ID: 947908982

View in Genome Browser
Species Human (GRCh38)
Location 2:233789532-233789554
Sequence CCTGCTGGATGATGTCCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947908982_947908991 -8 Left 947908982 2:233789532-233789554 CCTCCAGGACATCATCCAGCAGG 0: 1
1: 0
2: 0
3: 28
4: 343
Right 947908991 2:233789547-233789569 CCAGCAGGAGGGGGAGCTGGAGG 0: 1
1: 0
2: 17
3: 138
4: 1097
947908982_947908992 9 Left 947908982 2:233789532-233789554 CCTCCAGGACATCATCCAGCAGG 0: 1
1: 0
2: 0
3: 28
4: 343
Right 947908992 2:233789564-233789586 TGGAGGAGCAGTGCGTGCAGAGG 0: 1
1: 0
2: 6
3: 29
4: 321
947908982_947908993 13 Left 947908982 2:233789532-233789554 CCTCCAGGACATCATCCAGCAGG 0: 1
1: 0
2: 0
3: 28
4: 343
Right 947908993 2:233789568-233789590 GGAGCAGTGCGTGCAGAGGCTGG 0: 1
1: 0
2: 5
3: 44
4: 398
947908982_947908994 16 Left 947908982 2:233789532-233789554 CCTCCAGGACATCATCCAGCAGG 0: 1
1: 0
2: 0
3: 28
4: 343
Right 947908994 2:233789571-233789593 GCAGTGCGTGCAGAGGCTGGTGG 0: 1
1: 0
2: 4
3: 38
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947908982 Original CRISPR CCTGCTGGATGATGTCCTGG AGG (reversed) Exonic
900181754 1:1314178-1314200 CCTGCTTGCTGCTGTCCTGGGGG - Intronic
900441466 1:2657660-2657682 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900441708 1:2658905-2658927 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900441938 1:2660068-2660090 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900442601 1:2663521-2663543 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900442831 1:2664684-2664706 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900443494 1:2668137-2668159 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900443724 1:2669300-2669322 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900444252 1:2672070-2672092 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900444495 1:2673315-2673337 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900444726 1:2674478-2674500 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900445157 1:2676726-2676748 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900445866 1:2680460-2680482 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900446105 1:2681704-2681726 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900458848 1:2790507-2790529 CCTGCCAGCTGGTGTCCTGGCGG - Intronic
901179620 1:7332280-7332302 CCTCCTGGATGACATTCTGGAGG - Intronic
902243101 1:15101714-15101736 CCAGCAGGATGCTGACCTGGTGG - Exonic
902437753 1:16409282-16409304 CCTGCAGGAGGAGGTCGTGGGGG + Intronic
902960967 1:19962615-19962637 CCTGATGGAGGAGGCCCTGGAGG - Intergenic
902970420 1:20044160-20044182 CCTGATGGAGGAGGTCCTGTAGG + Intronic
903396028 1:23002416-23002438 CCTGGGGGAGGAGGTCCTGGAGG + Intergenic
903472308 1:23595692-23595714 CCAGGGGGATGATGGCCTGGAGG - Intronic
903778795 1:25809019-25809041 GCCGGTGGATGATGACCTGGGGG - Exonic
903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG + Intergenic
904379738 1:30102474-30102496 CCTGCAGGAATCTGTCCTGGAGG + Intergenic
904393957 1:30205634-30205656 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
904769461 1:32872666-32872688 CCTGCTGGTTCCTGTGCTGGAGG - Intergenic
905033167 1:34900987-34901009 GCTGCTGGCTGAGGACCTGGGGG + Intronic
905311510 1:37052152-37052174 CCTGCTGGTTGATGTCCTCTGGG - Intergenic
905693669 1:39960206-39960228 CCTGAAGCAGGATGTCCTGGAGG - Intronic
