ID: 947908012

View in Genome Browser
Species Human (GRCh38)
Location 2:233779831-233779853
Sequence CCGCTGCCTGCAGGTGCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947908007_947908012 14 Left 947908007 2:233779794-233779816 CCACCACTGAGCCTTCTGTAGTG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 947908012 2:233779831-233779853 CCGCTGCCTGCAGGTGCCAGAGG 0: 1
1: 0
2: 1
3: 22
4: 293
947908009_947908012 3 Left 947908009 2:233779805-233779827 CCTTCTGTAGTGATAAACACTCT 0: 1
1: 1
2: 0
3: 13
4: 145
Right 947908012 2:233779831-233779853 CCGCTGCCTGCAGGTGCCAGAGG 0: 1
1: 0
2: 1
3: 22
4: 293
947908008_947908012 11 Left 947908008 2:233779797-233779819 CCACTGAGCCTTCTGTAGTGATA 0: 1
1: 0
2: 2
3: 14
4: 167
Right 947908012 2:233779831-233779853 CCGCTGCCTGCAGGTGCCAGAGG 0: 1
1: 0
2: 1
3: 22
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947908012 Original CRISPR CCGCTGCCTGCAGGTGCCAG AGG Exonic
900109297 1:998841-998863 CCGCGGTCTGCAGGTGGCTGGGG - Intergenic
900211024 1:1455963-1455985 CACCTGCCTGCAGGTGTCTGGGG + Intronic
900216850 1:1486282-1486304 CACCTGCCTGCAGGTGTCTGGGG + Intronic
900223931 1:1524011-1524033 CACCTGCCTGCAGGTGTCTGGGG + Intronic
900405506 1:2491176-2491198 TGGATGCCTGCAGGAGCCAGAGG - Exonic
900476590 1:2879124-2879146 CCCCTGCATGCAGGTCCCCGAGG + Intergenic
900792949 1:4691665-4691687 CCGCTGACTCCAGGAGTCAGGGG + Intronic
901784719 1:11617064-11617086 GCTCAGCTTGCAGGTGCCAGAGG - Intergenic
903069914 1:20721980-20722002 ACTCTGCCGGCAGGTGCTAGGGG + Exonic
903270604 1:22185929-22185951 CTGGTGCCTGCAGGTGCCCTGGG - Intergenic
903378100 1:22879097-22879119 CCCCTGCCTCCAGGGGCCTGAGG - Intronic
903875895 1:26472794-26472816 CGGCTGCCCGCGGGCGCCAGAGG + Intronic
908037851 1:60074962-60074984 CCTCTGGCTGCATGTGCCAGTGG - Intergenic
912711651 1:111954150-111954172 CCACAGTCTGCAGGTGCAAGGGG - Intronic
915354967 1:155250514-155250536 CAGCTGCCCGCAGCTGCCACCGG - Exonic
915427777 1:155841738-155841760 CCACTGCATCCAGCTGCCAGAGG - Intronic
916894029 1:169142872-169142894 CTGCTGCCTCCAGGTCTCAGAGG + Intronic
917499791 1:175575866-175575888 CTGGAGCCTGCAGATGCCAGTGG + Intronic
919742813 1:200990876-200990898 CCTCTGCCTGCACAGGCCAGGGG + Intronic
920084949 1:203408629-203408651 CCCCTGCCAGCAGCAGCCAGAGG - Intergenic
920255038 1:204648931-204648953 CCTCTCCCTCCATGTGCCAGTGG - Intronic
921056043 1:211543143-211543165 TCACTGCCCACAGGTGCCAGAGG - Intergenic
922133164 1:222799087-222799109 CCTCTGCCTGCAGGTGCTGATGG - Intergenic
922911124 1:229218018-229218040 CCACTGCCTGGAGGAGGCAGTGG + Intergenic
923029465 1:230236001-230236023 TCTCTTCCTGCAGGTGTCAGCGG + Exonic
924825114 1:247531000-247531022 CCGCTGCCACCAGGTCCCCGAGG + Exonic
1062798135 10:359411-359433 CTGCTGCCTGCCGGTGCCTTGGG + Intronic
1062888366 10:1036714-1036736 CAGCTGCCTGCAGGGGCCCACGG + Intergenic
