ID: 947907876

View in Genome Browser
Species Human (GRCh38)
Location 2:233778849-233778871
Sequence ATCTCACGGTTCCACTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947907876 Original CRISPR ATCTCACGGTTCCACTGGCC AGG Intronic
900360094 1:2284205-2284227 TCCTCCCCGTTCCACTGGCCGGG + Intronic
902599566 1:17531890-17531912 ATCTCACAGTTTCACTGCCCAGG - Intergenic
905421463 1:37848646-37848668 ATCACTCAGGTCCACTGGCCTGG - Intronic
907343871 1:53758296-53758318 ATCTCACAGTTCCACGTGGCTGG + Intergenic
913490133 1:119371596-119371618 GTGTCACGATTCCAGTGGCCTGG - Intronic
914356943 1:146894694-146894716 AACTCACAGTTCCACAGGGCTGG + Intergenic
918017715 1:180652941-180652963 ATCTCAAGGCTTCACTGGTCTGG + Intronic
919536852 1:198797958-198797980 ACCTCACAGTTCCACTGGCTTGG + Intergenic
1063519124 10:6725003-6725025 GACTCACAGTTCCACTGGCTGGG - Intergenic
1064852565 10:19725437-19725459 GACTCACAGTTCCACAGGCCTGG - Intronic
1066611054 10:37248906-37248928 ATCTCACCCCTGCACTGGCCAGG - Intronic
1068370937 10:56113222-56113244 ATCTCACGGTTCTGCATGCCTGG + Intergenic
1071721238 10:88148535-88148557 GTCTCACGGTTCCACGTGGCTGG + Intergenic
1075208896 10:120473868-120473890 AGCTCATGGTTCCACTGTACAGG - Intronic
1080559116 11:33445942-33445964 TTCTCACAGTTCCACAGGCCAGG - Intergenic
1085330484 11:75645486-75645508 ATTTCAGGGTTTCACTGGTCTGG - Intronic
1086006483 11:82044757-82044779 TTCTGACTGCTCCACTGGCCAGG + Intergenic
1088831827 11:113543466-113543488 ATCTCACAGTTCCACTAATCAGG + Intergenic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1092632391 12:10395947-10395969 ATCTCACGCTGTGACTGGCCAGG - Intronic
1093646160 12:21587599-21587621 GTCTCACAGTTCCACAGGGCTGG - Intronic
1102596774 12:113998910-113998932 TTCTCACTGTTCCAGAGGCCGGG - Intergenic
1102660566 12:114523999-114524021 AATTCACAGTTCCACTGGGCTGG + Intergenic
1102982264 12:117251231-117251253 TTCTCACGGTTCTAGTGGCTGGG - Intronic
1107782602 13:43920537-43920559 GTCTCACTGGTCCATTGGCCAGG + Intergenic
1109692022 13:65907045-65907067 AACTCACAGTTCCACATGCCTGG - Intergenic
1112700758 13:102004931-102004953 AACTCACAGTTCCACAGGACTGG - Intronic
1115950267 14:38713217-38713239 ATCTCACAGTTTCAGTGGGCAGG - Intergenic
1116339928 14:43709321-43709343 AACTCACAGTTCCACAGGGCTGG - Intergenic
1116740171 14:48744690-48744712 GTTTCACTGTTTCACTGGCCTGG + Intergenic
1118974739 14:70666972-70666994 ATCTCACAGTTCCAGGGGCTAGG + Intronic
1122440776 14:101730472-101730494 GACTCACAGTTCCACGGGCCTGG - Exonic
1122846873 14:104505035-104505057 ATCTCACATTTCCAGAGGCCAGG - Intronic
1123875233 15:24617472-24617494 TTCTCACGATTCCACTAGGCAGG + Intergenic
1124226717 15:27901414-27901436 ATCTCCTGGCTCCTCTGGCCAGG + Intronic
1129073057 15:72967872-72967894 ATGTCCCTGTTGCACTGGCCTGG - Intergenic
1129767661 15:78180646-78180668 CTGTCCCGGTTCCAGTGGCCGGG - Intronic
1131738523 15:95361059-95361081 ATCTCACAGTTCCACGTGGCTGG + Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1135915814 16:26604514-26604536 AACTCACAGTTCCACATGCCTGG - Intergenic
1141731554 16:85826234-85826256 ATCCCACGCTTCCACTGGCTTGG - Intergenic
1144500254 17:15780046-15780068 GACTCACGGTTCCACTTGGCTGG + Intergenic
1148683648 17:49488563-49488585 GTCTCAGGGGTCCCCTGGCCCGG + Intergenic
1157053476 18:44197850-44197872 AGATCGCAGTTCCACTGGCCAGG - Intergenic
925035976 2:686101-686123 TTCTCACAGTGCCACTGGGCAGG - Intergenic
