ID: 947911597

View in Genome Browser
Species Human (GRCh38)
Location 2:233804228-233804250
Sequence TCCAATCCGTGTATGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947911585_947911597 20 Left 947911585 2:233804185-233804207 CCTGGAAGGTGAGGTTCCTGGGG 0: 1
1: 0
2: 5
3: 30
4: 381
Right 947911597 2:233804228-233804250 TCCAATCCGTGTATGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 83
947911587_947911597 4 Left 947911587 2:233804201-233804223 CCTGGGGAGCCCATCCCAAGCCA 0: 1
1: 0
2: 1
3: 19
4: 272
Right 947911597 2:233804228-233804250 TCCAATCCGTGTATGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 83
947911589_947911597 -6 Left 947911589 2:233804211-233804233 CCATCCCAAGCCAACCCTCCAAT 0: 1
1: 0
2: 1
3: 17
4: 227
Right 947911597 2:233804228-233804250 TCCAATCCGTGTATGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 83
947911590_947911597 -10 Left 947911590 2:233804215-233804237 CCCAAGCCAACCCTCCAATCCGT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 947911597 2:233804228-233804250 TCCAATCCGTGTATGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 83
947911582_947911597 26 Left 947911582 2:233804179-233804201 CCGGTACCTGGAAGGTGAGGTTC 0: 1
1: 0
2: 0
3: 8
4: 158
Right 947911597 2:233804228-233804250 TCCAATCCGTGTATGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 83
947911588_947911597 -5 Left 947911588 2:233804210-233804232 CCCATCCCAAGCCAACCCTCCAA 0: 1
1: 0
2: 2
3: 27
4: 281
Right 947911597 2:233804228-233804250 TCCAATCCGTGTATGTGCTGGGG 0: 1
1: 0
2: 0
3: 1
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947911597 Original CRISPR TCCAATCCGTGTATGTGCTG GGG Intronic
902188015 1:14740102-14740124 CCCAAGCCGAGTGTGTGCTGGGG + Intronic
903670204 1:25031014-25031036 TCCAAACCGTGAATGGGGTGTGG - Intergenic
911118225 1:94268404-94268426 GCCAATGTGTGTGTGTGCTGGGG - Intronic
917833933 1:178925133-178925155 ACCATTCAGTGTATTTGCTGTGG - Intergenic
919977884 1:202624436-202624458 TGTAATACGTGTATGTGTTGTGG + Intronic
921163798 1:212491486-212491508 TCCAATCTGTGTATGTAGAGGGG - Intergenic
1065604468 10:27403166-27403188 TGCACACCGTGTATGTGGTGGGG - Intronic
1071233435 10:83616079-83616101 TCCAGTCTGTGTATTTTCTGTGG + Intergenic
1072841145 10:98775292-98775314 TTCAATCCCAGAATGTGCTGAGG - Intronic
1085103101 11:73818206-73818228 TCCACTCCGTGTGTGGGCTCTGG + Intronic
1098033285 12:66276619-66276641 TCCACTCAGTGTCTGTGTTGGGG + Intergenic
1101820851 12:108183377-108183399 TTAACTCTGTGTATGTGCTGGGG + Intronic
1102012575 12:109627692-109627714 TCCAGTCCCTCTCTGTGCTGGGG + Intergenic
1104956655 12:132469838-132469860 TGCAATCCATGTATATGATGAGG + Intergenic
1106196871 13:27501599-27501621 TGCAATCCCTGTGTCTGCTGGGG + Intergenic
1108133517 13:47330085-47330107 TGAAATCCGTGTATGTCCAGCGG + Intergenic
1108718315 13:53104386-53104408 GCCACTCCATCTATGTGCTGTGG + Intergenic
1123439916 15:20282730-20282752 TGCAATCCGGGTCTGTGTTGAGG - Intergenic
1127294002 15:57593856-57593878 TACTATCTGTGTGTGTGCTGGGG + Intronic
1130102587 15:80905231-80905253 GCCAAGCCGTGTAGGTGGTGTGG + Intronic
1133315541 16:4881518-4881540 TCCCACAGGTGTATGTGCTGAGG - Exonic
1136523650 16:30814188-30814210 TCCAATCCCTTTTTTTGCTGCGG + Intergenic
1136845257 16:33571667-33571689 TGCAATCTGGGTCTGTGCTGAGG + Intergenic
1140603876 16:76510608-76510630 TCCCATACTTGTCTGTGCTGAGG + Intronic
1141736065 16:85854346-85854368 ACCAGTCCGTGTAGGTGCGGGGG + Intergenic
1203106965 16_KI270728v1_random:1420320-1420342 TGCAATCTGGGTCTGTGCTGAGG + Intergenic
1203155425 16_KI270728v1_random:1871965-1871987 TGCAATCTGGGTCTGTGCTGAGG + Intergenic
1148747334 17:49926060-49926082 CCCAACCCGAGTGTGTGCTGGGG - Intergenic
1150991768 17:70267898-70267920 TCCAATCAGCGTTTTTGCTGGGG - Intergenic
1152322928 17:79618431-79618453 TCCAAGCCGTGTGTCTGCTCAGG + Intergenic
1152497951 17:80687652-80687674 ACCATTCCGTGGCTGTGCTGTGG - Intronic
1152992532 18:376351-376373 TCCAATCCATGGATTTTCTGGGG - Intronic
1156717111 18:40024547-40024569 TATAATTTGTGTATGTGCTGGGG + Intergenic
1157106289 18:44777500-44777522 ACCATTCCGCGTATGTCCTGGGG + Intronic
1166066128 19:40360129-40360151 TCCAATCCTTGCAGTTGCTGCGG + Intronic
925359429 2:3267170-3267192 TCCAATCCCTGTATGTGTGTTGG + Intronic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
928156941 2:28885473-28885495 TCCAATGTGTGTATGTGTTTGGG + Intergenic
931796833 2:65719197-65719219 TAAAATCAGTCTATGTGCTGAGG - Intergenic
936614044 2:114031128-114031150 TGCAATCCATGTCTCTGCTGGGG + Intergenic
937980890 2:127614700-127614722 TCCACTCCCTGTAAGTGATGAGG - Intronic
938984161 2:136557073-136557095 TCCAATCTGTGTTTGTGATTTGG + Intergenic
947911597 2:233804228-233804250 TCCAATCCGTGTATGTGCTGGGG + Intronic
1169003141 20:2182831-2182853 TCCAACCCCTGTGTGAGCTGGGG - Intergenic
1170962232 20:21035695-21035717 TTGAATCCTTGTATGAGCTGTGG - Intergenic
1173955468 20:47029041-47029063 TCCAATCTGTACATGTGCTTTGG - Intronic
1174912969 20:54626180-54626202 TCCCATCCATGTATGTACTCTGG - Intronic
1175774537 20:61644696-61644718 AACAATCCGTCTATGTGGTGGGG + Intronic
1178341697 21:31790944-31790966 TGCAATCCATGAATCTGCTGGGG - Intergenic
1178425454 21:32475492-32475514 TCCAAGTCGAGTATGAGCTGAGG + Intronic
1180997769 22:19973970-19973992 TCCAAGAGGTGTATGGGCTGCGG - Intronic
1181967619 22:26668012-26668034 TCCACCCTGTGTGTGTGCTGGGG + Intergenic
951377480 3:21938462-21938484 TCTAATTCATGTATGTGCTGTGG - Intronic
952605070 3:35136747-35136769 TCCAAAAGGTGTATGTGTTGAGG + Intergenic
952690703 3:36201832-36201854 TCTAAACAGTGTATCTGCTGAGG + Intergenic
954881389 3:53838215-53838237 TCCAGTCTGTGCAGGTGCTGCGG + Intronic
957900612 3:86483728-86483750 TCCAATCTGTGTATGTCTGGGGG + Intergenic
966863824 3:184245290-184245312 TCCACTCCATCTTTGTGCTGCGG - Exonic
969840701 4:9879564-9879586 TCCAAGCAAGGTATGTGCTGAGG + Intronic
971056393 4:22917757-22917779 TCTAATCCATGTATGTGTGGAGG + Intergenic
974738456 4:65972775-65972797 TTCAATGCTTGTATGTACTGTGG + Intergenic
975068354 4:70098740-70098762 ACCAATCCCTGTGTGTACTGAGG - Intergenic
979652872 4:123156552-123156574 TCCAATCTGAGTAGGTACTGAGG - Intronic
983368598 4:166829113-166829135 TTGAATCTGTGTATGTGGTGAGG - Intronic
988196185 5:28009080-28009102 ACCATTCCGTGGATGTGGTGGGG - Intergenic
996889005 5:128395077-128395099 TCCTAACAGTGTCTGTGCTGAGG + Intronic
1006749108 6:36365522-36365544 TCCTGTCCCTGTATCTGCTGTGG - Intronic
1010485575 6:76408680-76408702 TCCAATCCATGTATGTGAATTGG + Intergenic
1012391988 6:98752219-98752241 TCCAATGTGTGTGTGGGCTGGGG - Intergenic
1014942020 6:127452779-127452801 TCCAATCCGAGTATGGGTAGAGG + Intronic
1029130382 7:98325801-98325823 TGCATCCCGTGTGTGTGCTGGGG - Intronic
1029680432 7:102104992-102105014 TCCAAGCCGTGCAGGTGCAGAGG + Intronic
1031815555 7:126430381-126430403 TTCAATCAGTATATGTTCTGAGG - Intergenic
1033387277 7:140890385-140890407 CCAAATCCCTGTATGTGCTCAGG + Intronic
1034411654 7:150945378-150945400 TCCGAGCCGTGTCTGTGCAGGGG + Exonic
1037321761 8:17650499-17650521 TCCATGCCGTGTAGGTACTGGGG - Intronic
1042783954 8:72525624-72525646 TCCAATCTCTATATGTGCTTTGG + Intergenic
1044797963 8:95923257-95923279 TCCAATTCATGAATCTGCTGAGG + Intergenic
1045406567 8:101872519-101872541 TCCACTCAGTGTCTGTGTTGGGG + Intronic
1053130469 9:35611832-35611854 TCCAATCCTTGTTAGAGCTGAGG + Exonic
1053168261 9:35859858-35859880 TCTACTCCGTGAATGTGTTGGGG - Intergenic
1055727020 9:79241337-79241359 TCCAATGCATATGTGTGCTGTGG + Intergenic
1199034175 X:143031986-143032008 TCCAATTGGTGTAAGTCCTGGGG + Intronic
1202372239 Y:24206182-24206204 ACCAACCCGTGTGTGTGTTGGGG + Intergenic
1202498546 Y:25463934-25463956 ACCAACCCGTGTGTGTGTTGGGG - Intergenic