1065605497 10:27413918-27413940 CCGGTGCCTGCAGATGGCCGTGG + Exonic
1066657747 10:37711486-37711508 GCAGTGCCTGCAGGTGCCAGAGG + Intergenic
1066697452 10:38091715-38091737 CAGCTGCCTTCAGGTTCCGGAGG + Intergenic
1066995084 10:42555754-42555776 CAGCTGCCTTCAGGTTCCAGAGG - Intergenic
1067836059 10:49642508-49642530 CCCCTGCCTGGAGGTGACAAGGG + Intronic
1067849763 10:49747094-49747116 CCACTGCCTCCAGGTGGGAGGGG + Exonic
1070385107 10:75917253-75917275 CCTCTGTCTCCAGGTGACAGAGG + Intronic
1070782704 10:79146793-79146815 CTGCTTCCTGGATGTGCCAGGGG - Intronic
1072797521 10:98367278-98367300 GTGCTGCCTGCAGGTATCAGGGG + Intergenic
1073138877 10:101234828-101234850 CAGCTGCCTGCAGATGCGTGCGG + Intergenic
1073284673 10:102380490-102380512 CCTCTGACTGCAGGTGGCAGTGG - Exonic
1073544712 10:104338331-104338353 CCGCTGCTTGCAGGCGGCTGCGG + Intronic
1076280415 10:129242021-129242043 CCGATCCCTGCAGGACCCAGTGG - Intergenic
1076285298 10:129289893-129289915 CCCCTCCCTTCAGGTGTCAGTGG - Intergenic
1076347026 10:129786092-129786114 CAGGTGGCTGCAGGTGCCACCGG - Intergenic
1076906903 10:133366984-133367006 CCCCTCCCTGCAGGTGCGGGCGG - Exonic
1078068854 11:8095485-8095507 CCGTGGCCTGCAGGCACCAGCGG + Exonic
1080386724 11:31814840-31814862 CCACAGCCTGAAGGTGCCACGGG - Intronic
1083436577 11:62647358-62647380 AGGATGCCTCCAGGTGCCAGGGG + Exonic
1083554381 11:63614236-63614258 CAGGAGGCTGCAGGTGCCAGCGG + Exonic
1083655460 11:64227066-64227088 CCGCTCCCGGCAGGTGGCTGAGG + Exonic
1083672107 11:64305519-64305541 CCGCTTCCTCCAGCTGACAGCGG - Intergenic
1084147872 11:67274665-67274687 CTCCTGTCTGCAGGTGCCAAGGG + Intronic
1084482257 11:69428753-69428775 CAGCTGCATGGAGGAGCCAGAGG + Intergenic
1084564381 11:69920925-69920947 CCGCGGCCTGCAGCAGCCACAGG + Intergenic
1089188219 11:116635482-116635504 CTGCCTCCAGCAGGTGCCAGAGG - Intergenic
1089639671 11:119839418-119839440 CTGCTGCCTGGAGGAGGCAGGGG - Intergenic
1091171917 11:133527049-133527071 CATCTGCCTGCAGCTGCCTGGGG - Intronic
1091219219 11:133920457-133920479 CACCTCCCTGCAGGTGCCCGCGG - Exonic
1091279743 11:134375068-134375090 CCCCCTCCTGCTGGTGCCAGTGG + Exonic
1091408074 12:221267-221289 CCGTTGTGTGGAGGTGCCAGTGG - Intronic
1096774698 12:53956796-53956818 CAGCTGCCTGCGGTTGGCAGGGG + Exonic
1098143201 12:67471839-67471861 TGGCAGCCTGCAGGTGCCCGAGG + Intergenic
1101434348 12:104652356-104652378 CTGCTGCCTGCAGGAGCCCACGG - Intronic
1101712790 12:107283989-107284011 CCGATGCCCCCAGGTGACAGTGG + Intergenic
1103270441 12:119668879-119668901 CAGCTGACGGCAGTTGCCAGAGG + Intronic
1103897043 12:124279761-124279783 CAGCTCCCCGCAGGTGCCATGGG - Intronic
1104450516 12:128864834-128864856 CAGAGGCCTGCATGTGCCAGAGG + Intronic
1105345174 13:19564934-19564956 CTTCTGCCTGCAGGTGTCTGCGG - Intergenic
1108481567 13:50877733-50877755 CAGCAGCCTGCAGTAGCCAGAGG - Intergenic
1111907339 13:94270890-94270912 CTGCTGGCTGCAGTTCCCAGGGG + Intronic