925221426 2:2144348-2144370 ATCTCACGTTTCCACCTGCTGGG + Intronic
926519948 2:13897887-13897909 TTCTCACAGCTCCACTGGGCAGG - Intergenic
927062006 2:19432021-19432043 AACTCACAGTTCCACATGCCTGG - Intergenic
927504294 2:23603186-23603208 TTCTCACGGTTCCAGGGTCCAGG - Intronic
932314624 2:70771642-70771664 ATCTCATGGTTTCTGTGGCCAGG - Intergenic
933650235 2:84844420-84844442 GACTCACAGTTCCACTTGCCTGG - Intronic
938928699 2:136067126-136067148 ATCTCACTGTTCCAGAGGCTGGG - Intergenic
947907876 2:233778849-233778871 ATCTCACGGTTCCACTGGCCAGG + Intronic
1169804141 20:9541970-9541992 AACTCACAGTTCCACATGCCTGG - Intronic
1170474021 20:16696995-16697017 ATCCCACGGCTCCCCTGGCTTGG + Intergenic
1170768586 20:19312818-19312840 AGCTCAGAGTTCCATTGGCCTGG + Intronic
1173741011 20:45401741-45401763 AACTCACAGTTCCACAGGGCTGG - Intronic
1175861567 20:62153041-62153063 AACTCACAGTTCCACAGGGCTGG + Intronic
1179114589 21:38478410-38478432 AGCCCAGGATTCCACTGGCCTGG + Intronic
1179599545 21:42466938-42466960 ATCGGACGATTACACTGGCCGGG + Intergenic
1180004640 21:45014660-45014682 CTCTCTCGGCTCCCCTGGCCCGG - Intergenic
1181009046 22:20029568-20029590 ATCTCATAGATCCTCTGGCCAGG + Intronic
1182325493 22:29509537-29509559 ATCTGACACCTCCACTGGCCTGG - Intronic
1182520185 22:30880702-30880724 ATCTCACTGCTCCCCAGGCCAGG - Intronic
1182811618 22:33121777-33121799 AACTCACGGTTCCACATGGCTGG + Intergenic
1183408894 22:37643513-37643535 ATCTGAGAGCTCCACTGGCCGGG - Intronic
1184096972 22:42321390-42321412 ACCTCCCGGCTCCTCTGGCCAGG + Intronic
955321431 3:57977236-57977258 ATCACAGGGTACCACTGGCGAGG + Intergenic
956365399 3:68496570-68496592 ATCTAAAGGTTCAACTGGGCTGG - Intronic
957159256 3:76587402-76587424 GACTCACAGTTCCACAGGCCTGG + Intronic
958024338 3:88033117-88033139 GTCTCACAGTTCCACTTGGCTGG + Intergenic
959851960 3:111097756-111097778 AACTCACAGTTCCACAGGGCTGG - Intronic
961887238 3:130104233-130104255 CTCCCACGGTACCACAGGCCTGG - Intronic
964389264 3:156180937-156180959 ATCTCAGACTTCCACTGTCCAGG - Intronic
968632813 4:1661004-1661026 AGCTCACTGTGCCGCTGGCCTGG - Intronic
968940128 4:3633421-3633443 CACTCACCGTCCCACTGGCCAGG + Intergenic
969709281 4:8833425-8833447 ATCTCACGGTTTGATTGACCAGG + Intergenic
969934693 4:10668814-10668836 ATCTCACGCTCCCTCTGCCCTGG + Intronic
969969494 4:11031279-11031301 GACTCACAGTTCCACTGGTCGGG + Intergenic
972890769 4:43553728-43553750 TTCTCACAGTTCCACTAGGCAGG - Intergenic
972890884 4:43554566-43554588 AACTCACAGTTCCACTGGGCTGG - Intergenic
974998708 4:69194733-69194755 ACCTCAAGGTTCCATGGGCCTGG + Intronic
976002990 4:80394133-80394155 GACTCACAGTTCCACTTGCCTGG - Intronic
977276074 4:94978840-94978862 AACTCACGGTTCCACATGGCTGG + Intronic
977841985 4:101718447-101718469 AGCTCATGGTTCTACTGGCTGGG + Intronic
983017946 4:162638688-162638710 GGCTCACAGTTCCACTGGCTGGG - Intergenic
984990180 4:185372756-185372778 TTCTCACAGTTCCAGAGGCCAGG - Intronic
985813403 5:2108186-2108208 AACTCACAGTTCCACTTGGCTGG + Intergenic
986106743 5:4667062-4667084 AACTCACAGTTCCACAGGCTGGG + Intergenic
986891694 5:12316974-12316996 ATCTCAAGGTTACTCTTGCCTGG + Intergenic
988361973 5:30247907-30247929 TTCTCACAGTTCCAAAGGCCAGG - Intergenic
988422796 5:31026723-31026745 AACTCATGGTTCCACAGGGCTGG - Intergenic
991937577 5:71817071-71817093 ATCTCAAGGTTTCACTGTGCTGG - Intergenic
992473575 5:77081102-77081124 ACCTAACAGCTCCACTGGCCAGG + Intronic
995946229 5:117649969-117649991 ATCTGAAGGTTCCACTGAGCAGG + Intergenic