906081469 1:43091921-43091943 CCAGATGGATGATGTCCCTGAGG + Intergenic
906575219 1:46883176-46883198 CCAACTGGATGCTGCCCTGGTGG + Intergenic
906596756 1:47084718-47084740 CCAACTGGATGCTGCCCTGGTGG - Exonic
907293601 1:53434488-53434510 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
909776693 1:79492031-79492053 CCTGGGGGAGGATGTTCTGGAGG + Intergenic
910446347 1:87302170-87302192 CTTGCTGGATGTTGTCCTGAGGG + Intergenic
910719891 1:90274536-90274558 CCTGCCGGATAATGTCCTTTTGG + Intergenic
911966926 1:104382429-104382451 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
911983848 1:104598242-104598264 CCTGATGGAGGAGGTCCTGTAGG - Intergenic
912496951 1:110097987-110098009 CAAGCTGGATGAAGACCTGGAGG - Intergenic
913482687 1:119303970-119303992 CCTGCTGGAGGCTGTCATAGGGG - Intergenic
913529607 1:119724377-119724399 CCTGCTGGAGGAGGATCTGGGGG + Intronic
914397650 1:147286288-147286310 CCTGCTAAAGGATGGCCTGGTGG + Exonic
915110304 1:153560362-153560384 CTTGCTGCATCATCTCCTGGTGG + Intergenic
915952847 1:160201310-160201332 CTGGCTGGAGGATGTCCTGGAGG + Exonic
916941792 1:169685109-169685131 CCTGATGGAGGAGGTCCTGTAGG - Intronic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
917554232 1:176067487-176067509 CCTGCTGGTTGATGGCCTGCCGG - Intronic
917743191 1:177981759-177981781 CCTGCAGGACAATGTACTGGAGG + Intronic
918105757 1:181413723-181413745 CCCTCTGGATGAGGTCCTCGTGG + Intronic
919845619 1:201640341-201640363 CTTCCTGGATGAGGTCCTGGAGG + Intronic
920225181 1:204433411-204433433 CCTTCTAGATGTTGTCCTGTGGG - Exonic
920533862 1:206724427-206724449 CAGGCTGGCTGACGTCCTGGGGG - Intronic
922801424 1:228366393-228366415 CCAGCTGGACGCTGTCCTGGAGG - Exonic
923110354 1:230885174-230885196 CCTGCTGGCTTCTGTCCTGTTGG - Intergenic
923201226 1:231713659-231713681 TCTGCTTCATGATGTCCTAGAGG - Intronic
923761076 1:236844727-236844749 CATGCTGGTTGATGTGCTGGCGG + Intronic
1064985672 10:21207641-21207663 CCTGCTCCATGATCTCCTGCAGG - Intergenic
1067474970 10:46558828-46558850 CCTCCTGGGTCAGGTCCTGGAGG + Intergenic
1067775844 10:49164362-49164384 CCTGCTGGAGTAAGTCCAGGTGG - Intronic
1068464748 10:57375478-57375500 CCTGCTGTATCATGAACTGGTGG + Intergenic
1069696236 10:70387503-70387525 CCTTCTGGAAGAGGTACTGGGGG - Intergenic
1069872743 10:71543116-71543138 CCTGCTGAATGGGGCCCTGGAGG - Intronic
1069909991 10:71753068-71753090 CCTGCTGGCAGATGCCCTGCAGG + Intronic
1070319483 10:75343853-75343875 CCTGTTACATGATGCCCTGGTGG + Intergenic
1070843934 10:79506906-79506928 GCAGGTGGATGATGTCCGGGAGG + Intergenic
1070844031 10:79507389-79507411 GCAGGTGGATGATGTCCGGGAGG + Intergenic
1072725764 10:97812640-97812662 CCGGCTGGTTGAAGACCTGGAGG - Intergenic
1073394619 10:103207807-103207829 CCTGTTGGAGGAGGTCCTGTAGG - Intergenic
1073683527 10:105729606-105729628 CCTGATGGAGGAAGTCCTGAAGG - Intergenic
1074062725 10:109982079-109982101 CCTGCTGCCTGATGTACTGAGGG - Intergenic
1074881673 10:117664647-117664669 TCTGCTGTATGAACTCCTGGAGG + Intergenic
1076769013 10:132652977-132652999 CCTGCTGGCCGATGTGCAGGTGG + Intronic
1076895526 10:133309416-133309438 CCTGCATGATCACGTCCTGGAGG - Exonic
1077056953 11:598399-598421 CCTGCTGGATGAAGCCATCGAGG + Exonic
1077252408 11:1566469-1566491 CCTGGTGGATGGTGGCCTTGGGG + Intronic