1113082908 13:106535837-106535859 CCGCCGCCCGCGGGAGCCAGGGG - Intergenic
1113667850 13:112153399-112153421 AGACTGCCTGCAGGTGCGAGGGG + Intergenic
1118621732 14:67620130-67620152 CCGCTGTCTCCAGGTTCTAGGGG - Intronic
1121584704 14:95055189-95055211 TCCCTCTCTGCAGGTGCCAGGGG - Intergenic
1122062870 14:99148392-99148414 CCGCTCTCTCCAGGTCCCAGTGG + Intergenic
1122077947 14:99247631-99247653 CTGATGACTGCAGGTGCCAAAGG - Intronic
1122125380 14:99575887-99575909 CAGCTGCCTACAGGGGGCAGAGG + Intronic
1122147156 14:99698266-99698288 CCTCTGCCTGAATGTACCAGGGG + Intronic
1122195622 14:100082892-100082914 CCGCTGACTGAATGTGGCAGGGG - Intronic
1122771174 14:104098622-104098644 CCGGAGCCTGCAGGGGCCTGGGG - Intronic
1122792783 14:104191390-104191412 CCCCTGAATGCAGGTGCAAGGGG - Intergenic
1122811423 14:104291277-104291299 ACCCTGCCTTCAAGTGCCAGAGG + Intergenic
1123002619 14:105304045-105304067 GAGGTGCCTGCAGGTGCAAGGGG + Exonic
1123174229 14:106401681-106401703 CCGCTGCCTTCAGGTTTCCGAGG + Intergenic
1123182441 14:106482616-106482638 CCGCTGCCTTCAGGTTTCCGAGG + Intergenic
1202944461 14_KI270726v1_random:14113-14135 CCGCTGCCTTCAGGTTTCCGAGG - Intergenic
1123439888 15:20282539-20282561 CCCCTGCCTGCATCTCCCAGTGG - Intergenic
1125477098 15:40054844-40054866 CCACAGCCTGCAGGTGCAAGGGG - Intergenic
1126009491 15:44288974-44288996 CTTCTGCCTGCAGGTGTCTGCGG + Exonic
1126786378 15:52180340-52180362 TCTCTGCCTGCAGGAGCCACGGG - Intronic
1128882623 15:71257451-71257473 CAGCTGCCTTCAGGGCCCAGTGG + Intronic
1129873959 15:78960227-78960249 CAGCTGGCTGCAGGTCCCAGGGG + Exonic
1130830273 15:87591947-87591969 CAGCTTCCTGCAGGTGACTGGGG - Intergenic
1132026293 15:98406919-98406941 CAGGTACCTGAAGGTGCCAGAGG + Intergenic
1132556317 16:574275-574297 CCACTGCCGGCAGGAGCCCGAGG + Exonic
1132645476 16:997459-997481 CCGGTGCCTGCAGGGGCCCTGGG + Intergenic
1132672429 16:1107320-1107342 CCTCTGCCTCCAGGTGCCCTGGG + Intergenic
1132860640 16:2070031-2070053 CCGAGGCCAGCAGGAGCCAGGGG - Intronic
1132928542 16:2446245-2446267 CTGCTGCCCTCAGGAGCCAGGGG - Intronic
1133281759 16:4670744-4670766 CAGGTCCCTGCAGGTACCAGGGG + Intronic
1135304336 16:21355516-21355538 CCCCTGGCAGCAGGTGCCACAGG - Intergenic
1136290208 16:29267217-29267239 CCCGTGGCTGCAGGTGACAGTGG - Intergenic
1136301080 16:29334646-29334668 CCCCTGGCAGCAGGTGCCACAGG - Intergenic
1137576882 16:49605762-49605784 CCGCTGCCTGCCAGTGACAACGG - Intronic
1137576911 16:49606047-49606069 GCGCTGGCTGCAGGTGCACGCGG - Intronic
1139256586 16:65548626-65548648 CTGCTGCCTGCAGGGGGCTGGGG + Intergenic
1139370993 16:66469403-66469425 CCGCTGCCTGCAGGAGCCTCTGG - Intronic
1139751765 16:69113277-69113299 GCGCTACCAGAAGGTGCCAGAGG - Intronic
1140192826 16:72832767-72832789 CAGCTGGCTGCAGGAGGCAGAGG + Intronic
1140410865 16:74739635-74739657 CACATGGCTGCAGGTGCCAGGGG + Intronic
1141521075 16:84580049-84580071 CAGCTGCTGGCAGGTGCCTGGGG + Intronic
