ID: 947909705

View in Genome Browser
Species Human (GRCh38)
Location 2:233792953-233792975
Sequence CTGGGTAAGGAGCAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 375}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947909690_947909705 27 Left 947909690 2:233792903-233792925 CCCACTTGAGCCTGCAGGTCTGG 0: 1
1: 0
2: 2
3: 20
4: 183
Right 947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG 0: 1
1: 0
2: 6
3: 44
4: 375
947909701_947909705 -9 Left 947909701 2:233792939-233792961 CCGGAGGGAGACTGCTGGGTAAG 0: 1
1: 0
2: 1
3: 7
4: 169
Right 947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG 0: 1
1: 0
2: 6
3: 44
4: 375
947909692_947909705 26 Left 947909692 2:233792904-233792926 CCACTTGAGCCTGCAGGTCTGGC 0: 1
1: 0
2: 0
3: 26
4: 231
Right 947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG 0: 1
1: 0
2: 6
3: 44
4: 375
947909693_947909705 17 Left 947909693 2:233792913-233792935 CCTGCAGGTCTGGCTCGATCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG 0: 1
1: 0
2: 6
3: 44
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947909705 Original CRISPR CTGGGTAAGGAGCAGATGGA GGG Intronic
900783973 1:4636190-4636212 CTGGTTATGGAGCAGATGGATGG - Intergenic
900930679 1:5735075-5735097 CGGGGTAAGGAGCTGCTGCAGGG + Intergenic
901061337 1:6473357-6473379 CTGGGCAGAGAGCAGCTGGAGGG + Exonic
902162538 1:14542944-14542966 TTGGGTATGGAAAAGATGGAAGG + Intergenic
902270532 1:15301182-15301204 CTGGGTAGAGATCAGATGGGAGG - Intronic
902532447 1:17099046-17099068 CTGGGTGTGGGGCAGATTGACGG + Intronic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903012389 1:20340350-20340372 TTGGGCAAGGAGCAGAGGGTAGG + Intronic
903345185 1:22679958-22679980 TTGGGGGAGGAGCAGCTGGAAGG - Intergenic
903907439 1:26696608-26696630 CTGGGAAAGGAGCTGCAGGACGG + Exonic
904433488 1:30479631-30479653 CTGGGGAAGGAGTGGAGGGAAGG - Intergenic
904497858 1:30897437-30897459 CTGGGGAAAGATCAGATGGCTGG - Intronic
904586261 1:31582593-31582615 CAGGGCAAGGGGCAGATGCATGG + Intronic
904929466 1:34074883-34074905 CTAAGCAAGGGGCAGATGGAGGG + Intronic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905689454 1:39932261-39932283 CTAGGTGAGGAGAAGATGGAAGG + Intergenic
906101897 1:43269319-43269341 CTGTGTAAGGGGCCCATGGAGGG - Intronic
907327976 1:53653235-53653257 CTGGTAAAGAAGCAGATGGATGG + Intronic
908192679 1:61719454-61719476 CTGGGTAAAGGGTATATGGATGG + Intronic
910512529 1:88022882-88022904 CTGGGTAATAAGCAGAGGTAGGG - Intergenic
910806187 1:91191658-91191680 CTGGGAAAGGAGAAGATGAGGGG - Intergenic
911971238 1:104440516-104440538 CTGGGTAAAAAGCAAGTGGATGG - Intergenic
913531070 1:119734827-119734849 CTGGGGAAGGCCCAGATGGAGGG - Intronic
914351330 1:146842867-146842889 GTGGGTAGGGAGATGATGGATGG + Intergenic
916070052 1:161164805-161164827 CTGGTTAAGGAGCATTTGGGAGG - Intronic
917709046 1:177665932-177665954 CTGGCAAAAGAGCAGAGGGAAGG + Intergenic
918220521 1:182432397-182432419 CTTGGTAAGAAGTAGATGCACGG - Intergenic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
921429741 1:215051666-215051688 CTTGGGAAGCAGCAGATGCAAGG + Intronic
923237552 1:232048784-232048806 CGAGGTAAGGAACAGATGAATGG - Intergenic
923557088 1:235009807-235009829 CTGAGAGAAGAGCAGATGGAGGG + Intergenic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
1066366300 10:34780036-34780058 CGGGGAAAGAAGAAGATGGAGGG - Intronic
1066385256 10:34936329-34936351 CTGGGTATGAAACAGCTGGAAGG + Intergenic
1068598127 10:58925861-58925883 TTCGGTAAGGGGCAGTTGGAAGG + Intergenic
