 4:34465196-34465218 TGTCAAGGGCAGGACATGGTGGG + Intergenic
972037131 4:34539126-34539148 TGTCATGGGAGGGATCTGGTGGG + Intergenic
972051808 4:34744131-34744153 TGTCAAGGAAGAGACCTGGTGGG - Intergenic
972822621 4:42719173-42719195 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
972827401 4:42775760-42775782 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
972894536 4:43603016-43603038 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
973121855 4:46530657-46530679 TGTCAAGGGCAGGACCTTGTGGG - Intergenic
973136658 4:46716495-46716517 TGTCAAGGGAGGGAACTGGTAGG - Intergenic
973335008 4:48947269-48947291 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
974076237 4:57170948-57170970 TGTCAAGGGTGGGACCTGGTGGG + Intergenic
974134607 4:57799361-57799383 TGTCACGGGAGGGATCTGGTGGG - Intergenic
974219184 4:58944386-58944408 TGTCATGGAAGGGACCTGGTGGG - Intergenic
974425273 4:61734609-61734631 TGTGGAGGGCAGGACCTGGTGGG - Intronic
974581332 4:63806519-63806541 TGCCAAGATCAGGATTTGGTGGG + Intergenic
974593670 4:63988602-63988624 TGTCAAGGAAGGGACCTGATGGG + Intergenic
974806227 4:66883585-66883607 TGTCAAGGTAGGGACCTGGTGGG + Intergenic
974931574 4:68366265-68366287 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
974939982 4:68455557-68455579 TGTCAAGAAGAAGATTTGGTAGG + Intronic
975037071 4:69697254-69697276 TGTTGAGGGCAGGACCTGGTGGG + Intergenic
975388061 4:73781711-73781733 TGTCAAGTGCAGGACCAGGTGGG - Intergenic
975400491 4:73931623-73931645 TGTCATGGAAGGGACCTGGTGGG + Intergenic
975946566 4:79713280-79713302 TGCCAAGGATAGGATAGGGTAGG - Intergenic
976450659 4:85186913-85186935 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
976618268 4:87100336-87100358 TGTCAGGGACAGGCCGTGGTAGG - Intronic
976726478 4:88220716-88220738 TGTCATGGGAAGGACCTGGTGGG + Intronic
976926355 4:90502412-90502434 TGTTAAGGGAAGGACCTGGTGGG - Intronic
976987162 4:91315946-91315968 TGTCATGGGAAGGAGCTGGTGGG + Intronic
977056879 4:92203667-92203689 TGTCATGGAAGGGACCTGGTGGG - Intergenic
977379382 4:96252262-96252284 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
977477843 4:97536296-97536318 TGTCAAGGGAGGGAGCTGGTGGG + Intronic
977711992 4:100137169-100137191 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
978769703 4:112442186-112442208 TGTCATGGGAAGGACCTGGTAGG - Exonic
978879282 4:113681260-113681282 TGTCAGGGGAAGGACCTGGTGGG + Intronic
978896163 4:113890054-113890076 TGTCACGGAAGGGATCGGGTGGG - Intergenic
979034327 4:115693782-115693804 AGTCAAGCACATGATCTGGGAGG + Intergenic
979068433 4:116168960-116168982 TGTCAAAGGTAGGACCTGGTGGG - Intergenic
979781288 4:124653985-124654007 TGTCAAGGGAGGGAGCTGGTGGG + Intergenic
980066104 4:128190503-128190525 TGTCAAGGGAGGGACCTGGTAGG + Intronic
980197518 4:129609787-129609809 TGTCAATGTCAGGCTCTGTTTGG + Intergenic
980576360 4:134687806-134687828 TGGCAAGGACAGCATAGGGTGGG + Intergenic
980579247 4:134728446-134728468 TGTCAAGGGAGGGACCTGGTAGG + Intergenic
980746215 4:137020115-137020137 TGTCGAGGAAGGGACCTGGTGGG + Intergenic
981109112 4:140915456-140915478 TGACAAAGTCAGGATCTGGGAGG - Intronic
981407352 4:144386607-144386629 TGTCATGGAAGGAATCTGGTGGG - Intergenic