1141628571 16:85274772-85274794 CTGCTGGGGGCAGGTGCCAGTGG - Intergenic
1141682607 16:85553307-85553329 CCGCTGCCGGCGGGTGCAAGGGG + Intergenic
1142062782 16:88041383-88041405 CCCCTGGCAGCAGGTGCCACAGG - Intronic
1142096092 16:88240738-88240760 CCCGTGGCTGCAGGTGACAGTGG - Intergenic
1142158682 16:88546007-88546029 CAGCAGCCTTCAGGAGCCAGTGG - Intergenic
1142206547 16:88785532-88785554 GCGCTGCCTGGGGGAGCCAGAGG - Intergenic
1142670678 17:1486105-1486127 CCGAGGCCTGCGGGTCCCAGAGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1142961638 17:3555525-3555547 CTGCTCCCTGCAGGTGAGAGGGG - Intronic
1146520474 17:33521939-33521961 ACACTGCCCGCAGTTGCCAGAGG - Intronic
1146656422 17:34637632-34637654 CGGCTTCCTGCAGGTGCCACGGG + Exonic
1151459333 17:74245451-74245473 CCGCTGCCTCCAGAAGGCAGAGG - Intronic
1152355150 17:79803279-79803301 CCCCTGCCTGGAGATGCCCGGGG + Intergenic
1152569814 17:81116656-81116678 CCAGTGCCTGCAGGAGTCAGCGG - Exonic
1152639132 17:81442441-81442463 CCCCTGCCTGCAGCTGCACGGGG + Exonic
1152762176 17:82114559-82114581 CCTCTGCATTCAGGAGCCAGTGG - Intronic
1152779335 17:82219438-82219460 CCACGGCCTGCAAGTGCCTGGGG - Intergenic
1155216505 18:23647999-23648021 CTGAGGCCTGAAGGTGCCAGGGG + Intronic
1157559649 18:48637387-48637409 TCCCTGCCTGCAGGAGCCTGTGG + Intronic
1157773749 18:50374294-50374316 TAGATGGCTGCAGGTGCCAGAGG - Intergenic
1158548789 18:58417515-58417537 CCGCTGGCTGCCTGTGCTAGAGG - Intergenic
1158653558 18:59308624-59308646 CCGCCTCCCGCGGGTGCCAGTGG + Intronic
1159787445 18:72730931-72730953 CCACAGCCTGGAGGTGCCAGAGG - Intergenic
1160544567 18:79644148-79644170 CGGAGGCCTGCAGGTGCCACGGG + Intergenic
1160895857 19:1401524-1401546 CCGCTCCCTGCAGGGGCTTGTGG + Exonic
1160945972 19:1644269-1644291 CCACAGCCTGCAGGGGCCTGGGG + Intronic
1161059409 19:2207558-2207580 CCGATGTCTGCAGGAGCCACAGG - Exonic
1161087298 19:2341029-2341051 CCGCTGCCCGCCGGGGCCCGGGG - Exonic
1161264694 19:3358894-3358916 CCGGTGACTGCAGGTGTCCGGGG - Intergenic
1161281024 19:3445821-3445843 CAGATGCCTGCAGGTGCCTATGG + Intronic
1161395455 19:4042900-4042922 CAGCTGCCTGCCCGCGCCAGGGG + Intergenic
1161673017 19:5624578-5624600 CCACTGCCTGCAGGGGCTGGGGG - Intronic
1161742874 19:6034745-6034767 CCACTGCGTGGAGGTGCCATGGG + Intronic
1161983271 19:7641530-7641552 CCCATGCCTGCAGGAGTCAGTGG - Intronic
1162058648 19:8081189-8081211 CCTCTGCCTGGAGGTGGCAAGGG - Intronic
1163387969 19:17011748-17011770 CCTCTGCCTGCAGGTGCCCACGG - Exonic
1164402837 19:27913473-27913495 CTGGAGCCTGCAGGTGGCAGAGG + Intergenic
1165361904 19:35341891-35341913 CGGGTGCCTACTGGTGCCAGGGG + Exonic
1165814758 19:38634977-38634999 TGGCTGTCTGCAGGTGACAGGGG - Exonic
1166895910 19:46021889-46021911 CAGAGGCCTGCAGGTGGCAGGGG - Intronic
1167636439 19:50658666-50658688 GCGCAGCCTGCAGTCGCCAGTGG + Intronic