1077423058 11:2461933-2461955 TCTGCTGTCTGCTGTCCTGGGGG + Intronic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1078874832 11:15382672-15382694 CCTGGTGAATAATGTCCTTGAGG - Intergenic
1080701283 11:34646524-34646546 CCAGCTGGTTGGTGTCCAGGAGG - Exonic
1080994449 11:37582090-37582112 CTTGGGGGATGAGGTCCTGGAGG + Intergenic
1081984236 11:47290029-47290051 CATCCGGGATGATGTCCTGCCGG - Exonic
1084434509 11:69131111-69131133 CCTGCCGGCTCTTGTCCTGGAGG + Intergenic
1084608802 11:70187788-70187810 TCTGCTGGCTGATGTCCTTGGGG - Exonic
1085688322 11:78645807-78645829 CCTGGTGTAAGATGTCCTTGAGG + Intergenic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1086773025 11:90793195-90793217 CCTGATGGATGATGGCTTGGGGG + Intergenic
1087409382 11:97771737-97771759 CCAGGTGGAAGATTTCCTGGTGG + Intergenic
1089365464 11:117918536-117918558 CCTGGCGGATGATGACCTGCCGG + Exonic
1092474487 12:8807179-8807201 CCTGCCGGAGGAGGTTCTGGAGG - Intergenic
1092609841 12:10160447-10160469 CTTGCTGGATGAAGTCCTGTGGG + Exonic
1093024330 12:14232821-14232843 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
1094058540 12:26289759-26289781 CCTGCTGGATTCTGTCCTCTTGG + Intronic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1096599997 12:52722370-52722392 CCTGAAGGATGAGGTCCTAGAGG - Intergenic
1096633993 12:52947166-52947188 CCTGCTGAATGAAGTGTTGGGGG - Intronic
1096911940 12:54992882-54992904 CCTTCTGGAAGAGGTCCTGAAGG + Intergenic
1096931216 12:55211991-55212013 CCTCCTGGATAATATCCTGCAGG - Intergenic
1097417055 12:59326689-59326711 CCTGTTGGAGGAGGTTCTGGAGG + Intergenic
1097592425 12:61589493-61589515 CCTGATGGAGGAAGTCCTGTAGG - Intergenic
1099576523 12:84390588-84390610 CCTGCTGGATGAGGTGAAGGAGG + Intergenic
1103895809 12:124272441-124272463 CAAGGGGGATGATGTCCTGGAGG - Intronic
1104616484 12:130274179-130274201 CCTACTGAAGGATGTCTTGGTGG + Intergenic
1104969990 12:132526864-132526886 CCTGCTGGGGGAGGCCCTGGTGG + Intronic
1105307145 13:19177020-19177042 CCTGCTGCATGTTGTACAGGGGG - Exonic
1105323713 13:19351420-19351442 CCTCCTGGATGATGGCATGCAGG + Intergenic
1105449310 13:20484649-20484671 CCTGCTGTACGATGTGCTCGGGG - Intronic
1105870237 13:24498115-24498137 CCTCCTGGATGATGGCATGGAGG - Exonic
1107357136 13:39579369-39579391 CCTGCTGGGTCATGACCTGCTGG - Intronic
1108463850 13:50694913-50694935 TCTAGTGGATGAGGTCCTGGAGG + Intronic
1109142462 13:58731661-58731683 CCTGTTGGATTCTGTCCTGTAGG - Intergenic
1109735906 13:66483964-66483986 CCTGCCGGTTGATGGCCTGCAGG - Intronic
1110835156 13:80074580-80074602 CCTGCTGGTCGATGGCCTGCTGG - Intergenic
1111262512 13:85760512-85760534 TCTGCTGGTTGATGGCCTGCTGG + Intergenic
1114221675 14:20702825-20702847 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
1116602851 14:46949264-46949286 TCTTCTGGATGATGTACTGTGGG - Intronic
1117174152 14:53130638-53130660 CCTGGGGGAGGAGGTCCTGGAGG - Intronic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1121331665 14:93053384-93053406 CCGGCTGCCTGTTGTCCTGGGGG + Intronic
1121393162 14:93593950-93593972 CCTGCTGGCTGGTGTCCTTTGGG + Intronic
1122645040 14:103188761-103188783 ACAGCTGGATGATGTGATGGAGG - Intergenic
1122798807 14:104219766-104219788 CCTCCTGGATGAGGCCCGGGTGG + Intergenic
1124925142 15:34063523-34063545 CCTGCGGGAGGATGACCAGGAGG - Exonic
1126168730 15:45676181-45676203 GCTCCTGGATGATCTCCTGCAGG - Exonic
1126185368 15:45826108-45826130 CCTGCTGTATCATCTCATGGTGG - Intergenic
1128334173 15:66775531-66775553 CCTGCTGGATCAGGGCCAGGAGG + Intronic