1069870461 10:71529805-71529827 GTGGGTAAGGAGGAGGTGGGAGG - Intronic
1069974022 10:72198178-72198200 GAGGGAAGGGAGCAGATGGAAGG + Intronic
1069974039 10:72198221-72198243 GAGGGAAGGGAGCAGATGGAAGG + Intronic
1069974057 10:72198269-72198291 GAGGGAAGGGAGCAGATGGAAGG + Intronic
1070153510 10:73819531-73819553 CTGGCTGAGGAGCAGAGAGAAGG + Exonic
1070170391 10:73928469-73928491 CTGGGAAGGGAGCAGACAGAAGG + Intergenic
1070768875 10:79070852-79070874 CGGGGGAAGGAGCAGCGGGAGGG - Intronic
1070787136 10:79168418-79168440 GTGGGGAAAGAGCAGATGGCTGG - Intronic
1070986464 10:80693744-80693766 CTGGTGGAGGCGCAGATGGAGGG + Intergenic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1072631730 10:97151236-97151258 GTGGGTGAGTAGAAGATGGAAGG + Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073347639 10:102796202-102796224 CGGGGGAAGGAGCACATAGAAGG + Intronic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076698173 10:132257032-132257054 CCTGGCCAGGAGCAGATGGATGG + Intronic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081684040 11:45028844-45028866 GGGGGAATGGAGCAGATGGAAGG + Intergenic
1082082953 11:48026305-48026327 CTGGGAAAGGGGCAGTTGGCTGG + Intronic
1082143056 11:48632262-48632284 ATGGGAAAGGAGCACATAGATGG - Intergenic
1083779906 11:64912376-64912398 CGGGGTCAGGAGCAGGTGCAGGG + Exonic
1084000618 11:66293547-66293569 TGGGGTGGGGAGCAGATGGAGGG - Intronic
1084179184 11:67438108-67438130 CTGGGGAGGGAGCAGAGGGCTGG + Exonic
1084209683 11:67615243-67615265 CTGGGGGTGGAGCAGAGGGATGG - Intergenic
1084786013 11:71442041-71442063 CTGGGTAAGGAGGGAATGGATGG - Intronic
1085025294 11:73232949-73232971 AGGGGTAAGGAGGAGAGGGAGGG + Intronic
1085055957 11:73403944-73403966 CTGTGTGGGGATCAGATGGAGGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085932555 11:81101933-81101955 CAGAGGAAGTAGCAGATGGAAGG - Intergenic
1086353806 11:85971434-85971456 CTGGGTTAAGAGCAGATGCTGGG + Intronic
1086986525 11:93255999-93256021 GTGGCTCAGGAGCAGATGGTTGG + Intergenic
1087626088 11:100597736-100597758 CATGGTAATGAGCATATGGAGGG + Intergenic
1089118119 11:116112580-116112602 TTGGGAAAGAAGCAGAGGGAGGG + Intergenic
1089445068 11:118545433-118545455 GAGGGAAAAGAGCAGATGGAGGG + Exonic
1090501217 11:127263241-127263263 CTGGGCAAAGGGCAGAAGGAGGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091646088 12:2273517-2273539 CTGGGTTAGGACCAGCAGGACGG + Intronic
1092160062 12:6310987-6311009 CTGGGTAGGGAGCAGTGCGAGGG + Exonic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1095575665 12:43735375-43735397 CTGGACAAGGAGGAAATGGAAGG + Intronic
1095951271 12:47783227-47783249 GAGGGTACGGACCAGATGGAGGG + Exonic
1096688848 12:53307160-53307182 CTGGGTCAGTATGAGATGGAAGG - Intronic
1097991640 12:65841223-65841245 CTGGGTAAGAAGCACATGTGAGG + Intronic
1098088761 12:66878460-66878482 CTGGGAGAGGAGAAAATGGAGGG + Intergenic
1100006560 12:89901765-89901787 GTTGGTATGGAGCTGATGGAAGG + Intergenic
1100670147 12:96802819-96802841 GTGGGTAGGGAGCAGGGGGAGGG - Intronic
1100796354 12:98185839-98185861 TTGGGTAGGCAGCAGAAGGAAGG - Intergenic
1101241968 12:102848068-102848090 CAGGGTAATGAGCAGATAGATGG + Intronic
1101348585 12:103907268-103907290 GGGGGAGAGGAGCAGATGGAGGG + Intergenic
1103133421 12:118487817-118487839 ATGGGCAAGGAGCAGATGCAGGG + Intergenic
1103567256 12:121822997-121823019 CAGGGGAAGGGGCAGAGGGAGGG - Exonic
1104209963 12:126679224-126679246 CTGGGAAAGAGGCACATGGATGG - Intergenic
1104644034 12:130484520-130484542 CAGGGGAAGGAGCAGATAGCAGG - Intronic