1168097438 19:54123733-54123755 CTGCTGCCTGCAGGGGCGGGTGG - Exonic
1168404889 19:56105566-56105588 CTGCCTCCTGCAGGTGCCGGGGG - Intronic
926945163 2:18179806-18179828 CTTTTGCCTGCAGGTGCTAGGGG - Intronic
927122842 2:19985090-19985112 TCACTGCCTGCAGGTACCGGAGG + Intronic
927869364 2:26613922-26613944 CACCTGCCTGCCGGTGTCAGCGG - Intronic
928316208 2:30248595-30248617 CAGATGCCTGGAGGTGACAGGGG + Intronic
931942866 2:67272301-67272323 GCACTGCCTGCATGTTCCAGAGG - Intergenic
932189225 2:69725050-69725072 CGGCTGACTGCAGGAGTCAGAGG - Intronic
933278205 2:80304573-80304595 CCGCTCTCTGCAGCTGCCCGGGG - Exonic
933843410 2:86305715-86305737 CTGCTGGCTGCAGGTGCCAAGGG - Intronic
934488379 2:94738494-94738516 CCACAGCCTGGAAGTGCCAGCGG - Intergenic
934758529 2:96840647-96840669 CCTCCGTCTGCAGGTGCCACTGG + Intronic
936014136 2:108944863-108944885 CCGCCACCTGCAGGTCCCAGAGG + Intronic
937853500 2:126656357-126656379 CCGCGGCCCGCAGCAGCCAGGGG + Intronic
939958806 2:148548270-148548292 CCCCAGCCTGCAGATGCCAGTGG - Intergenic
942302002 2:174571825-174571847 CCTCTGCCTCCAAGTTCCAGCGG - Exonic
946428594 2:219613115-219613137 CCTCTTCCCCCAGGTGCCAGTGG + Exonic
947581664 2:231323443-231323465 CCTCTGCCTGCAGGTGTTACTGG + Intronic
947908012 2:233779831-233779853 CCGCTGCCTGCAGGTGCCAGAGG + Exonic
948529486 2:238595295-238595317 CAGCTGCCTGCAGTTGCCCAGGG - Intergenic
948844719 2:240677540-240677562 GTGCTGCCAGCAGGTGCCGGTGG + Intronic
948849141 2:240697339-240697361 GTGCTGCCAGCAGGTGCCGGTGG - Intronic
1168894413 20:1313492-1313514 CCGCTGTCTGCAGACACCAGGGG + Exonic
1168908094 20:1422979-1423001 CCGATGCCTGCATGTGCTATGGG + Intergenic
1169192831 20:3668843-3668865 AAGCTGCCTGCAGGTGCTGGAGG + Exonic
1171045951 20:21809513-21809535 CCGCAGCCAGCAGATGACAGAGG - Intergenic
1171255504 20:23686550-23686572 TGGCTGCATGCAGGTGCCTGAGG + Intronic
1171262848 20:23748475-23748497 TGGCTGCATGCAGGTGCCTGAGG + Intronic
1173687235 20:44932230-44932252 CCAGTCCCTGCAGGAGCCAGTGG + Intronic
1174046958 20:47740526-47740548 CCCCTGCCTGGAGCTCCCAGTGG - Intronic
1174352621 20:49979394-49979416 CCGCCGCCTGCAGGAGGGAGTGG + Intergenic
1174400239 20:50272078-50272100 CCAACACCTGCAGGTGCCAGGGG + Intergenic
1175418606 20:58817395-58817417 CCGCATCCTGCAGGTGCTCGTGG + Intergenic
1175789129 20:61730860-61730882 CCGCTGCCTGCATGGCCCAGTGG - Intronic
1175851336 20:62095167-62095189 GCTCTGCCAGCAGGTGTCAGTGG + Intergenic
1175875462 20:62227431-62227453 CCGATCCCTGCTGGTGCCTGGGG + Intergenic
1176019898 20:62957233-62957255 CCTCTGCCTGCAGGGCCCTGGGG - Intronic
1178734743 21:35138724-35138746 CTTCTGCCACCAGGTGCCAGGGG + Intronic
1179613848 21:42569252-42569274 CAGCTCCCTGCACGAGCCAGTGG - Intronic
1180221103 21:46358525-46358547 CTGGTGGCTGCAGGTGCCATTGG - Intronic
1180909900 22:19442508-19442530 CAGCTGCCTTCAGGTTCCTGGGG - Exonic
1180956932 22:19745425-19745447 CAGCTCCCAGCAGGTGCTAGTGG - Intergenic