1129316781 15:74750005-74750027 CCTGCCGGATGGTGTCCAGGCGG - Exonic
1131164870 15:90135080-90135102 CCTGATGGAGGAGGTCCTGTAGG - Intergenic
1131394420 15:92075334-92075356 CATGCTGGATTACCTCCTGGAGG - Intronic
1132111492 15:99105192-99105214 CCGGCAAGATGCTGTCCTGGCGG + Exonic
1132503797 16:296894-296916 CCTGCTGGAGGGTGCCCGGGAGG + Intronic
1132859760 16:2064406-2064428 CCTTCTCGATGATGTCCAGCAGG - Exonic
1133970555 16:10564738-10564760 CCTCCTGGAGGCTGCCCTGGTGG - Intronic
1134689027 16:16178869-16178891 CCTGCTGGATGACCCCCTGGCGG - Exonic
1135585898 16:23670608-23670630 CCAGCTGGCTGGTCTCCTGGGGG + Exonic
1136529949 16:30861399-30861421 CCTGGGGGAGGAGGTCCTGGAGG - Intronic
1137676243 16:50305162-50305184 CCTGTTGTATGGTGCCCTGGCGG + Intronic
1137751527 16:50864414-50864436 CCTGCTGGATGGAGGCTTGGAGG + Intergenic
1141453234 16:84119718-84119740 CTTCCTGAATGATGACCTGGAGG + Intergenic
1141804310 16:86332663-86332685 CCTGCTGGATGTAAACCTGGGGG + Intergenic
1142729489 17:1842796-1842818 CCTTCTGCATGATGGCCTGAGGG - Exonic
1143023254 17:3927501-3927523 GCGGCTGGAGGATTTCCTGGCGG + Intronic
1143579834 17:7818943-7818965 CCTGCTGGATGATGTGCAGCTGG + Exonic
1144605154 17:16658340-16658362 CCTGCTGGGGGATGGCCTAGTGG - Intergenic
1145884470 17:28372470-28372492 CCTGCTGGAGCAGATCCTGGTGG + Exonic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1148784928 17:50141348-50141370 CCAGGTGAATGATCTCCTGGTGG - Exonic
1149319566 17:55470042-55470064 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
1150266104 17:63833327-63833349 ATTCCTGGATGAAGTCCTGGGGG + Exonic
1150820532 17:68430876-68430898 TCTGCAGGATTAGGTCCTGGTGG + Intronic
1151703566 17:75755516-75755538 CCTGCTGGAGGATGTGCGGTAGG + Intronic
1152170282 17:78741802-78741824 TCTGCCGGAGGCTGTCCTGGAGG - Intronic
1152918201 17:83052549-83052571 CCTCCTGGAGGACCTCCTGGTGG - Intergenic
1153693574 18:7617350-7617372 CCTGCTTGATGATTTTCTAGTGG + Intronic
1158407182 18:57170222-57170244 CCTCCTGGATGATTTCCTCAAGG - Intergenic
1158576698 18:58644448-58644470 CCTGGGGGAGGAGGTCCTGGAGG + Intergenic
1158669643 18:59463424-59463446 CCTGCTGTGTGGTGCCCTGGCGG - Intronic
1159037913 18:63295399-63295421 TCTGCTGTCTGATGTGCTGGGGG - Intronic
1160521523 18:79510893-79510915 CCCGGTGGAGGATGTCCCGGCGG - Intronic
1160817719 19:1043751-1043773 CCTGCTGAGGGATGTCCGGGAGG + Exonic
1161028183 19:2046251-2046273 GCTGCAGGAAGATGTGCTGGGGG - Exonic
1161043377 19:2121793-2121815 ACTGCAGGATGAGGTCCTTGTGG + Exonic
1162262209 19:9542479-9542501 CCTGAGGGAGGAGGTCCTGGAGG - Intergenic
1163487288 19:17595672-17595694 CCTGGTGGAGGAGGTTCTGGAGG - Intergenic
1163995882 19:21046901-21046923 TCTTCTGGATGATATCCTGAAGG + Intronic
1165090894 19:33387952-33387974 CCTCCTGGATGAGGCCCTGGCGG - Exonic
1166569030 19:43781991-43782013 CATCCAGGATGATGCCCTGGGGG + Intergenic
1166905795 19:46107516-46107538 CCTGGGGGAGGAGGTCCTGGAGG + Intergenic
1167117790 19:47498148-47498170 CCTTCTGGAGGGAGTCCTGGAGG + Intronic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1168248142 19:55124784-55124806 CCTGATGGAGGAGGTCCTGTAGG - Intergenic
1168637065 19:58004464-58004486 CCTGCTGGAGGATGAGCTGTAGG - Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925180349 2:1813409-1813431 GCTGCTGGAAGCTCTCCTGGGGG - Intronic
926332107 2:11834222-11834244 CCTGATGTATTATATCCTGGTGG + Intergenic