1105420586 13:20248410-20248432 CTCTGTAAGGAGCAGTGGGATGG + Intergenic
1106971647 13:35147655-35147677 CTGGGTCAGGAGGTGAGGGAAGG + Intronic
1106978630 13:35251898-35251920 CTGGGGTGGGAGCAGAAGGAAGG - Intronic
1108167420 13:47708157-47708179 CAGGGTAAGGAGGATCTGGAAGG - Intergenic
1108297319 13:49037473-49037495 TTGGATAAGGAGGAGATAGAAGG + Intronic
1108701075 13:52944643-52944665 CTGGGTAAGGAGAGCAAGGAGGG + Intergenic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112542315 13:100327221-100327243 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1113121236 13:106925783-106925805 CTGGGTAATGAGCAGAGGCTGGG - Intergenic
1113360784 13:109629432-109629454 CTGGGAAAGGAAGAGATGAATGG + Intergenic
1113521571 13:110945829-110945851 CTGGGTGTTGAGGAGATGGAAGG - Intergenic
1113880111 13:113620157-113620179 CTGTGGGTGGAGCAGATGGAGGG + Intronic
1114004928 14:18302100-18302122 CTGGGTTAGAAGCATATGGGTGG - Intergenic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114645374 14:24253028-24253050 CTGGGTAAGGGCCTGAGGGATGG + Intronic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117881593 14:60318049-60318071 CAAGGTAAGGAGCAGAAGGTGGG - Intergenic
1119379195 14:74218003-74218025 CTGGGTAGGGAGCATAGGGTCGG - Intergenic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1120831838 14:89004326-89004348 CTGGGTGAGAAGCAGTGGGAGGG + Intergenic
1121467990 14:94128301-94128323 CTGGGTAGGGAGAAGAGGAAAGG - Intronic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122328095 14:100894729-100894751 CTGGGAAGGGAGCAGATGCCTGG + Intergenic
1122500912 14:102198834-102198856 CTGGGAAAGGAGCAGTTGTCAGG + Intronic
1123165801 14:106324112-106324134 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123168498 14:106349140-106349162 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123176187 14:106421566-106421588 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123194756 14:106605974-106605996 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123198381 14:106638976-106638998 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123222815 14:106872687-106872709 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1202947497 14_KI270726v1_random:41999-42021 CCGGGTCAGGAGCAGGTGCAGGG + Intergenic
1123410603 15:20056041-20056063 CTGGCTCGGGAGCAGATGCAAGG - Intergenic
1123519935 15:21062747-21062769 CTGGCTCGGGAGCAGATGCAAGG - Intergenic
1125649432 15:41302526-41302548 CTGGATAAAGAGCATATGAAAGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127526177 15:59793935-59793957 ACTGGTAAGGGGCAGATGGATGG + Intergenic
1127791477 15:62402453-62402475 CTGGGTAAGGAGGACAAGAAAGG - Intronic
1128381936 15:67119555-67119577 CTGTCTATGAAGCAGATGGATGG + Intronic
1128612048 15:69081822-69081844 CTGGCTAAGGAACACAGGGAGGG + Intergenic
1131132993 15:89912285-89912307 CTGGGTGAGGAGGATTTGGAGGG - Intronic
1131602658 15:93865193-93865215 CTGGGTATGGAGTAGATTGATGG + Intergenic
1131759135 15:95600936-95600958 TTGGGAAAGGAGGAGAGGGAAGG + Intergenic
1131788293 15:95936596-95936618 TTGGGGAAGGGGCAGAGGGACGG - Intergenic
1132026280 15:98406870-98406892 CTGGGGTAGGAGGAGAAGGAAGG - Intergenic
1132203108 15:99968675-99968697 CTGGGGCCGGAGAAGATGGATGG - Intergenic
1132289009 15:100686315-100686337 CTGGAGAAGGAGCAGATCCAGGG - Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132695563 16:1200314-1200336 CGGCGTGAGGAGCAGATGAACGG - Exonic
1132803762 16:1766423-1766445 CTGGGGCAGGAGCAGAGGGAAGG + Intronic