1181547316 22:23609473-23609495 CTGCATCCTGCAGGTGCCTGGGG + Intronic
1181572168 22:23773484-23773506 CTGCTGCCGGCAGGTGCCCGCGG - Intronic
1183358942 22:37373481-37373503 CCGCTGCCCGCCGGCACCAGCGG + Exonic
1183409671 22:37647435-37647457 CCCCAGCCTGAAGGAGCCAGGGG + Exonic
1183931280 22:41237529-41237551 CCGTTTCCTGCAGGTGCCAGGGG - Exonic
1184215086 22:43061363-43061385 CAGCTGCCAACAGGAGCCAGGGG - Intronic
1184332715 22:43836190-43836212 CCTCCGACTGCAGGTGCCACAGG + Intronic
1184923942 22:47624518-47624540 CGGCTGCCTGCACCAGCCAGCGG - Intergenic
1185143682 22:49117709-49117731 CAGCTGCCTGATGGGGCCAGGGG + Intergenic
949562238 3:5213719-5213741 CTGCTGGCTGCAGGTGCTGGTGG + Intronic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
950082652 3:10234613-10234635 CGGCTGCCTGCCTGTGCCTGCGG + Exonic
950628813 3:14267794-14267816 CCCCTGTCAGCAGGTGTCAGGGG - Intergenic
951108942 3:18778243-18778265 CCACATCCTGCAGGTGCCAGTGG - Intergenic
955481444 3:59394410-59394432 CAGCTGCATGCAGGTGCAGGGGG + Intergenic
955484385 3:59420856-59420878 CCATTACCTGCATGTGCCAGTGG + Intergenic
957977130 3:87460920-87460942 CCGCTGCCTTAAGTTGCAAGAGG - Intergenic
960940376 3:122929284-122929306 CCACTGCCTGCTTGTGTCAGAGG + Intronic
961451652 3:127004872-127004894 CCTCTGCCTGCAGCTGCTCGCGG + Exonic
961555292 3:127692900-127692922 CAGCCGCCTGCAGAGGCCAGTGG - Intronic
961605769 3:128094441-128094463 GTGCTGCCTGGAGGTGGCAGTGG - Intronic
962377975 3:134874627-134874649 CTGCTGCCTCCAGGAGCCAAAGG - Intronic
962763758 3:138542581-138542603 GCGCAGCCACCAGGTGCCAGTGG + Intronic
964351373 3:155806360-155806382 CCGCGACCTGCAGTCGCCAGTGG + Intergenic
966973689 3:185067410-185067432 CCCCAGCCGGCAGGTGCCTGAGG - Intergenic
967119642 3:186371417-186371439 CCACTGCCTGCGGTTGTCAGTGG - Intergenic
967329736 3:188278424-188278446 TCTCTGGCTGCAGGTGCCATGGG - Intronic
968506131 4:972260-972282 CTGCTGCCTGGGGATGCCAGGGG - Intronic
968510489 4:993375-993397 CCGCTGCTCGCGGGAGCCAGAGG - Exonic
968616034 4:1578340-1578362 CGTCTGCGTGCAAGTGCCAGGGG + Intergenic
968621600 4:1605723-1605745 GCGGTGCCTGCAGGTGCCTCTGG - Intergenic
969254280 4:5991865-5991887 CTGCTCCCTGGAGCTGCCAGTGG + Intergenic
971149939 4:24021151-24021173 CCTGTGCCTGCAAGGGCCAGAGG - Intergenic
971918842 4:32910242-32910264 CCACCTCCTGCAGGTGCCTGTGG + Intergenic
974257486 4:59478477-59478499 CCCATGCCTGCAGTTGCCATAGG + Intergenic
978819482 4:112949089-112949111 CTGCTGCCTGCTGGTGCAAAAGG - Intronic
984206571 4:176793109-176793131 CCGCTCCCCGCAGGGGACAGGGG - Intergenic
984277451 4:177627350-177627372 CCATTGCCTTCAGTTGCCAGAGG + Intergenic
985672885 5:1215137-1215159 CAGCTGCCTGCAGTGCCCAGGGG - Intronic
985801147 5:2005927-2005949 CTGCCTCCTGCAGGTGTCAGCGG - Intergenic
987586547 5:19863680-19863702 CCCCTGGCAGCAGGTGGCAGTGG + Intronic
992487578 5:77210843-77210865 CCCCTCACTGCAGGTGGCAGCGG + Intronic