927089623 2:19700647-19700669 TCTGCTGGGTGGTGGCCTGGTGG - Intergenic
927706058 2:25297180-25297202 CATGCTGGCTGCTGTCCTCGGGG + Intronic
929420415 2:41784504-41784526 CCTGCTCTGTGCTGTCCTGGAGG - Intergenic
929584153 2:43102868-43102890 TCTGCTTGATGCTGTGCTGGTGG - Intergenic
929824286 2:45298330-45298352 CCTGCTGGTTGGTTGCCTGGAGG + Intergenic
931285471 2:60828332-60828354 CCTACTGGATGATGACCATGTGG - Intergenic
932159462 2:69447118-69447140 CCTGGGGGAGGAGGTCCTGGAGG + Intergenic
933137933 2:78760142-78760164 CCTGGTGGAGGCTGTCCTGGAGG - Intergenic
933977431 2:87522828-87522850 TCTGCTGGGTGATGTCCCAGAGG - Intergenic
934754811 2:96817468-96817490 CAAGCTGGACGCTGTCCTGGAGG + Exonic
934816702 2:97333641-97333663 CCTGCTGGATTACGTCTTGCTGG + Intergenic
934820994 2:97374843-97374865 CCTGCTGGATTACGTCTTGCTGG - Intergenic
935882195 2:107575839-107575861 TCTGCTGGTTGATGGCCTGCTGG - Intergenic
936060805 2:109294662-109294684 CCTGCTGGGTGATGTGGTGACGG + Intronic
936316391 2:111427977-111427999 TCTGCTGGGTGATGTCCCAGAGG + Intergenic
936870790 2:117132563-117132585 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
938298530 2:130193879-130193901 CCTGCTGCATGTTGTACAGGGGG - Exonic
938458200 2:131480634-131480656 CCTGCTGCATGTTGTACAGGGGG + Exonic
938840959 2:135162979-135163001 TCTGGTGAATGATTTCCTGGCGG - Exonic
938934212 2:136115111-136115133 CTTGCTTGATGATTTCCAGGAGG + Exonic
939569900 2:143828959-143828981 CCTGCCAGATGATGGCCTAGAGG - Intergenic
940182937 2:150955283-150955305 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
940283491 2:152010859-152010881 CCTGCTGGTTGCTGTCCTTGAGG - Intronic
940726441 2:157341569-157341591 CCTGGGGGAGGAGGTCCTGGAGG + Intergenic
940801178 2:158134800-158134822 CTTGCCTCATGATGTCCTGGTGG + Exonic
945858117 2:215091832-215091854 CCTGGGGGAGGACGTCCTGGAGG - Intronic
946187783 2:217990957-217990979 CTTCCTGGGTGATGACCTGGCGG + Intronic
946339127 2:219057186-219057208 GCTGCTGGGTGCTGACCTGGTGG - Intronic
947720893 2:232368592-232368614 CCTGCTGGAGGGGGTCCTGCGGG + Intergenic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
948276260 2:236711327-236711349 CCTGCTGAAGCAAGTCCTGGGGG + Intergenic
948868790 2:240788050-240788072 CCTGTGGGATGATGCCCTGCTGG + Exonic
1168839263 20:898787-898809 CCTGTGGGAGGAGGTCCTGGAGG - Intronic
1169210770 20:3765161-3765183 CCTGCTGGTCGCTGTCCTCGGGG + Intronic
1170680436 20:18521064-18521086 CCTGCGGGAGGAGGTTCTGGAGG + Intronic
1172124140 20:32615134-32615156 CATGCTGGTTTGTGTCCTGGGGG - Intergenic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1173892725 20:46525929-46525951 CCTTCTGGAAGATTTCCTGTAGG + Intergenic
1175790435 20:61737118-61737140 CCTGCTGGATGCTGGCCCTGGGG + Intronic
1175933553 20:62504826-62504848 CCTGCTGGATGATGGCTCTGTGG + Intergenic
1176272042 20:64240403-64240425 CCTGCTTGATGCTCTCCAGGAGG - Exonic
1177160720 21:17545175-17545197 AGAGCTGGATGATGACCTGGAGG - Intronic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1179582427 21:42352106-42352128 CCTGGAGGATGATGGCCTGAAGG - Intergenic
1179582464 21:42352210-42352232 CCTGGAGGATGAGGGCCTGGAGG - Intergenic
1180124540 21:45780518-45780540 TATGCTGGCTGATGTCCTTGTGG + Intronic
1180858403 22:19062601-19062623 ACTGCTGGAGTATGTCCAGGAGG + Intronic
1181041028 22:20192702-20192724 CCTGCTGCCTGCTGCCCTGGTGG - Intergenic
1181456962 22:23065236-23065258 CCTGCTGTTTGATGTCCTCAGGG - Intronic