1134298029 16:12963921-12963943 CTTGGTGAGGACCAGAGGGAAGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135524732 16:23205754-23205776 CTGGGGATGGAACAGGTGGATGG - Intronic
1136040725 16:27576758-27576780 CTGGGTAAGGCACAGAGGGTTGG - Intronic
1136071337 16:27789300-27789322 ATGGATAATGGGCAGATGGAGGG + Exonic
1136071350 16:27789368-27789390 ATGGATAATGGGCAGATGGAGGG + Exonic
1137391653 16:48086363-48086385 CTGGCTGTAGAGCAGATGGAAGG - Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG + Intergenic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139982708 16:70872683-70872705 GTGGGTAGGGAGATGATGGATGG - Intronic
1140639629 16:76957097-76957119 CTGGGAAATGTGCACATGGAGGG + Intergenic
1141140564 16:81494329-81494351 CTGGGAATGGAGCAGATGCGGGG + Intronic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1141881576 16:86863684-86863706 CTGGGCAAGAGGCAGATGGCAGG + Intergenic
1142804592 17:2364800-2364822 CTGGGTAGGAGGCAGATGGCTGG - Intronic
1143363101 17:6387385-6387407 CTGGGTGAGAAGAAGATGAATGG - Intergenic
1145192096 17:20851887-20851909 CTGCGGAAGGAGCAGAGGGGAGG - Intronic
1145402317 17:22551920-22551942 CTGCGGAAGGAGCAGAGGGGAGG - Intergenic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1147261481 17:39211837-39211859 CTTGCAAAGGAGCAGATGCACGG + Exonic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148062737 17:44847900-44847922 CTGGGGAAGAGGCAGATGGTAGG + Exonic
1148319293 17:46736486-46736508 CAGGGTAAGGAGTAGAGGGAGGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1148670258 17:49404905-49404927 CTGGGGTGGGAGCAGAAGGAAGG + Exonic
1148779316 17:50112629-50112651 CTGGGGGAGGAGCAGATGAAGGG - Intronic
1150656232 17:67041643-67041665 CTGGCTGCGGAGCAGGTGGAAGG - Intergenic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1152308526 17:79535339-79535361 ATAGGTAAGGAGAAGAGGGAGGG + Intergenic
1152915562 17:83032961-83032983 CTGGGTCAGGAGGAGAGGAACGG + Intronic
1154027601 18:10723450-10723472 CTGCAATAGGAGCAGATGGAGGG + Intronic
1154069631 18:11141647-11141669 CAGGCTAAGGAGCAGACGAACGG + Intronic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1157597906 18:48875033-48875055 CTGGGCCAGGAGGAGATGGAGGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158546108 18:58398833-58398855 CTGGGTAAGGAGCAGTTGCTGGG + Intronic
1159843623 18:73430969-73430991 GTGGGCAAGGAGGAGAAGGAAGG - Intergenic
1160130782 18:76223172-76223194 CTGGGGAAGGAGCACATGAAAGG - Intergenic
1160767876 19:816466-816488 CTGGGTAATGAATGGATGGATGG - Intronic
1161181717 19:2887925-2887947 CTGGCTAAGGGGCAGAGGCAAGG - Intergenic
1161585649 19:5103994-5104016 GTGGGTGAGGAGCAGAAGGAGGG + Intronic
1162031548 19:7919664-7919686 CCGGGTAAGGAGAGGAGGGAGGG - Intergenic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1162917268 19:13881232-13881254 CTTGGGCAGGAGCAGAAGGATGG + Intergenic
1163007708 19:14406846-14406868 CTGGGCAGGGAGCAGATTGTGGG - Intronic
1163235778 19:16029623-16029645 CTGGGACAGGAGCAGAGGGCGGG + Intergenic
1163373231 19:16914303-16914325 CTCGATAATGAGCAGAAGGAGGG + Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1164746694 19:30621682-30621704 CTGGGTGAGGAGCAGCCGGGTGG + Intronic
1166029547 19:40116818-40116840 ATGGGTAAAGCTCAGATGGAAGG - Intergenic
1166329333 19:42069508-42069530 AGGGGGAAGGAGCAAATGGAGGG + Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1167042731 19:47032261-47032283 CTGGGGCTGGGGCAGATGGAAGG - Exonic
1167793352 19:51693772-51693794 CTGGGGAAGGTGCAGAGGGAGGG + Intergenic