992527764 5:77629048-77629070 CGGCTGCCAGCAGGTGGCCGAGG + Exonic
994407177 5:99359603-99359625 CTGCTGTCTGCAGGTGGCAGAGG - Intergenic
999253610 5:150196919-150196941 CCTCTGCCTGGAGCTGGCAGGGG - Intronic
1000253388 5:159516013-159516035 CCGCCGCCTGCAGGTGTCGCTGG + Intergenic
1002511979 5:179726201-179726223 CCTCTGCCTCCAGGTTCAAGTGG - Intronic
1005506941 6:26477688-26477710 CCTCTGGCTGCTGGTGACAGAGG + Intergenic
1006743996 6:36329003-36329025 CCCCTCCCTCTAGGTGCCAGTGG + Intronic
1007343697 6:41210186-41210208 CTCCTGTCTGCTGGTGCCAGCGG + Intergenic
1010986787 6:82434142-82434164 CAGTTGCCTGCAGGTACCTGTGG - Intergenic
1013374629 6:109502497-109502519 CCTCTGCCTGAAGGTTCTAGGGG - Intronic
1018376328 6:163217184-163217206 CCGCTCCCTGCAGAAGCTAGGGG + Intronic
1019049193 6:169170227-169170249 GACCTGCCTGGAGGTGCCAGGGG - Intergenic
1019307547 7:343096-343118 CCACCGCCTGCAGGTGCCACGGG - Intergenic
1019454955 7:1122188-1122210 TAGCAGCCTGGAGGTGCCAGGGG - Intronic
1019484760 7:1284437-1284459 CTGCAGGCTGCAGCTGCCAGGGG - Intergenic
1019501497 7:1367045-1367067 CAGCTGCCTGCGGGTGCCCTCGG + Intergenic
1019660500 7:2221246-2221268 CCGCTGCCTGCGGGCACCTGTGG - Intronic
1019707555 7:2503773-2503795 CTCCTGCCTGCAGGGGCCCGAGG + Intergenic
1019995443 7:4721399-4721421 CTGTTTCCTGCAGGTGACAGTGG + Intronic
1020080519 7:5283616-5283638 CCGATGCATGCAGGGGCCACAGG - Intronic
1021089220 7:16462668-16462690 TCACTGCCTGCAAGTGCAAGAGG - Exonic
1023232744 7:38051381-38051403 CCCAGGCCTGCAGGTGGCAGGGG + Intergenic
1023749502 7:43358171-43358193 ACTCTGCCTGTAGGTGCCGGTGG - Intronic
1024723841 7:52169706-52169728 CAGGAGCCTGCAGGAGCCAGTGG - Intergenic
1025198400 7:56948564-56948586 CCGATGCATGCAGGGGCCACAGG + Intergenic
1025673550 7:63628369-63628391 CCGATGCATGCAGGGGCCACAGG - Intergenic
1026737810 7:72960152-72960174 CCGCTGCCTGGAGGGGATAGGGG - Exonic
1026788845 7:73318953-73318975 CCGCTGCCTGGAGGGGATAGGGG - Exonic
1026899059 7:74027354-74027376 TGGATGCCTGCAGATGCCAGGGG - Intergenic
1027105924 7:75404916-75404938 CCGCTGCCTGGAGGGGATAGGGG + Exonic
1027247164 7:76375041-76375063 CTGCTGCCTACATGTGCCAGTGG - Intergenic
1027641416 7:80737919-80737941 CATCTGCCTGCCAGTGCCAGGGG + Intergenic
1028077640 7:86535032-86535054 CTACTGCCTTCAGGTTCCAGAGG - Intergenic
1029669829 7:102021963-102021985 CCTCTGTCTGCAGGAGCGAGAGG - Intronic
1032095830 7:128938165-128938187 CCGCCGCCCGCAGGTGCCTGGGG - Intronic
1032128689 7:129212224-129212246 CTGGTGGCTGCAGGTGCCTGGGG + Exonic
1034003573 7:147443382-147443404 CCACTGCCTGCAGGTGGTGGAGG + Intronic
1035353646 7:158264547-158264569 CCGGTGGCAGCAGGTGACAGTGG + Intronic
1035436708 7:158864939-158864961 CAGGTGGCTGCAGATGCCAGTGG + Intronic
1041853249 8:62418102-62418124 CAGCTGCCAGCAAGTGCAAGTGG + Intronic
1042220409 8:66467609-66467631 CAGTTTCATGCAGGTGCCAGGGG + Intronic
1043229935 8:77788669-77788691 CCACTGCCTACAGGTGCCTTTGG - Intergenic
1043876605 8:85492977-85492999 CAGGAGCCTGCAGGTGCAAGTGG + Intergenic
1046812016 8:118543526-118543548 CCGCGGCCTGCATGTGGCCGAGG + Intronic
1048197476 8:132344030-132344052 CCTCTGCATGCAGGTGCCTTTGG + Intronic
1049255005 8:141609121-141609143 CCGCCGCCTGCAGGGATCAGTGG + Intergenic
1049312964 8:141943112-141943134 CCTGTGCCTGCAGGTGCCGCTGG + Intergenic
1049407885 8:142459882-142459904 CCTCTGCCTGCTGGGGGCAGGGG - Intronic
1049743936 8:144255078-144255100 GTGCTGCCTCCAGGTGCCTGTGG - Intronic
1050090952 9:2016279-2016301 GCGCTGCCGCCAGGTACCAGAGG - Intronic
1051483135 9:17579797-17579819 CCGCCGCCCGCAGGCTCCAGGGG + Intronic
1052758625 9:32567144-32567166 CCACTGCCTGCGGGGCCCAGAGG - Exonic
1052972731 9:34386885-34386907 CAGCTGCCTGCAGATACCTGTGG - Intronic
1053450667 9:38191835-38191857 CCGCAGCCAGCAGCAGCCAGAGG - Intergenic
1053669411 9:40345871-40345893 CCACAGCCTGGAAGTGCCAGCGG + Intergenic
1053802091 9:41771051-41771073 CAGCTGCCAACAGGAGCCAGTGG - Intergenic
1053919207 9:42972112-42972134 CCACAGCCTGGAAGTGCCAGCGG + Intergenic
1053920536 9:42985307-42985329 CCACAGCCTGGAAGTGCCAGCGG - Intergenic
1054143179 9:61544238-61544260 CAGCTGCCAACAGGAGCCAGTGG + Intergenic
1054380541 9:64485891-64485913 CCACAGCCTGGAAGTGCCAGCGG + Intergenic
1054515205 9:66030420-66030442 CCACAGCCTGGAAGTGCCAGCGG - Intergenic
1054647996 9:67605380-67605402 CAGCTGCCAACAGGAGCCAGTGG + Intergenic
1057055572 9:91958040-91958062 CAGCTCACTGCAGGTTCCAGTGG - Intergenic
1057851647 9:98571043-98571065 CCCCGGCCTGCAGCTGCCTGAGG - Intronic
1060157382 9:121329132-121329154 CAGCTGGCTGCAGCTGGCAGGGG - Intronic
1061432444 9:130539838-130539860 CACCTTCCTCCAGGTGCCAGTGG + Intergenic
1061729634 9:132603823-132603845 CCGCTGTCTGCAGGTGACCCAGG + Intronic
1061907852 9:133707993-133708015 CTGCTGCCAGCAGTTGGCAGGGG + Intronic
1061953627 9:133950149-133950171 GCCCTGCCTGCCTGTGCCAGGGG - Intronic
1062110666 9:134780447-134780469 CACGTGCCTGCAGGGGCCAGTGG + Intronic
1062155389 9:135045485-135045507 CTGCAGCCTGCCTGTGCCAGCGG - Intergenic
1062360504 9:136185834-136185856 CCGCTGCCCGAGGGTGCCACAGG + Intergenic
1062570497 9:137182892-137182914 CCTCTGTGTGCAGCTGCCAGAGG - Intronic
1186594410 X:10965203-10965225 CCACTGTCGGCAGGGGCCAGGGG + Intergenic
1189198953 X:39175455-39175477 CAGCTGCTTTTAGGTGCCAGAGG + Intergenic
1190031577 X:46978285-46978307 CCGCAGCCTGCATGTGGCACAGG - Intronic
1192582748 X:72298576-72298598 ACCCTGCCTCCTGGTGCCAGTGG - Intronic
1192769300 X:74170215-74170237 GCTCTGGCTGCAGCTGCCAGTGG - Intergenic
1193739741 X:85203230-85203252 CCGCTTCCTGAAGGTGCCTTTGG - Intergenic
1196793249 X:119482827-119482849 CCTCTGCAGGCAGGTGCGAGAGG - Intergenic
1196917374 X:120551280-120551302 CCTCTGCCTCCAGGTTCCAGTGG + Intronic
1199661304 X:150053485-150053507 GCCCTGCCTGCAGGTAGCAGTGG - Intergenic