1183424964 22:37734520-37734542 GGTCCTGGCTGATGTCCTGGGGG - Exonic
1183456425 22:37925654-37925676 CCTGGGGGCTGGTGTCCTGGAGG - Exonic
1184030718 22:41892828-41892850 CCTGCTGCATCCTGTCCTGCTGG - Intronic
1184050484 22:42000111-42000133 CAAGCTGGATGATGTGCTTGGGG + Intronic
949397925 3:3634847-3634869 CCTGATGGATGACACCCTGGAGG + Intergenic
949489528 3:4575142-4575164 CCTGCAAGAAGATCTCCTGGTGG + Intronic
954161767 3:48727795-48727817 CCTGATGGAGGAGGTCCTGTAGG + Intronic
954300267 3:49697433-49697455 CCTGGTGGATGATGACCTGCTGG + Exonic
955277189 3:57557369-57557391 CCTTCTGGATAAGGTTCTGGCGG - Exonic
956541222 3:70341710-70341732 CCTGTTGGCTTATGTCCTCGTGG - Intergenic
960132016 3:114067108-114067130 GCAGCTGCATGATGTCCTGTTGG + Intronic
961822945 3:129584547-129584569 TCTGCAGGATCATGCCCTGGGGG + Exonic
961881045 3:130061516-130061538 CCTGGGGGAAGATGTTCTGGAGG - Intergenic
962713491 3:138107384-138107406 CCTGCTGCATCATCTCCTGGTGG - Intronic
962989298 3:140564052-140564074 TCTCCTGGATGAAGTGCTGGTGG - Exonic
963111844 3:141694753-141694775 CCTGGGGGAGGAGGTCCTGGAGG + Intergenic
963643651 3:147886973-147886995 ACTGCTGGAATGTGTCCTGGGGG + Intergenic
965335102 3:167424835-167424857 CCTGATGGAGGAAGTCCTGTAGG - Intergenic
965841942 3:172916328-172916350 CCTGTTGACTGATGTCCTGTAGG + Exonic
966066841 3:175829957-175829979 CCTGCGGGAAGAGGTTCTGGAGG - Intergenic
966330535 3:178807357-178807379 CCTTATGGTGGATGTCCTGGAGG - Exonic
966398451 3:179524400-179524422 CCTGATGGAGGAGGTCCTGTAGG + Intergenic
968434915 4:579456-579478 CCCGCAGGAGGATGCCCTGGTGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
970180255 4:13384249-13384271 CCTGCTGGCTACTGTGCTGGTGG - Intronic
970452605 4:16185801-16185823 CTGGCTTGATGATGTCCTTGAGG - Intronic
973305410 4:48643145-48643167 TTTGCTGGATGAGGTCCTGCAGG - Intronic
973930851 4:55791907-55791929 CCTGCTGGGAGATGCCCAGGAGG - Intergenic
974903775 4:68032856-68032878 CCTGAGGGATGAAGTCCTGAAGG - Intergenic
975731099 4:77337901-77337923 CTATCTGGTTGATGTCCTGGAGG + Intronic
977894102 4:102344953-102344975 CCTGCCGGCTGGTGCCCTGGTGG - Exonic
978568615 4:110112107-110112129 ACTGCTGGATGAAGTCATGAAGG + Intronic
979140156 4:117162465-117162487 TCTGCTGGTTGATGGCCTGCAGG - Intergenic
980611780 4:135170761-135170783 CCTGGGGGATGAGGTTCTGGAGG + Intergenic
982004271 4:151049386-151049408 CCTGCCGGAGGATGGCCTGCCGG + Intergenic
982318805 4:154058520-154058542 CCTGAGGGAGGAGGTCCTGGAGG - Intergenic
982497109 4:156106937-156106959 CCTGCAGGAGGAGGTTCTGGAGG + Intergenic
982843894 4:160224951-160224973 TCAGCTGGATGCTGTCATGGGGG + Intergenic
983550366 4:169010857-169010879 CCTGCTGGATGATGTTCGACAGG - Intergenic
985079008 4:186245579-186245601 CCTGATGGAGGAGGTCCTGTAGG + Intronic
985533930 5:452170-452192 CCTGCTTGATGATGTCCACAAGG + Intronic
985608334 5:871271-871293 CCCGCTGGGTGCTGTCCTTGTGG - Intronic
985725752 5:1515067-1515089 CCTGATGCAGGATGTGCTGGGGG - Intronic
985725775 5:1515163-1515185 CCTGATGCAGGATGTGCTGGGGG - Intronic
985725799 5:1515259-1515281 CCTGATGCAGGATGTGCTGGGGG - Intronic
986096192 5:4556062-4556084 CCGGCTGGGTGAGGTCCTTGGGG - Intergenic
986290869 5:6397765-6397787 CCTGAGGGAGGATGTGCTGGTGG - Intergenic
986438525 5:7758739-7758761 CCTGCTCGATGGAATCCTGGAGG + Intronic
986502634 5:8416336-8416358 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