1168512852 19:56987340-56987362 CTGGGTTAGGAGGGGATGAAAGG - Intergenic
925872617 2:8284216-8284238 CTGGGAAAGGGACAGTTGGAGGG - Intergenic
927458426 2:23277113-23277135 CGGGGAAAGGAGCAGATTGGAGG + Intergenic
928443383 2:31312063-31312085 CTAGGAAGGGAGGAGATGGAGGG - Intergenic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
934993833 2:98939382-98939404 CTGGAGAAGGATCAGAGGGATGG - Intergenic
935091803 2:99901739-99901761 CTGGAGAAAGAGCAGATGCAGGG - Intronic
936276484 2:111102156-111102178 CAAGGTCAGGAGCAGATGGAAGG - Intronic
937038679 2:118803824-118803846 CTGGGGAAGGAGCAGCGGGAGGG - Intergenic
937449674 2:121991978-121992000 GTGGGGGAGCAGCAGATGGAGGG - Intergenic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938472451 2:131577360-131577382 GAGGGGAAGGAGGAGATGGAAGG - Intergenic
938857336 2:135327075-135327097 CTGGGTAATGAGTACATGGGGGG + Intronic
939294985 2:140250332-140250354 TTGGATCAGGAACAGATGGATGG + Intronic
939739190 2:145885255-145885277 CTGAGGAAGCAGCAGATAGATGG - Intergenic
941990822 2:171555362-171555384 CTGGGGAGGGAGCAGAAGGCAGG - Exonic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
946077981 2:217091580-217091602 CTGGGACAGGAGGAGATAGAAGG + Intergenic
946266647 2:218549058-218549080 CTGGATAGGGATCAGAGGGAAGG + Intronic
946365708 2:219247754-219247776 CTGGGTGAGGAGCATGTGGGTGG + Exonic
947523968 2:230867371-230867393 CTGGGTAAGGAGGAAATGTGCGG - Intronic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
948079143 2:235191384-235191406 CTGGGAGAGGAGCAGCTGGGAGG - Intergenic
948735065 2:239998236-239998258 CTGGGTAAGGAGGAAAGTGAAGG - Intronic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1171114977 20:22517646-22517668 ATGGCTAATGAGCAGGTGGAAGG + Intergenic
1172184878 20:33025252-33025274 ATGGGTAGTGAGTAGATGGATGG - Intergenic
1172184937 20:33025647-33025669 ATGGGTAGTGAGTAGATGGATGG - Intergenic
1173285615 20:41669142-41669164 CTGGGTAAAGAACAAATGGGTGG + Intergenic
1173430408 20:42982741-42982763 GTGGGAGAGGAGCAGAGGGATGG - Intronic
1173745526 20:45433985-45434007 CTGAGTAAAGTGCAGATGGCAGG - Intergenic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174458025 20:50663275-50663297 CTGGGTAAGGTGCTGATGGGAGG - Intronic
1175934508 20:62508856-62508878 CGGGGTGCTGAGCAGATGGATGG - Intergenic
1177064981 21:16419377-16419399 CTGGGAAGGGAGCCAATGGAAGG - Intergenic
1177158107 21:17519143-17519165 CAGGGTAAGGAGCCAATGTAGGG - Intronic
1178687559 21:34723414-34723436 ATGGGTAAGGAGCTGATGGAAGG + Intergenic
1179037667 21:37773445-37773467 ATGAGTAGGGAGCAGAGGGAAGG + Intronic
1179572761 21:42287535-42287557 CTGGGAAGGGAGCAGAACGAAGG - Intronic
1179984689 21:44913869-44913891 ATGGGTAAGGCACAGATGTAGGG + Intronic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181753220 22:25004548-25004570 CAGGGAAATGGGCAGATGGAGGG - Intronic
1182626958 22:31654530-31654552 CTCGGGCAGGAGCAGATTGAAGG - Intronic
1182710329 22:32318678-32318700 CTGTGTTGAGAGCAGATGGAAGG - Intergenic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1182951320 22:34378753-34378775 TTGGGTAAGGAGCAGTAGGCTGG + Intergenic
1183272057 22:36868474-36868496 GGAGGGAAGGAGCAGATGGAGGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1184227344 22:43136632-43136654 TTGGGGAAGTAGCAAATGGAAGG + Intronic
1184397899 22:44255643-44255665 CTGTGTTGAGAGCAGATGGAAGG - Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184927198 22:47651257-47651279 CTGGGGAAGGAGGAGAAGGTGGG + Intergenic