981523409 4:145688430-145688452 TGTCAAGGGAAGGTCCTGGTAGG + Intronic
981611313 4:146596887-146596909 TGTCATGGAAGGGACCTGGTGGG - Intergenic
981695361 4:147553748-147553770 TGTCGTGGGCAGGACCTGGTGGG + Intergenic
982371075 4:154634068-154634090 TGTCCAGGAAGGGACCTGGTGGG + Intronic
982731913 4:158964937-158964959 AGTCAAGGAAAGGACCTGGTGGG - Intronic
982797726 4:159665329-159665351 TGTCAAGGGAGGGACCTGGTAGG - Intergenic
982816925 4:159897314-159897336 TGTCATGGAAGGGACCTGGTGGG + Intergenic
983133304 4:164049323-164049345 TGTCAAGGGAGGGACCTGGTGGG - Intronic
983204338 4:164897774-164897796 TGTCAAGGACCTGTTCTGGTAGG - Intronic
983305310 4:165977202-165977224 TGTCGAGGGCAGAACCTGGTGGG + Intronic
983860210 4:172696514-172696536 TGTCATGGGAGGGATCTGGTGGG + Intronic
984026157 4:174546248-174546270 TGTCAAGGGAGAGATCTGGTAGG - Intergenic
984571799 4:181403969-181403991 TGTCAAGGGAGGGAGCTGGTGGG - Intergenic
984942664 4:184947738-184947760 TGTCAAGGGAGAGATCTGGTGGG + Intergenic
985063611 4:186101624-186101646 TTTCAAGGCCAGGATCTGGAAGG + Intergenic
985144428 4:186880043-186880065 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
985399678 4:189582124-189582146 TTTCAAGGACACGATATGGGAGG + Intergenic
985542063 5:491956-491978 TGTGAAGGACGCGATGTGGTCGG + Exonic
985869934 5:2546187-2546209 TGTCGAGGGCAGGACTTGGTGGG - Intergenic
986636330 5:9825443-9825465 TGTCATGGAAGGGACCTGGTGGG - Intergenic
986869116 5:12027178-12027200 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
986900055 5:12420601-12420623 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
986967034 5:13286410-13286432 TGTCATGGGAAGGACCTGGTGGG + Intergenic
987011266 5:13768180-13768202 TGTCAAGGGAGGGACCTGGTGGG + Intronic
987172192 5:15270427-15270449 TGTCATGGGAGGGATCTGGTGGG + Intergenic
987593405 5:19963440-19963462 TGTCATGGGAGGGATCTGGTGGG + Intronic
987659687 5:20855788-20855810 TGTCATGGGAGGGATCTGGTGGG + Intergenic
987743959 5:21946912-21946934 TGTCAAGGGCAAGACCTGGTGGG + Intronic
988083793 5:26446826-26446848 TGTCAGGGGCAGGACCTGATGGG - Intergenic
988385172 5:30553666-30553688 TGTGGAGGGCAGGACCTGGTGGG + Intergenic
988763957 5:34349859-34349881 TGTCATGGGAGGGATCTGGTGGG - Intergenic
988770303 5:34426684-34426706 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
988901407 5:35736604-35736626 TGTCAAGGGAAGGACCTGGTAGG - Intronic
989222682 5:38986111-38986133 TGTCGAGGAAGGGACCTGGTGGG + Intronic
989245517 5:39249912-39249934 TGTTGAGGAAAGGACCTGGTGGG + Intronic
989248730 5:39282781-39282803 TGTCAAAGGAAGGACCTGGTGGG - Intergenic
989738597 5:44740509-44740531 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
989746681 5:44838210-44838232 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
990015809 5:51061187-51061209 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
990026889 5:51203100-51203122 TGTCAAGGAAGGGACTTGGTTGG + Intergenic
990136163 5:52645914-52645936 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
990202865 5:53397525-53397547 TGTCAAGGAAGAGATCTGGTGGG + Intergenic
990933826 5:61125078-61125100 TGTCAGGGGAGGGATCTGGTAGG - Intronic
991136365 5:63186344-63186366 TGTCAGGGAAGGGACCTGGTAGG + Intergenic
991276189 5:64849684-64849706 TGTCAAGGGAGGGACCTGGTGGG + Intronic