986701263 5:10411462-10411484 CCTGCTGGAGTATGGCTTGGTGG - Exonic
990565128 5:57020451-57020473 CCTGCAGGAGGAGGTCCTGTAGG + Intergenic
991946357 5:71901656-71901678 CCTGCTGCATTATGTTCTGCTGG + Intergenic
992155247 5:73948940-73948962 CCTGGTGGACTGTGTCCTGGTGG + Intergenic
995546844 5:113240967-113240989 GGAGCTGCATGATGTCCTGGAGG - Intronic
995790485 5:115881767-115881789 CCTCCTGGATAATATCCTGAAGG + Intronic
996215457 5:120860114-120860136 CCTGCTGGTTGATGTACTGAAGG + Intergenic
998808452 5:145941464-145941486 CCTCCAGGAAGAGGTCCTGGTGG + Intronic
998985480 5:147751810-147751832 CCTGATGGATGAGGTTCTGTAGG + Intronic
999106356 5:149074805-149074827 CCTGCTAGATGATTTCCTTATGG - Intergenic
1000606925 5:163336264-163336286 CCTGGGGGAGGAGGTCCTGGAGG - Intergenic
1001021927 5:168190419-168190441 CCTGCTGAATGATGTCCAGTGGG - Exonic
1003639189 6:7862409-7862431 CCGGCTGGAGGCTGACCTGGTGG - Exonic
1004836998 6:19541144-19541166 CCTGGGGGAGGATGTTCTGGAGG - Intergenic
1005583627 6:27255240-27255262 GCTGCTGGAAGATGTTCTGTGGG - Exonic
1005786579 6:29250677-29250699 CCTGGGGGAGGAGGTCCTGGAGG + Intergenic
1005923373 6:30419253-30419275 CCAGCTGTATGGTGCCCTGGTGG - Intergenic
1007107749 6:39295304-39295326 GCTTCTGGACGATGTGCTGGTGG + Intergenic
1007300986 6:40867677-40867699 CCTGTTGGAGGAAGTCCTGTAGG + Intergenic
1007329077 6:41089656-41089678 GCTGCTGGATGATGATCTGCTGG - Exonic
1008511451 6:52279452-52279474 CATTCTGGATGATGACTTGGTGG - Exonic
1009464333 6:63952146-63952168 CCTGATGGAGGAGGTCCTGTAGG - Intronic
1011359173 6:86503557-86503579 CCTACTCAATGATGTCCTGGTGG + Intergenic
1011668702 6:89661231-89661253 CCTGCTGGTTGATGAGCTGTAGG + Intronic
1012646230 6:101685464-101685486 CATGCTGGATGTTTTCATGGTGG + Intronic
1016650297 6:146453886-146453908 CCTGGGGGATGAGGTGCTGGGGG + Intergenic
1017002663 6:150006609-150006631 CCTGCTGGAGGCTCTCCTGCTGG - Intergenic
1018495406 6:164342204-164342226 CCTGGTGGAGGAGGTTCTGGAGG + Intergenic
1018579775 6:165298389-165298411 CATACTGGATAAAGTCCTGGAGG + Intronic
1019539983 7:1547107-1547129 CGTCCTGCACGATGTCCTGGGGG + Exonic
1019640191 7:2099209-2099231 GCTGCTGCATGTTGACCTGGCGG - Intronic
1019920491 7:4160342-4160364 CCTTTTGGATGCTGCCCTGGAGG - Intronic
1022447401 7:30481471-30481493 CCTGATGGAGGAGGTCCTGTAGG - Intergenic
1022644735 7:32219638-32219660 CCTCCTGGTTGATACCCTGGTGG + Intronic
1024319040 7:48047029-48047051 TCTTCTGTATGAAGTCCTGGTGG + Intronic
1024523955 7:50332441-50332463 CCTGCTGCCTGATTTCATGGGGG - Intronic
1028247092 7:88492648-88492670 CTTGCAGGCTGGTGTCCTGGAGG - Intergenic
1029279964 7:99429189-99429211 CTTTGTGGATGATTTCCTGGGGG + Exonic
1033211517 7:139463531-139463553 CCTGGTGGAGGAAGTCCTGTAGG - Intronic
1034330069 7:150274888-150274910 TCTCCTGGATGACGTTCTGGCGG + Intronic
1034667985 7:152834970-152834992 TCTCCTGGATGACGTTCTGGCGG - Intronic
1035076499 7:156181041-156181063 CGGGCTGGAGGGTGTCCTGGTGG - Intergenic
1038577440 8:28717226-28717248 CAAGCTGGATCAGGTCCTGGTGG + Exonic
1040648020 8:49421739-49421761 CCTGATGGAGGAGGTCCTGTAGG - Intergenic
1041586235 8:59523382-59523404 TCTGCTGGTTGATGGCCTGCTGG - Intergenic
1041651844 8:60309971-60309993 CCTGATGGAGGAGGTCCTGTAGG + Intergenic
1043504395 8:80888025-80888047 CTTGTTGGATGAAGTCCTGCCGG + Intergenic
1043517686 8:81010925-81010947 CCAGCTGTATGATGACCTGAAGG - Intronic
1043518180 8:81016014-81016036 CCTGCTGGATGATGAGAAGGTGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045543033 8:103104210-103104232 CCTGTTGGGTTATGTCCTGGTGG + Intergenic
1046750421 8:117920894-117920916 CCTGCTTGATGATGTGTTGGAGG - Intronic
1046898735 8:119500968-119500990 TCTGCTGGCTGTTCTCCTGGCGG + Intergenic
1047214327 8:122864442-122864464 CCTGCTGTATGTGGTCCAGGGGG + Intronic
1047499448 8:125430520-125430542 CCTGCTGAATCCTGTCCTCGCGG + Exonic
1048849739 8:138633350-138633372 CATGCTAGATGATGTATTGGAGG - Intronic
1049670978 8:143869752-143869774 CCTGCTGGAGGACGTGCAGGAGG - Exonic
1049781493 8:144431042-144431064 CCTGCTGCCTGCTGACCTGGGGG - Intronic
1049868824 8:144957730-144957752 CCTGGGGGAGGAGGTCCTGGAGG + Intergenic
1050140476 9:2511673-2511695 CCTGTGGGAGGAGGTCCTGGAGG - Intergenic
1050479285 9:6073311-6073333 TCTGCTGGTTGATGGCCTGCTGG - Intergenic
1050493032 9:6209604-6209626 CATGCTTGATGATGTCCTACAGG + Intergenic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1051820893 9:21166354-21166376 TCTGCTGGATCATCTCATGGAGG + Exonic
1051822752 9:21187273-21187295 TCTGCTGGATCATCTCATGGAGG + Exonic
1051824304 9:21201907-21201929 TCTGCTGGATCATCTCATGGAGG + Exonic
1051824642 9:21206839-21206861 TCTGCTGGATCATCTCATGGAGG + Exonic
1051826574 9:21227915-21227937 TCTGCTGGATCATCTCATGGAGG + Exonic
1051833227 9:21304998-21305020 TCTGCTGGATCATCTCATGGAGG + Exonic
1051839989 9:21385074-21385096 TCTGCTGGATCATCTCATGGAGG + Exonic
1051842053 9:21409413-21409435 TCTGCTGGATCATCTCATGGAGG - Exonic
1052892918 9:33720277-33720299 CCTGCAGGATGATGGGCTTGGGG + Intergenic
1056752073 9:89359206-89359228 CCTGCTGGAGGTTGCCATGGAGG + Exonic
1059960106 9:119556411-119556433 CCGGCTGGATGGTGCCGTGGTGG + Intergenic
1060472546 9:123960524-123960546 CCTCCTGTATGTTGTACTGGGGG + Intergenic
1060547325 9:124469110-124469132 CCTACTGGAGGTTGTACTGGGGG - Intronic
1060833434 9:126735075-126735097 TTTGCTTGATAATGTCCTGGAGG - Intergenic
1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG + Exonic
1061391724 9:130320616-130320638 CGTCCTGGACAATGTCCTGGGGG + Intronic
1189031816 X:37459238-37459260 CCTGATGGAGGAGGTCCTGTAGG + Intronic
1189147897 X:38673965-38673987 CCTGCTGAATGACCTACTGGAGG - Intronic
1190262578 X:48806653-48806675 GCTGGTGGATGCGGTCCTGGGGG + Exonic
1192368197 X:70492609-70492631 CCTACTGGCTGATTTCCTTGGGG - Intronic
1192706139 X:73529906-73529928 CCTGGGGGAGGATGTCCTGGAGG - Intergenic
1192914135 X:75635735-75635757 CCTGTGGGAGGAGGTCCTGGAGG + Intergenic
1195326862 X:103765244-103765266 CCTGGTGGAGGTGGTCCTGGAGG + Intergenic
1197793634 X:130279276-130279298 CCTGATGGAGGAGGTCCTGGAGG - Intergenic
1198552955 X:137763413-137763435 CCTGCTATATGCTTTCCTGGAGG + Intergenic
1199672592 X:150159478-150159500 CCTGCAGGATGCTGGCCTGAGGG + Intergenic
1200144825 X:153921117-153921139 GCTGCAGGATGAGCTCCTGGAGG - Exonic
1200987179 Y:9314427-9314449 CCTTTTGCATGATGTCCTGAAGG - Intergenic
1202118410 Y:21498213-21498235 CCTTTTGCATGATGTCCTGAAGG + Intergenic
1202120862 Y:21521753-21521775 CCTTTTGCATGATGTCCTGAAGG + Intronic
1202123313 Y:21545294-21545316 CCTTTTGCATGATGTCCTGAAGG + Intronic
1202155693 Y:21884087-21884109 CCTTTTGCATGATGTCCTGAAGG - Intronic
1202158141 Y:21907628-21907650 CCTTTTGCATGATGTCCTGAAGG - Intronic
1202184594 Y:22172553-22172575 CCTTTTGCATGATGTCCTGAAGG - Intronic
1202206766 Y:22413848-22413870 CCTTTTGCATGATGTCCTGAAGG + Intronic