950171041 3:10839320-10839342 CTGGGTCAGGGGCAGATGAGAGG - Intronic
950175082 3:10867625-10867647 GTGGGAAAGGACCAGATGGATGG - Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950489424 3:13294676-13294698 CTGGGTTAGGGGGAGATGGCTGG - Intergenic
952348094 3:32507478-32507500 CTGGGTAACAAGGAGATTGAGGG + Intergenic
952608978 3:35183903-35183925 ATATGTAAGGAGCAGATGCAGGG - Intergenic
953027208 3:39152210-39152232 ATGGGTAAGGAACAGGAGGAGGG + Intronic
953369350 3:42374145-42374167 CAAGATAAGGAGCAGATGGAAGG - Intergenic
953445519 3:42961645-42961667 CTTGTTGAGGAACAGATGGAGGG + Intronic
954415179 3:50389885-50389907 CTTGGTAAGAAGTACATGGATGG + Intronic
954672874 3:52299870-52299892 CAGGGTAGGGAGCACAGGGAGGG + Intergenic
954867832 3:53744717-53744739 CTAGGGAAGGAGCAGAAAGACGG - Intronic
955067439 3:55545333-55545355 CTGGGGAGGGATCAGAAGGATGG + Intronic
956160545 3:66346858-66346880 CTGTGTAAGGACCACTTGGATGG + Intronic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957284586 3:78202020-78202042 CTGGGTACTGAGCAGGTGGCTGG - Intergenic
960204336 3:114876762-114876784 GTTGGTAAGGAACAGATGGTTGG - Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
961915350 3:130368567-130368589 CTGGGTAAGGAGGAGAAGTGGGG + Intronic
962417525 3:135196720-135196742 GTGGGAAAGGAGAAGTTGGAGGG - Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
965561852 3:170069533-170069555 CTGGAAAATGAACAGATGGACGG - Intronic
966457720 3:180136584-180136606 CTGGTGAATGAGCAGATGGGAGG + Intergenic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967231045 3:187337749-187337771 CTGATCATGGAGCAGATGGATGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
968271069 3:197404200-197404222 CCGGGTAAGGAGATGAAGGAAGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968584481 4:1409750-1409772 CTGGGACAGGAGCAGAAGTATGG + Intergenic
968641994 4:1719684-1719706 CTGGGGAGGGTGCAGCTGGAAGG + Intronic
969638782 4:8384613-8384635 CTGGGGAGGGGGCAGATCGAGGG - Intronic
971251349 4:24975615-24975637 CTGGGGAAGGAGCTCATTGATGG + Intronic
971251607 4:24977202-24977224 CTGGGGAAGGAGCTCATTGATGG - Intronic
971582296 4:28357280-28357302 ATGGGAAAGGAGGAGAGGGAAGG + Intergenic
972783394 4:42305594-42305616 CTGGGTAGGGTGCTGATGAAGGG + Intergenic
975493011 4:75009296-75009318 CTGACTCAGGAGCTGATGGAAGG - Intronic
976544012 4:86312400-86312422 GTGAGTAAGGAGCACTTGGAAGG - Intronic
976739766 4:88346047-88346069 TAGGGTGAGAAGCAGATGGATGG + Intergenic
977534823 4:98244904-98244926 ATGGGAAAGGAGCAGACTGAGGG + Intergenic
977857626 4:101913072-101913094 CTGGGTTGGGATCAGATGGTTGG - Intronic
978345374 4:107762155-107762177 CCGGGGGAGGAGGAGATGGAAGG + Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981618991 4:146672692-146672714 CTGGGAAAAAAGCAGAGGGAGGG + Intergenic
982287359 4:153748986-153749008 CTGGAGAAGGAGCAGCTGGGAGG + Intronic
982826663 4:160010981-160011003 CTGGGGATGGAGCAGGTGGTTGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
983874931 4:172864268-172864290 GGGGATAAGGAGCAGATGAATGG - Intronic
984549257 4:181141130-181141152 CTGGGTAAAGAGGAAATTGAGGG - Intergenic
985817861 5:2139786-2139808 CTGAGTAAGCTGCAGATGCAGGG - Intergenic
986635063 5:9812941-9812963 ATGGGTTATGAGCAGAAGGAAGG + Intergenic
988398727 5:30732666-30732688 CTAGGTCAGGAGCGGATAGATGG - Intergenic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
991404183 5:66285675-66285697 GTGTGTAAGGAGCGGATGGTTGG + Intergenic
992623753 5:78618364-78618386 TTGGGCAAGGAGCAGCTGGGAGG + Intronic