1000433020 5:161173739-161173761 ATCTCACCTTTGCACTGGGCAGG + Intergenic
1000728621 5:164802858-164802880 AACTCACAGTTCCACAGGGCTGG + Intergenic
1002832349 6:834243-834265 AACTCACAGTTCCACAGGGCTGG - Intergenic
1002923941 6:1594196-1594218 ATCACACGGTTCCAATGGCCCGG + Intergenic
1003008667 6:2405780-2405802 AACTCACAGTTCCACATGCCTGG + Intergenic
1003485156 6:6569171-6569193 GTCTCAAGGTTGCACAGGCCAGG + Intergenic
1007160833 6:39790803-39790825 ATATCAAGGCTCCACTGGCAAGG - Intergenic
1012830695 6:104200649-104200671 AACTCACAGTTCCACTTGGCTGG - Intergenic
1013039749 6:106421797-106421819 AACTCACAGTTCCACTTGGCTGG + Intergenic
1013391167 6:109687765-109687787 ATCGCACGGTTTCCATGGCCAGG - Intronic
1014067511 6:117144775-117144797 AACTCACAGTTCCACAGGGCTGG + Intergenic
1016094607 6:140020304-140020326 TTCTCACAGTTCCACTAGGCAGG + Intergenic
1023891457 7:44394852-44394874 AACACAGGGTTTCACTGGCCAGG + Intronic
1024683496 7:51719111-51719133 TTCTCACGGTTCCAAAGGCTGGG + Intergenic
1026224798 7:68430801-68430823 GACTCACGGTTCCACAGGGCTGG - Intergenic
1028191818 7:87862745-87862767 AACTCACAGTTCCACATGCCTGG + Intronic
1030997924 7:116380985-116381007 AACTCACGGTTCCACATGGCTGG + Intronic
1032301238 7:130689277-130689299 TTCTCACAGTTCCAGAGGCCGGG - Intergenic
1032479168 7:132232832-132232854 AACTCCCGGTGCCGCTGGCCAGG + Intronic
1034567729 7:151928990-151929012 ATCTCAGGGATCCTCTGGACAGG + Intergenic
1036183885 8:6607808-6607830 GTCTCACAGTTCCACCTGCCTGG - Intronic
1036848699 8:12186767-12186789 CTCCCACGGTACCACAGGCCTGG - Exonic
1036870060 8:12429048-12429070 CTCCCACGGTACCACAGGCCTGG - Exonic
1039155688 8:34554171-34554193 ACCTCAAGGCTCCACTGGGCAGG - Intergenic
1039326997 8:36496551-36496573 CTCTCCCTGTTCCACTGTCCAGG - Intergenic
1039350663 8:36760289-36760311 AACTCACAGTTCCACAGGGCTGG - Intergenic
1042993368 8:74665972-74665994 ATCTCACAGTTCCACATGGCTGG - Intronic
1043080748 8:75761714-75761736 AACTCACGGTTCCACGTGGCTGG - Intergenic
1043510547 8:80946255-80946277 TTCTCACAGTTCCACTAGCAAGG - Intergenic
1043940296 8:86189223-86189245 AACTCACAGTTCCACAGGGCTGG + Intergenic
1044866746 8:96578658-96578680 ATTTCACAGCTTCACTGGCCTGG - Intronic
1045849314 8:106674048-106674070 TTCTCACAGCTCCACTGGGCAGG - Intronic
1051529008 9:18078984-18079006 ATCTCAAGGTTCCCCAGGCAGGG + Intergenic
1051586141 9:18728888-18728910 ATCTGACGGTTCCACACCCCTGG - Intronic
1053785125 9:41647756-41647778 ATATCACCGTTCCACTGCCAGGG + Intergenic
1054173852 9:61861706-61861728 ATATCACCGTTCCACTGCCAGGG + Intergenic
1054663688 9:67719075-67719097 ATATCACCGTTCCACTGCCAGGG - Intergenic
1058999749 9:110336139-110336161 AACTCACGGTTCCACATGGCTGG - Intronic
1060395246 9:123312185-123312207 ACCTCAAGGTCCCACAGGCCAGG - Intergenic
1060984804 9:127813827-127813849 CTCTCACTGTTGCAGTGGCCTGG + Exonic
1061238514 9:129355903-129355925 ATCTAAAGGCTCCACTGGGCTGG + Intergenic
1062489025 9:136795590-136795612 ATAACAAGGTGCCACTGGCCAGG - Intronic
1186039446 X:5460319-5460341 AACTCACAGTTCCACAGGGCTGG + Intergenic
1186862017 X:13681915-13681937 AACTCACAGTTCCACTTGGCTGG - Intronic
1190934195 X:54980084-54980106 ATCTCAAGGTTCTACTGGGTAGG - Intronic
1194397388 X:93403104-93403126 AACTCACAGTTCCACTTGGCTGG + Intergenic
1197289836 X:124641917-124641939 ATGTCACTGTTCTACTGGCTGGG - Exonic
1201547516 Y:15181697-15181719 AACTCACAGTTCCACAGGGCTGG - Intergenic