991355617 5:65766487-65766509 TGTCAAGGGAGGGAGCTGGTGGG - Intronic
991439069 5:66627303-66627325 TGTCATGGGAAGGACCTGGTGGG - Intronic
991562861 5:67972803-67972825 TGTCAGAGATAGGGTCTGGTGGG - Intergenic
991636034 5:68706904-68706926 TGTTAAGGGCAGGATCTTGTGGG - Intergenic
991764156 5:69957051-69957073 TGTCAAGGGCAAGACCCGGTGGG + Intergenic
991783169 5:70161096-70161118 TGTCAAGGGCAAGACCCGGTGGG - Intergenic
991843388 5:70832123-70832145 TGTCAAGGGCAAGACCCGGTGGG + Intergenic
991875612 5:71161423-71161445 TGTCAAGGGCAAGACCCGGTGGG - Intergenic
992411561 5:76510559-76510581 TCTCATGGACACGATCTGGAAGG + Intronic
992562565 5:77966999-77967021 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
993036729 5:82767401-82767423 TGTCATGGGAGGGATCTGGTGGG + Intergenic
993675806 5:90814501-90814523 TGTCAAGGGTGGGATCTGGTGGG + Intronic
993753147 5:91695083-91695105 TGTCGAGGGAAGGATCTGGTGGG - Intergenic
993787405 5:92160187-92160209 TGTCAAGGAAGGGACCTGTTGGG - Intergenic
994294078 5:98068028-98068050 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
994630564 5:102280819-102280841 TGTCAAGGGAGGGACCTGGTGGG - Intronic
994759804 5:103837749-103837771 TGTCAAGGCGGGGACCTGGTGGG - Intergenic
995358940 5:111271105-111271127 TGTCAAGGGAGGGACCTGGTAGG - Intronic
996818766 5:127602375-127602397 TGTCAGGGACAAGATGAGGTGGG - Intergenic
997564634 5:134877446-134877468 TGTGAAGGTCAGGGTCTGGAGGG + Intronic
997642229 5:135456735-135456757 TGGCTAGGACAGCCTCTGGTTGG + Intergenic
997695749 5:135859410-135859432 TGTCATGGGAGGGATCTGGTAGG - Intronic
997728988 5:136150926-136150948 AGTAAAGAACAGAATCTGGTGGG + Intronic
998618208 5:143764597-143764619 TGTCAAGGGCAGGACTGGGTGGG - Intergenic
998794744 5:145806685-145806707 TGTCAAGGGAGGGACCTGGTGGG + Intronic
999065672 5:148683239-148683261 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
999082943 5:148861378-148861400 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
999969430 5:156844579-156844601 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1000471563 5:161648756-161648778 TGTCGAGGGCAGGACCTGGTGGG + Intronic
1000575529 5:162970634-162970656 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1000581162 5:163036416-163036438 TGTCTTGGGAAGGATCTGGTGGG + Intergenic
1000658131 5:163906926-163906948 TGTCACGGGAAGGACCTGGTGGG - Intergenic
1001592924 5:172878693-172878715 TGTCAAGGTCAGGATTTGAGGGG + Intronic
1001688599 5:173615405-173615427 TTTCCATGACAGGCTCTGGTAGG + Intronic
1002429197 5:179193219-179193241 TGTCCAGGACGGGAGCTGGCTGG + Intronic
1002869967 6:1157671-1157693 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1003714900 6:8635423-8635445 TGTCAAGAGCAGGACCTGGTGGG + Intergenic
1003757255 6:9135674-9135696 TGTCAAGGAAGGGACCTGGTGGG - Intergenic
1003820844 6:9895389-9895411 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1004372576 6:15065209-15065231 TGTCGAGGAAGGGACCTGGTGGG - Intergenic
1004776657 6:18853986-18854008 TGTCAAGGGAGGGACCTGGTTGG - Intergenic
1005187080 6:23174626-23174648 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1005441189 6:25870759-25870781 TGTCATAAACAGGATCTGTTTGG + Intronic
1006816517 6:36854296-36854318 TGTCGAGGGAGGGATCTGGTGGG + Intergenic
1007009461 6:38401132-38401154 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1008707987 6:54186746-54186768 TGTTGAGGGCAGGAACTGGTGGG - Intronic
1008751577 6:54739949-54739971 TGTCATGGGCAGGACCTGGTAGG + Intergenic
1008967627 6:57329514-57329536 TGTCATGGAAAGGACTTGGTGGG + Intronic
1010261337 6:73820654-73820676 TGGCGAGGGCAGGATTTGGTAGG + Intronic
1010467944 6:76190899-76190921 TGTCAAGGGTGGGATCAGGTGGG + Intergenic
1010515145 6:76763250-76763272 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1010551680 6:77231183-77231205 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1010688112 6:78876094-78876116 TGTCAAGGGGGGGATCTGATGGG + Intronic
1010873325 6:81069198-81069220 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1010895480 6:81357794-81357816 TATCAAGGGAAGGACCTGGTAGG - Intergenic
1011188584 6:84706266-84706288 AGCCAAGGACAGCATCTGGCTGG - Intronic
1011218765 6:85032757-85032779 TGTCGAGGAAGGGATCTGGTGGG - Intergenic
1011219019 6:85034658-85034680 TGTCAGGGAAAGGATATGGTAGG - Intergenic
1011955345 6:93018552-93018574 TGTCAAGGGAGGGATCTGGTGGG + Intergenic
1012097322 6:94978504-94978526 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1012140506 6:95621080-95621102 TGTCATGGAAGGGACCTGGTAGG + Intergenic
1012254278 6:97014925-97014947 TGTCAGGGGAAGGACCTGGTGGG + Intronic
1013163780 6:107571273-107571295 AGTCAAGGAAAGGAAATGGTAGG + Intronic
1013360727 6:109391616-109391638 GGTCAAGGACAAGGTCTGTTAGG + Intronic
1014096086 6:117463862-117463884 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1015239454 6:131007181-131007203 TGTCAAGGGTAGGACCAGGTGGG + Intronic
1015319072 6:131851261-131851283 TGTCAAGGTCAGGTGCTCGTTGG + Exonic
1015388132 6:132649770-132649792 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1015476260 6:133661710-133661732 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1016970179 6:149754727-149754749 TGTCACGGGCAGGATCAAGTGGG - Intronic
1017133386 6:151127477-151127499 TGTTGAGGAAAGGACCTGGTGGG + Intergenic
1017461106 6:154651414-154651436 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1017611800 6:156194718-156194740 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1017652327 6:156594963-156594985 AGTCAAGGGCGGGACCTGGTGGG - Intergenic
1018209164 6:161463547-161463569 GGTCAAAGAAAGCATCTGGTAGG - Intronic
1018592484 6:165442636-165442658 TATCAAGGGAAGGACCTGGTGGG - Intronic
1018653230 6:166008481-166008503 CGCCAAGGACAGGATGGGGTGGG + Intergenic
1019199468 6:170302353-170302375 TGTCATGGGAAGGACCTGGTGGG - Intronic
1019512760 7:1426177-1426199 CCTCGAGGACAGGAGCTGGTGGG + Intergenic
1019619217 7:1981502-1981524 TCTCATGGACAGGATCCGATGGG + Intronic
1019774924 7:2906679-2906701 TGTCAAGGACAAGATCGGCGAGG - Exonic
1019914125 7:4121334-4121356 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1020280126 7:6646089-6646111 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1020471243 7:8537573-8537595 TGTCATGGGAAGGACCTGGTGGG - Intronic
1020720346 7:11736852-11736874 TGTCATAGGAAGGATCTGGTGGG + Intronic
1020857793 7:13451236-13451258 TGTCAAGGGAGGGACCTGGTCGG - Intergenic
1020874913 7:13681173-13681195 TGTCATGGAAGGGACCTGGTGGG + Intergenic
1020944009 7:14578019-14578041 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1020981084 7:15069917-15069939 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1021264055 7:18497039-18497061 TCTCAAGGAGATGAGCTGGTGGG + Intronic
1022062071 7:26807305-26807327 TGTCCAGGGAAGGACCTGGTGGG + Intronic
1022211190 7:28211259-28211281 TGTCATGGGCAGGACCTGGTGGG - Intergenic
1022297972 7:29074597-29074619 TGTTGAGGAAGGGATCTGGTGGG + Intronic
1022455571 7:30555561-30555583 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1022549056 7:31219680-31219702 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1022639227 7:32165676-32165698 TGTCAAGGGAAGAATCTGATGGG - Intronic
1022693524 7:32682068-32682090 TGTCAAGGGAAGAACCTGGTGGG + Intergenic
1022706140 7:32803689-32803711 TGTTAAGGGAGGGATCTGGTGGG - Intergenic
1022846706 7:34217065-34217087 TGTCAAGGGAGGGATCTGGTGGG - Intergenic
1023040989 7:36173120-36173142 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1025282461 7:57638172-57638194 GTTCAGGGACAGGAACTGGTGGG + Intergenic
1025302262 7:57827235-57827257 GTTCAGGGACAGGAACTGGTGGG - Intergenic
1025748613 7:64270776-64270798 TGTCAAGGAAGGGACTTGGTGGG + Intergenic
1026325393 7:69305083-69305105 TGTCAAAGGCAGGACCTGGTGGG + Intergenic
1026326652 7:69316248-69316270 TGTCAAGGGCAGGACCTGGTGGG + Intergenic
1027353144 7:77332121-77332143 TGCCCAGGACAGGATATGGGAGG + Intronic
1027401877 7:77817605-77817627 TGTCATGGGAAGGACCTGGTGGG - Intronic
1027426136 7:78062919-78062941 TGTGAAGGACAGGATCAGAGAGG - Intronic
1027560107 7:79718875-79718897 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1027729566 7:81853622-81853644 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1027916003 7:84322167-84322189 TGTCAAGGGCAGAACCTGGTGGG - Intronic
1027963353 7:84974851-84974873 TGTCAAGGAAGGGACCTGGTGGG - Intergenic
1028256481 7:88604448-88604470 TGTCAAGGAAGGGACCTGGTGGG + Intergenic
1028299913 7:89185562-89185584 TTGAAAAGACAGGATCTGGTCGG + Intronic
1028404996 7:90465179-90465201 TGTCATGGGAAGGACCTGGTGGG + Intronic
1029328635 7:99832328-99832350 TGTCAAGGAAGGGACCTGGTGGG + Intronic
1030264570 7:107606512-107606534 TCTTTAGGACAGGATCTGGCAGG + Intronic
1030876953 7:114825609-114825631 TGTCAAGGGAAGGACGTGGTGGG - Intergenic
1030944049 7:115694115-115694137 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1031204603 7:118740550-118740572 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1031249345 7:119359449-119359471 TGTCATGGAAGGGATCTGGTGGG - Intergenic
1031255103 7:119436736-119436758 TGTCAAGGGTAGGACCCGGTGGG - Intergenic
1031334750 7:120514692-120514714 TTCCATGGACAGGAGCTGGTGGG + Intronic
1031475748 7:122219163-122219185 TGTCAAGTACAGTATGTGTTTGG + Intergenic
1032366604 7:131305965-131305987 TGTCAGGGAAAGGACCTGGTGGG + Intronic
1033257646 7:139815991-139816013 TGTCAAGGGAGGGATCTGGTGGG + Intronic
1033482904 7:141759746-141759768 TGTCAAGGTAGGGACCTGGTAGG - Intronic
1033562726 7:142547886-142547908 TGTCAAGGGAGGGAACTGGTGGG + Intergenic
1034039262 7:147860028-147860050 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1034518739 7:151602738-151602760 TGCCAAGGGCAGGACCTGCTGGG + Intronic
1035456624 7:159013381-159013403 GGTCAAGGTCAGGATTGGGTTGG + Intergenic
1035525947 8:313533-313555 AGTCAAGGACAGGCCCGGGTTGG - Intergenic
1035548047 8:498764-498786 TGTCAGGGAAGGGACCTGGTGGG + Intronic
1036279299 8:7385929-7385951 TGTCAAGGGAGGGATCTGGTGGG + Intergenic
1036342215 8:7925944-7925966 TGTCAAGGGAGGGATCTGGTGGG - Intergenic
1036457397 8:8921979-8922001 TGTCAAGGTAGGGACCTGGTGGG + Intergenic
1037045098 8:14290065-14290087 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1037072806 8:14673281-14673303 TGTCAAGGGACGGACCTGGTGGG + Intronic
1037119527 8:15266492-15266514 TGTGAAGGGAGGGATCTGGTGGG - Intergenic
1037173396 8:15920034-15920056 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1037908566 8:22729670-22729692 AGTCAAGCACAGGATCTGCTGGG - Intronic
1038144301 8:24880264-24880286 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1038959054 8:32498605-32498627 TGTCATGGAAGGGACCTGGTCGG - Intronic
1039037869 8:33378956-33378978 TGTCAAGGGAGGGAACTGGTGGG + Intronic
1039082208 8:33744550-33744572 TGTCATGGAAAGGAACTGGTGGG - Intergenic
1039585845 8:38706312-38706334 TGTCAAGAGCAGGACCTGGTGGG + Intergenic
1041186728 8:55308535-55308557 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1041422692 8:57686533-57686555 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1041927430 8:63251128-63251150 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1042472399 8:69206343-69206365 TGTCATGGAAGGGATCTGGTGGG + Intergenic
1043059971 8:75488042-75488064 TGTCATGGGAGGGATCTGGTGGG - Intronic
1043696346 8:83223408-83223430 TGTGGAGGGTAGGATCTGGTGGG - Intergenic
1043779315 8:84312241-84312263 TGTTCAGGAAAGGACCTGGTGGG - Intronic
1043779596 8:84314229-84314251 TGTCAAGGGAGGGATCTGGTGGG - Intronic
1043842016 8:85117739-85117761 TGTTAAGGGTAGAATCTGGTTGG - Intronic
1044157510 8:88866267-88866289 TGTCAAGGGAAGGACTTGGTTGG - Intergenic
1044300507 8:90577815-90577837 TGTCAAGGGCAGGGCCAGGTAGG - Intergenic
1044359080 8:91260354-91260376 TGTCAAGGGAGGGATATGGTAGG - Intronic
1045257901 8:100545299-100545321 TATCAAGGAAGGGACCTGGTGGG + Intronic
1045258192 8:100547244-100547266 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1045416314 8:101971383-101971405 TGTCAAGGGCAGGACCTGGTGGG + Intronic
1045700895 8:104864915-104864937 TGTCAAGGGAGGGAGCTGGTGGG - Intronic
1046407835 8:113797922-113797944 TGTCATGGAAGGGAGCTGGTGGG - Intergenic
1046755926 8:117972896-117972918 TGTCATGGGAGGGATCTGGTGGG - Intronic
1046813424 8:118557131-118557153 TGTCAAGGGAAGGACCGGGTGGG + Intronic
1047573677 8:126130060-126130082 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1047648895 8:126898836-126898858 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1047870078 8:129072329-129072351 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1048017728 8:130512499-130512521 TGTCAAGGGCAGGACCTGGTGGG + Intergenic
1048376654 8:133828490-133828512 TGTCTAGGGAAGGACCTGGTGGG - Intergenic
1048527457 8:135216167-135216189 TGTCAAGGAAGGGACCTGGTGGG - Intergenic
1048589115 8:135804663-135804685 TGTCAAGGGAAGGACCTGGGGGG + Intergenic
1048782603 8:138018027-138018049 TGTCCAGCAAGGGATCTGGTAGG + Intergenic
1049068893 8:140341730-140341752 TGTCAAGGAAAGGGGCTGGAGGG + Intronic
1050634221 9:7593101-7593123 TGTCATGGGAGGGATCTGGTGGG + Intergenic
1050715046 9:8514821-8514843 TGTCAAAGAAGGGACCTGGTGGG + Intronic
1050987655 9:12103308-12103330 AGTCAAGGGAGGGATCTGGTGGG - Intergenic
1051738097 9:20224095-20224117 TGTCAAGGGAGGGACCTGGTTGG - Intergenic
1052124122 9:24754837-24754859 TGTCATGGAGGGGACCTGGTGGG + Intergenic
1052129117 9:24819663-24819685 TATCAAGGGAAGGACCTGGTAGG + Intergenic
1052136084 9:24911953-24911975 TGTCAAGGACAGGAAATGCATGG - Intergenic
1052282384 9:26748086-26748108 TGTCACGGAAGGGACCTGGTGGG + Intergenic
1052377216 9:27730880-27730902 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1052552165 9:29966116-29966138 TGTCAGGGAAGGGACCTGGTGGG - Intergenic
1053264410 9:36700197-36700219 TGTCAAGGGAGGGATCTGGTGGG - Intergenic
1055378760 9:75682972-75682994 TGTCAAGGGCGGGAACTGGTGGG - Intergenic
1055552154 9:77441203-77441225 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1057745000 9:97744149-97744171 TGTCAAAGGCGGGATCTGATGGG + Intergenic
1058238143 9:102519489-102519511 TGTCAAGGGCGGGACCTGGCGGG + Intergenic
1058307614 9:103463311-103463333 TGTCATGGAAAGGATGTGGTGGG - Intergenic
1058309379 9:103483044-103483066 TGTCAAGGAAAAGACCTAGTTGG + Intergenic
1058316935 9:103580526-103580548 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1058370378 9:104259356-104259378 TCTCAGTGACAGGATCTGATGGG + Intergenic
1058627925 9:106954417-106954439 TGTCAAGGAAGGGACCTTGTGGG - Intronic
1058939070 9:109796811-109796833 TGTCAGGGGCAGAACCTGGTGGG - Intronic
1059022907 9:110596260-110596282 TGTTAAGGAAAAGACCTGGTTGG - Intergenic
1059265262 9:113022654-113022676 TGTCAAGGGTGGGACCTGGTAGG - Intergenic
1059599674 9:115763069-115763091 TGTCATGGAAGGGACCTGGTGGG + Intergenic
1059868631 9:118545931-118545953 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1060327850 9:122634636-122634658 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1060605846 9:124913220-124913242 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1060724478 9:125997877-125997899 TGGCAAGGACAAGCTCTGGGAGG + Intergenic
1185955939 X:4489125-4489147 TGTCGAGGGAAGGACCTGGTGGG + Intergenic
1186039476 X:5460520-5460542 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1186379814 X:9046404-9046426 TGTCAAGGGAGGGACCTGGTGGG - Intronic
1187277216 X:17826694-17826716 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1187405032 X:18996422-18996444 GGCCAAGGACAGGATGTGGGAGG - Intronic
1187437413 X:19285357-19285379 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1187717874 X:22121446-22121468 TGTCGAGGACAGGATGGGGGTGG + Intronic
1188002203 X:24993669-24993691 CGTCAGGGACAGGGGCTGGTGGG - Intronic
1188127232 X:26384027-26384049 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1188305590 X:28557376-28557398 TGTCAAAGAAAGGACCTGGTGGG - Intergenic
1188527979 X:31106807-31106829 TGTCCAGGGAAGGACCTGGTGGG - Intronic
1188662222 X:32774697-32774719 TGTCAAGGGAGGGAACTGGTGGG - Intronic
1188813293 X:34680028-34680050 TGTCAAGGGAGGGATCTGGTGGG - Intergenic
1188982104 X:36735758-36735780 TGTCTATGAGAGGATATGGTAGG - Intergenic
1189577056 X:42365225-42365247 TGTCAAGGGAGGGAGCTGGTGGG - Intergenic
1189885864 X:45543765-45543787 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1190137380 X:47809092-47809114 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1190466291 X:50727484-50727506 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1190946434 X:55098770-55098792 TGACAACGACAGGATCCTGTTGG - Intronic
1191829282 X:65398442-65398464 TGTCAGGGAAGGGACCTGGTGGG + Intronic
1191923105 X:66278566-66278588 TGTTGAGGGCAGGACCTGGTGGG - Intergenic
1191923339 X:66280434-66280456 TGTTGAAGGCAGGATCTGGTGGG - Intergenic
1192132882 X:68569326-68569348 TGTCAAGGAAGGGACCTGGTGGG - Intergenic
1192500652 X:71649130-71649152 TGTCAAGGACAAAGCCTGGTGGG + Intergenic
1193050774 X:77096945-77096967 TATCAAGGAAAGAACCTGGTGGG + Intergenic
1193280567 X:79643646-79643668 TGTTGAGGAAAGAATCTGGTGGG + Intergenic
1193434834 X:81460074-81460096 TGTAGAGGAAGGGATCTGGTGGG + Intergenic
1193631218 X:83890475-83890497 TGTCATGGGAAGGACCTGGTGGG - Intergenic
1193843422 X:86438197-86438219 TGCAAAGGACATGATCTCGTAGG + Intronic
1194019836 X:88673966-88673988 TGTCAAGGGTGGGACCTGGTGGG + Intergenic
1194107658 X:89792131-89792153 TGTCAAGGAGGGGACCTGGTAGG - Intergenic
1194397417 X:93403299-93403321 TGTCATGGGAAGGACCTGGTAGG - Intergenic
1194579602 X:95655499-95655521 TGTCAAGAGCTGGACCTGGTGGG - Intergenic
1194841608 X:98751386-98751408 TGTCAGGGGAAGGACCTGGTGGG - Intergenic
1194875934 X:99187674-99187696 TGTCAAGGGTGGGACCTGGTGGG + Intergenic
1195424982 X:104718435-104718457 TGTCAAGGGAGGGACCTGGTGGG + Intronic
1195986431 X:110635712-110635734 TGTCAAGGGCAGGACCTGGTGGG - Intergenic
1196011445 X:110892217-110892239 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1196246159 X:113402822-113402844 TGTCGAGGGCGGGACCTGGTGGG + Intergenic
1196247903 X:113422367-113422389 TGTCAAGGGCAGGACCTGGCAGG + Intergenic
1196318229 X:114255101-114255123 TGTCAAAGGAGGGATCTGGTGGG + Intergenic
1196371568 X:114985064-114985086 TGTCGAGGAAGGGACCTGGTGGG + Intergenic
1196583673 X:117404938-117404960 TGTCAAGGTAAGGAACTGGTAGG - Intergenic
1197346778 X:125333848-125333870 TGTCAAGGAAGGGTTCTGGTGGG - Intergenic
1199038002 X:143076637-143076659 TTTCAAGGACAGAATCTTGTAGG - Intergenic
1199062459 X:143375604-143375626 TGTCTAGGAAGGGACCTGGTGGG - Intergenic
1199062727 X:143377601-143377623 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1199146677 X:144377210-144377232 TGTCAAGGGAGGGACCTGGTGGG - Intergenic
1199163129 X:144637937-144637959 TGTCATGGGAAGGACCTGGTAGG - Intergenic
1199192181 X:144982672-144982694 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1199206834 X:145159276-145159298 TGTCGAGGGCAGGACCTAGTGGG - Intergenic
1199306042 X:146268745-146268767 TGTCAAGGGAGGGACCTGGTAGG + Intergenic
1199370598 X:147043081-147043103 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1199512533 X:148638472-148638494 TGTCAAGGGAAGGACCTGGTTGG - Intronic
1199929642 X:152505726-152505748 TGTCATGGAAGGGACCTGGTGGG - Intergenic
1200390822 X:155945092-155945114 TGTCAAGGGAGGGACCTGGTGGG + Intergenic
1200459615 Y:3439916-3439938 TGTCAAGGAGGGGACCTGGTAGG - Intergenic
1201190695 Y:11439945-11439967 GGTCAGGGCCAGGATGTGGTCGG + Intergenic
1201733814 Y:17235559-17235581 TGTCATGGGAAGGACCTGGTTGG + Intergenic