993260574 5:85653991-85654013 CTGTGTAAGGATCAGTTGCAGGG - Intergenic
993260889 5:85656479-85656501 CTGTGTAAGGATCAGTTGCAGGG - Intergenic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
996633716 5:125666250-125666272 ATGGGTGAGGAGCAGATACAGGG + Intergenic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997966610 5:138361960-138361982 CTTGGGGAGCAGCAGATGGAGGG + Intronic
998060693 5:139116512-139116534 CTGGGTAATGAGCAGAACAAGGG + Intronic
998174477 5:139893528-139893550 CTGGGGAAGGAGCTGCTGCAGGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1001834737 5:174822481-174822503 CAGAGTAAGGAGAACATGGACGG + Intergenic
1002437461 5:179240402-179240424 CTGGGTAAGGGGTGGAGGGAAGG + Intronic
1002465067 5:179404133-179404155 CTGGAGGAGGAGCAGATGGATGG + Intergenic
1003047164 6:2744422-2744444 CAGGGTGAGGAGCACAGGGATGG + Intronic
1003260445 6:4511390-4511412 CTGGCCAAGGAGCAGCTGGGGGG - Intergenic
1003583328 6:7362535-7362557 CTGTGAATGGAGCAGATGGCAGG + Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004632075 6:17431738-17431760 CTCGTTAAGGAGCAGATGAAGGG - Intronic
1005601065 6:27426448-27426470 GTGGGTGGGGAGCAGATGGCAGG - Intergenic
1006082829 6:31577275-31577297 GTGGGTGAGGAGCACATGGGTGG - Exonic
1006904917 6:37526755-37526777 CTTGTTAATAAGCAGATGGAAGG + Intergenic
1007690727 6:43699550-43699572 ATGCCCAAGGAGCAGATGGAGGG + Intergenic
1009464522 6:63953303-63953325 TTAGGTGAGAAGCAGATGGATGG - Intronic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1010929663 6:81785920-81785942 CTGGGGCAGGGGCAGATGTATGG + Intergenic
1011705407 6:89996194-89996216 TTGGGTAGGGAGCACATGGATGG - Intronic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012951002 6:105517956-105517978 CTGGGTCAGTAGCATATGGACGG - Intergenic
1013010121 6:106112846-106112868 GTGGGTAAGGAGCAGAACAAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014638624 6:123880510-123880532 CTGGTTAAGGAGAGAATGGATGG + Intronic
1015350228 6:132209801-132209823 CTGGGTGTGGAGCACATAGAGGG + Intergenic
1016801564 6:148174224-148174246 ATGGTTGAGGAGCAGAGGGATGG + Intergenic
1017008201 6:150043424-150043446 CTGGGGAGGGGGCAGAAGGAAGG - Intergenic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1019398127 7:834373-834395 CTGGATCAGGACCAGAGGGAAGG + Intronic
1019875656 7:3808311-3808333 TTGAGTGAGGAGCAGATGGAGGG + Intronic
1021638890 7:22719043-22719065 CTAGCTAAGGAACAGAGGGAAGG + Intergenic
1022161641 7:27716812-27716834 CTGGGTAAGGAAAATATGAATGG - Intergenic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1024444941 7:49466146-49466168 CAGTGTTAGGAGCAGAGGGAAGG + Intergenic
1024561677 7:50649975-50649997 CTGGGTCATGAGCAGAGAGATGG + Intronic
1024739062 7:52335931-52335953 TAGGGTGAGAAGCAGATGGATGG + Intergenic
1025262065 7:57426199-57426221 CTCGGACGGGAGCAGATGGAGGG + Intergenic
1025739392 7:64183417-64183439 CTCGGACGGGAGCAGATGGAGGG + Intronic
1026000750 7:66557854-66557876 CTAGGACAGGGGCAGATGGAGGG + Intergenic
1026808575 7:73443581-73443603 TTGGTTAAGGAGCAGAGGGGAGG + Intronic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1027776397 7:82470791-82470813 CTGGGTAATGAGCACTTGCAAGG - Intergenic
1029237464 7:99132867-99132889 CTGAGTAGGGAGCTGCTGGAGGG + Intronic
1029670922 7:102030311-102030333 CTGGGTAAAGAGCATATAGGTGG - Intronic
1031642810 7:124186225-124186247 CTGGAGAAGGAGCCAATGGAGGG + Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1034081923 7:148287077-148287099 CCGGGCAAGGAGCAGAGGGGAGG - Intronic
1034221086 7:149446792-149446814 GTGGGTGAGGAGCAGGTGGGAGG - Intronic
1034585441 7:152087526-152087548 CTTTGTAGGGAGCAGATGGGTGG + Intronic
1034819348 7:154202564-154202586 CTCGGAAAGGGGCAGAAGGATGG - Intronic
1035373522 7:158393857-158393879 CTGGGGAGGGAGGTGATGGAAGG - Intronic
1035489619 7:159262074-159262096 CTAGGTAAGGAGCAGATCAATGG + Intergenic
1037240643 8:16773395-16773417 CTGGGTAAGGAGGGAAGGGAGGG - Intergenic
1037632385 8:20670073-20670095 CTGGCTTAGAAGCAGATAGATGG + Intergenic
1037941630 8:22955900-22955922 CTGGGTATAGAGGATATGGAAGG + Intronic
1038526512 8:28278769-28278791 CTGGGTGAGGGGTAGACGGAGGG + Intergenic
1039203252 8:35120215-35120237 CTGGGTAAAGAGCAGATCAGAGG - Intergenic
1039611721 8:38924428-38924450 CTGGGGAAGGAGGACAGGGAAGG + Intronic
1040575500 8:48647920-48647942 CAGGGAAAGGAGATGATGGATGG + Intergenic
1041365288 8:57096437-57096459 ATGGCTAAGGAGCACATTGAAGG - Intergenic
1043096209 8:75977245-75977267 TTGTGTAAGGAGCAGAGGCAGGG + Intergenic
1043331475 8:79122678-79122700 TTGGGGAAGGAGTAGTTGGAGGG - Intergenic
1043793537 8:84505167-84505189 CGAGGTAAGGTGCAGATTGATGG - Intronic
1048074462 8:131053958-131053980 CAGAGAAAGGAACAGATGGAGGG - Intergenic
1048473751 8:134725024-134725046 CAGGGGTAGGAGCAGATGGGGGG - Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1049222854 8:141435820-141435842 CAGGGTACGGGGCAGACGGATGG - Intergenic
1049422348 8:142522618-142522640 CTGGAGAAGGAGCAGAGAGAGGG - Intronic
1049468823 8:142766115-142766137 CTGGGAAAGGAGGAGAGAGAAGG - Intronic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050459314 9:5863626-5863648 CTATGTAAGGATCAGAGGGAAGG + Intergenic
1050567792 9:6904533-6904555 CTGGGTGCAGAGCAGATGGTAGG + Intronic
1050923383 9:11234016-11234038 AAGGGTAAGGAGCAGATGCAGGG + Intergenic
1050978371 9:11972730-11972752 CTTGGAAAGAAGGAGATGGATGG - Intergenic
1051299769 9:15636196-15636218 CTGGGTATGGAGTAGGTAGATGG + Intronic
1051398981 9:16659124-16659146 GTGGGTAAATGGCAGATGGATGG + Intronic
1052750151 9:32482053-32482075 TGGGGGAAGGAGCAGAAGGATGG - Intronic
1052750321 9:32483511-32483533 TTGGGGAAGTAGCAGAAGGATGG - Intronic
1053861240 9:42388296-42388318 CTTGCTAAGGAGCACATGCATGG + Intergenic
1056706997 9:88959847-88959869 CTTGGCCAGGAGCAGCTGGATGG + Intergenic
1056759998 9:89407717-89407739 GTGGATGAGGAGCAGTTGGATGG - Intronic
1057639695 9:96806621-96806643 CGGGGTAAGGAGCAAATAGGAGG + Intergenic
1057833819 9:98428180-98428202 CAGGGTAGGGGGCAGATTGAGGG + Intronic
1058814243 9:108668805-108668827 CTGGGTGAGCAGCTGATGGGAGG - Intergenic
1058815016 9:108675099-108675121 GTGAGGAAGGAGCAGAGGGAAGG - Intergenic
1060813502 9:126623148-126623170 CTGGGTGAGGAACAGAAGGGTGG - Intronic
1061487635 9:130928446-130928468 CTGGGGAAGTTGCACATGGAGGG + Intronic
1062030103 9:134358366-134358388 CTGGGTAGGGTGGAGCTGGAGGG + Intronic
1062512787 9:136916699-136916721 GTGGCTGAGGAGCAGCTGGAAGG - Intronic
1186428494 X:9484421-9484443 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187254513 X:17630045-17630067 CTGGTTATGGAGCATATGAATGG + Intronic
1187694494 X:21905177-21905199 CTTGGAAAGGAGCAGAGGAAGGG - Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1193468470 X:81873407-81873429 CTGGGTAAGGAGGAGCTGAGGGG + Intergenic
1195418526 X:104647113-104647135 CTGGGATAGGGGCAGAAGGAAGG + Intronic
1197864982 X:131008104-131008126 CTGGCTAGGCAGCTGATGGATGG - Intergenic
1198367079 X:135951666-135951688 CAGAGTCAGGAGGAGATGGATGG + Intergenic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic