ID: 947913154

View in Genome Browser
Species Human (GRCh38)
Location 2:233814739-233814761
Sequence AGGGCCAGACTCTGGGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 276}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947913150_947913154 -8 Left 947913150 2:233814724-233814746 CCAGAAGCTGGACTGAGGGCCAG 0: 1
1: 0
2: 1
3: 22
4: 236
Right 947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 276
947913148_947913154 -6 Left 947913148 2:233814722-233814744 CCCCAGAAGCTGGACTGAGGGCC 0: 1
1: 0
2: 1
3: 27
4: 240
Right 947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 276
947913144_947913154 2 Left 947913144 2:233814714-233814736 CCACTCCTCCCCAGAAGCTGGAC 0: 1
1: 1
2: 2
3: 30
4: 492
Right 947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 276
947913145_947913154 -3 Left 947913145 2:233814719-233814741 CCTCCCCAGAAGCTGGACTGAGG 0: 1
1: 0
2: 7
3: 82
4: 730
Right 947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 276
947913149_947913154 -7 Left 947913149 2:233814723-233814745 CCCAGAAGCTGGACTGAGGGCCA 0: 1
1: 0
2: 1
3: 24
4: 214
Right 947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 276
947913141_947913154 18 Left 947913141 2:233814698-233814720 CCAGAGCCAGGGATGGCCACTCC 0: 1
1: 0
2: 1
3: 33
4: 241
Right 947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 276
947913137_947913154 30 Left 947913137 2:233814686-233814708 CCTGGTGGCGGGCCAGAGCCAGG 0: 1
1: 0
2: 2
3: 26
4: 424
Right 947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 276
947913142_947913154 12 Left 947913142 2:233814704-233814726 CCAGGGATGGCCACTCCTCCCCA 0: 1
1: 0
2: 1
3: 33
4: 334
Right 947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG 0: 1
1: 0
2: 1
3: 19
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947913154 Original CRISPR AGGGCCAGACTCTGGGGAAC AGG Intronic
900095380 1:938060-938082 AGGGCCAGAGTCGGAGGCACTGG + Intronic
900176126 1:1292187-1292209 AGGGCGAGACAATGGGGACCAGG + Intergenic
900362981 1:2298899-2298921 AGGGCAAGACTCCGGGGAGGCGG - Intronic
900462012 1:2806067-2806089 AAGAACAGACTGTGGGGAACAGG - Intergenic
900478507 1:2887292-2887314 AGGGCCAGCCACAGGGGAATGGG - Intergenic
900586964 1:3437258-3437280 AGGGCTGGACTCTGGGGACGTGG - Exonic
900614774 1:3560616-3560638 AGGGAAAGGCTCTGGGGATCCGG + Intronic
900630219 1:3631156-3631178 AGGCCCAGATTCTGGGGGATGGG + Intronic
901402756 1:9025770-9025792 AGGGCCAAAGTCTGAGGAGCAGG + Intronic
901650984 1:10743166-10743188 AGGGGCAGAGGCTGGGGGACAGG + Intronic
901671870 1:10860795-10860817 AGGGTGTGACTCTGGGGAACTGG + Intergenic
902247083 1:15128075-15128097 AGGGCCTGACCCTTGGGAATTGG - Intergenic
902411992 1:16217286-16217308 AGGGCCAGATTCTAGGGAGAAGG - Intergenic
903219196 1:21859644-21859666 AGGGCTGGACGCTGGGGAAGTGG + Exonic
903821988 1:26110564-26110586 AGTGCCAGACTCTCGGGAGAAGG + Intergenic
907255706 1:53177156-53177178 AGTGCCTGGCTATGGGGAACAGG + Intergenic
907593759 1:55700939-55700961 AGGGCCAGGATCTGGTGAGCTGG + Intergenic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
912654381 1:111472489-111472511 AGGCACAGAGTCTGGGGAAGAGG - Intergenic
920092356 1:203463738-203463760 GGGGCCTGGCTCTGGGCAACAGG + Intergenic
922614576 1:226954281-226954303 AAAGCCAGACTCTTGGGAAGAGG + Intronic
922795949 1:228339890-228339912 AGGGCCAGGCTATGGGGCGCAGG + Intronic
923188394 1:231596377-231596399 AGGGGCCTACTCTGGGGGACAGG - Intronic
923447026 1:234081449-234081471 AGGTCCTGACTCTGGGAAACAGG - Intronic
923630297 1:235645184-235645206 AGGTCCAGACACTGATGAACAGG - Intronic
1066991383 10:42517548-42517570 AGGGCCATACCCTGGGGGTCAGG - Intergenic
1068797914 10:61104601-61104623 AGGGCATGAATCTGGGGAAATGG - Intergenic
1069685681 10:70316999-70317021 AGGGTCAGACTCTGGAAAGCTGG + Intronic
1069711703 10:70493603-70493625 CGGGCCAGACTTGGGGGAAGTGG - Intronic
1069866012 10:71503261-71503283 GGGTCCAGTCTCTGAGGAACCGG - Intronic
1069881800 10:71597927-71597949 AGGCCCAGGCTGTGGGCAACTGG + Intronic
1069911801 10:71764645-71764667 ACGGACGGACTCTGGCGAACTGG - Intronic
1070115606 10:73526007-73526029 AGGGACAGCCTCTTGGGAAATGG - Intronic
1070351283 10:75594217-75594239 AGGGCCCAGCTCTGGGGGACCGG + Intronic
1072913018 10:99520450-99520472 AGCGCCAGAGTCTCGGGAAAAGG + Intergenic
1073435488 10:103513475-103513497 AGGGCTAGCCTCTGTGGCACAGG - Intronic
1073525828 10:104181154-104181176 TGGGGCAGACTCTGGGGGAAGGG - Intronic
1073739924 10:106394711-106394733 AGGTCCAGACTCTAGGGCAGTGG + Intergenic
1073930221 10:108566739-108566761 AGGGCCACAATCTGGGCAAGTGG + Intergenic
1074375186 10:112934635-112934657 CTAGCCAGACTCTGGGGGACAGG + Intergenic
1074777569 10:116777483-116777505 AGTGGCAGGCTCTTGGGAACTGG - Intergenic
1074883884 10:117679768-117679790 GGGGCCAGCCTCTGGGGAAATGG + Intergenic
1075691874 10:124401897-124401919 ACAGCGAGACTCTGGGGAAAAGG - Intronic
1075753256 10:124791418-124791440 AGGGCCAGGCTTGGGGGAAAGGG - Intronic
1077101676 11:825269-825291 AGGGCCAGACCCTGGCCACCAGG - Exonic
1077169196 11:1158843-1158865 AGGGCCAGAGGCTGGGGACAGGG - Intronic
1077305498 11:1867018-1867040 AGGGCCAGTCCCTGTGGACCTGG + Intronic
1077348068 11:2073540-2073562 TGGGCCATACTCTGGGCAACAGG - Intergenic
1077358209 11:2128290-2128312 AGGGGCAGACCCTGGGGGCCAGG + Intergenic
1077418219 11:2435913-2435935 ATGCCCACACTCTGGGGAACAGG + Intergenic
1077610662 11:3641742-3641764 AGGGACAGACCCTGAGGAAGTGG - Intronic
1078108905 11:8376170-8376192 AGGGCAAGGCTCTGGGAAACAGG + Intergenic
1078360005 11:10660770-10660792 AGTGCCATTCTCTGGGGCACAGG - Intronic
1078730083 11:13965492-13965514 AGGGCCAGCAGGTGGGGAACTGG + Intronic
1078932188 11:15921183-15921205 AGGGCCAGCCTGTGAGGAGCTGG - Intergenic
1079114993 11:17635068-17635090 TGGGTCACACTCTGGGGAAAAGG - Exonic
1081943793 11:46969583-46969605 AGGTCCAGATTATGGGAAACTGG + Intronic
1083678702 11:64341637-64341659 TGGGCCAGATCCTGGGGAGCTGG + Exonic
1083941678 11:65899633-65899655 AGGGCCGGTCTCCGGGGACCTGG + Intronic
1084488747 11:69466254-69466276 TGGCCCAGAGTTTGGGGAACCGG - Intergenic
1085300507 11:75455683-75455705 GGAGCCAGGCTCTGGGGAAAGGG + Intronic
1085400077 11:76230590-76230612 AGGGTCAGCCCCTGGGGAGCAGG + Intergenic
1089423772 11:118352582-118352604 AGCATCAGACTCTGGGGATCAGG + Intronic
1089448406 11:118572477-118572499 AGGGGTAGGGTCTGGGGAACGGG - Exonic
1089635617 11:119809770-119809792 ATTCCCAGGCTCTGGGGAACAGG + Intergenic
1090493249 11:127184632-127184654 AGATCCTGTCTCTGGGGAACAGG + Intergenic
1091226403 11:133958861-133958883 AGGGCCAGGCTTTGTGGATCCGG - Intergenic
1092040539 12:5380096-5380118 TGGGCCAGGCCCTGGGGAGCAGG + Intergenic
1095515652 12:43002599-43002621 AAGGCCACATTCTGGGGTACTGG + Intergenic
1096692129 12:53327869-53327891 AGGGCCAGAGTCTAGGAAGCCGG + Exonic
1099996357 12:89783663-89783685 AGGGGCAGCCTCTGTGGAAGGGG + Intergenic
1101136762 12:101751827-101751849 TAGGCCAGAATCTGGGGAATGGG + Intronic
1101820265 12:108178788-108178810 AAGGCCACACTCTGGGGTACTGG + Intronic
1102978444 12:117223174-117223196 AGGCCCAGAGTCTGGGCATCAGG - Intronic
1103276221 12:119713744-119713766 AGGGCCAGACTCTCTGGGCCCGG - Intronic
1103807187 12:123582798-123582820 ACAGCAAGACTTTGGGGAACTGG + Intergenic
1103875649 12:124125148-124125170 CTGGCCGGACTCTGGGGAAGGGG - Intronic
1103897988 12:124286521-124286543 AAGGGCAGAGTCTGGGGACCAGG - Intronic
1104511183 12:129379853-129379875 AGGGCCACACTTTGGGAAATGGG + Intronic
1104937863 12:132376112-132376134 GGGGCCACACTCTGAGGAGCAGG - Intergenic
1105326249 13:19372846-19372868 AGGGCCTGACTCTTAGGAAATGG - Intergenic
1105867256 13:24472222-24472244 AGGGCCTGACTCTTAGGAAATGG + Intronic
1107327249 13:39257826-39257848 AGGGACAGACCCTTGGGAGCAGG - Intergenic
1109032939 13:57217084-57217106 ATGGCCACACTCTGAGGCACTGG - Intergenic
1112095713 13:96129686-96129708 AAGGCCACACTCTGAGGTACTGG - Intronic
1112653625 13:101425160-101425182 AGGGTCATTCTCTGGGGAAGGGG - Intergenic
1116012876 14:39371289-39371311 GGGGCCAGAATTTGGGGAAGGGG + Intronic
1118258834 14:64228742-64228764 AGGGCCAGCCACTGGTAAACTGG - Intronic
1120676905 14:87431276-87431298 TGTGCCACACTCTGAGGAACAGG - Intergenic
1121566694 14:94915253-94915275 AGGACCAGAATCTGAGGACCCGG + Intergenic
1121755937 14:96402020-96402042 AGGGCTAAACTCTGGGGCCCAGG - Intronic
1122430338 14:101636109-101636131 AGGGCCAGAGTATGGGCAACTGG - Intergenic
1122906952 14:104805996-104806018 AGGGTCAGACTCTGCGGAGGAGG + Intergenic
1125117794 15:36115969-36115991 AGAGCCTGACTCTGAGTAACTGG - Intergenic
1125536550 15:40443826-40443848 AGGGTCAGACTGCAGGGAACGGG - Intronic
1127390747 15:58503420-58503442 AGCGCCAGCCTCTGGATAACAGG + Intronic
1128795903 15:70466419-70466441 AGGGCCACAGGCTGGGTAACAGG - Intergenic
1129707962 15:77805428-77805450 AGCATCAGACTCTGGGGACCTGG - Intronic
1129901932 15:79157912-79157934 AGCACCAAACTCTGGGAAACTGG - Intergenic
1130903362 15:88223493-88223515 AGGGCCAGAGACTGCGGAGCAGG + Intronic
1131404559 15:92153842-92153864 AGGCCCAGACTGGGGGGAAAGGG + Intronic
1131452897 15:92560972-92560994 AGGGTCTGCTTCTGGGGAACTGG - Intergenic
1132721707 16:1319815-1319837 TGGGCCAGACTCAGGGGAGATGG - Intronic
1132888904 16:2194836-2194858 AGGGCCAGGGGCTGGGGAAGTGG - Intronic
1133758131 16:8777652-8777674 AGGGCCACACTCTGTGGGAGAGG + Intronic
1134095195 16:11414358-11414380 AGGCCCAGCCTCTGGAGAGCAGG + Exonic
1134174460 16:11994543-11994565 AGGGCTAGACTCATGGGAAGTGG - Intronic
1134641900 16:15836044-15836066 AGTGCCAGCCTCTTGGGAGCCGG - Intronic
1135134650 16:19878688-19878710 AGTGCCAGGCACTGGGGAAATGG - Intronic
1135803293 16:25519181-25519203 ATGCACAGACTCTGGGGAGCAGG - Intergenic
1136578719 16:31139473-31139495 GTGGCCAGACCCTGGGGAAAGGG - Intronic
1137769963 16:51008232-51008254 AGTGCCAGACTCTGTTGACCTGG - Intergenic
1138584564 16:57961484-57961506 TGGGCCATACTTGGGGGAACCGG - Intronic
1139579663 16:67864956-67864978 ACGGACAGGCCCTGGGGAACTGG - Intronic
1140032700 16:71351107-71351129 AGGGCCAGACGCTAGAGCACTGG - Intergenic
1140170380 16:72598605-72598627 AGGGACAGACTCTGGAGAGTGGG + Intergenic
1140403552 16:74691778-74691800 AGTGCCAAGCTCTGGGTAACAGG - Intronic
1140623112 16:76759983-76760005 AGGGCCATACAGTGGGCAACTGG - Intergenic
1141386280 16:83624876-83624898 ATGGCCAGGCTCAAGGGAACTGG - Intronic
1141547419 16:84780350-84780372 AGGGCCAGAAGCCGGGGCACGGG - Intergenic
1141639085 16:85330718-85330740 AGGGGCAGACTCTGGGATCCGGG - Intergenic
1141656572 16:85419882-85419904 AGGGTCAGAGTCGGGGGGACTGG + Intergenic
1141850950 16:86645618-86645640 AGGGTCATACTCAGGGGAAGAGG + Intergenic
1142374060 16:89697788-89697810 AGTGCCAAACTGTGGGGCACTGG - Exonic
1143730391 17:8879398-8879420 AGTGCCCGACTCAGGGGAAATGG - Exonic
1144861376 17:18305173-18305195 AGTGCCAGGCTCTGGTGATCTGG - Exonic
1145126005 17:20300638-20300660 AGGGCCAGACACAGGGGCTCTGG - Intronic
1145995179 17:29100879-29100901 AAGGCCAGCCTCAGGGGACCAGG - Intronic
1146002490 17:29139622-29139644 AGGGGTAGAGTCAGGGGAACGGG + Intronic
1146279560 17:31536518-31536540 AGGGCCAGAGTCTGGGAGAAAGG - Exonic
1146373769 17:32281075-32281097 AGGGCCAGACAATGGGGGGCGGG - Intronic
1148155728 17:45424482-45424504 AGTGCCAGGCCCTGGGGAATGGG - Intronic
1148271633 17:46266500-46266522 AGGGGCAGCCTTTGGGGAAACGG - Intergenic
1148386937 17:47240953-47240975 AAAGCCAGACGCTGGGGAAGAGG + Intergenic
1148769749 17:50060036-50060058 AGGGCCGGCCTCTGGGGAGATGG + Intronic
1148772226 17:50074100-50074122 GGGGGCAGGCTCTGGGGAGCAGG - Intronic
1149683563 17:58521843-58521865 ATGGCCGGAGCCTGGGGAACAGG + Exonic
1150045657 17:61910797-61910819 TGGGCCAGACTCATGAGAACTGG - Intronic
1150387418 17:64773146-64773168 AGTGCCAGGCCCTGGGGAATGGG - Intergenic
1150765148 17:67996302-67996324 AGGGGCAGCCTTTGGGGAAACGG + Intergenic
1151222471 17:72623231-72623253 AGGGCCAGACCCTGCCGAGCTGG + Intergenic
1151349646 17:73524298-73524320 AGCTCCAGCCTCTGGGGAAGGGG - Intronic
1151539553 17:74758135-74758157 AGTGACCGTCTCTGGGGAACAGG - Intronic
1151560587 17:74867561-74867583 AGGACCATGCTCTGGGGAAAGGG + Intronic
1151744728 17:76005750-76005772 AGGGCCAGACCCTGAGGAAAGGG + Exonic
1152027360 17:77819740-77819762 AGGGGGAGGTTCTGGGGAACTGG + Intergenic
1152205238 17:78971179-78971201 TGTGCCAGGCTCTGGGGGACAGG - Intergenic
1152364847 17:79849703-79849725 AGGGACAGGTTCTGGGGAGCTGG - Intergenic
1152378606 17:79930832-79930854 TGGGCCAGATTCTGGGGAGCTGG + Intergenic
1152425858 17:80218355-80218377 AGGGCCACACACTGGGCAGCAGG + Intronic
1152443319 17:80323544-80323566 AGGGCGAGACTCTGTCTAACAGG - Intronic
1152671213 17:81608181-81608203 GAGGCCAGGCTCTGGGGAAAGGG + Intronic
1152872544 17:82764627-82764649 AGAGCGAGACTCTGTGGAAATGG + Intronic
1153394091 18:4598278-4598300 ATGGCCAAACTCTTTGGAACTGG - Intergenic
1153964656 18:10168404-10168426 AGGGCCATATGCTGGGGACCCGG + Intergenic
1155056167 18:22185554-22185576 AGAGTCAGTCCCTGGGGAACTGG - Intronic
1155427754 18:25724008-25724030 ATGGCAAAACTCTGGGGGACTGG + Intergenic
1160559849 18:79749401-79749423 GGGGCCAGACTCGGGGGTGCTGG - Intronic
1161103442 19:2432503-2432525 AGGATCAGTCTCTGGGGAACTGG - Exonic
1163235089 19:16025277-16025299 AGGGACAGCCTGTGGGGAGCAGG - Intergenic
1166560207 19:43727754-43727776 AGGGACATGCTCTGGGGTACTGG + Intergenic
926434866 2:12827546-12827568 AGGGGCAGGCTTTGGGGATCCGG + Intergenic
926740422 2:16105898-16105920 GGGCCCAGACTCAGGGGAATGGG - Intergenic
927123444 2:19990271-19990293 AGGCCCAGACGCCAGGGAACAGG - Intergenic
930029092 2:47047510-47047532 AGGGCCACACTCTGGGTGAAGGG + Intronic
930032296 2:47065899-47065921 AGGGGCAGACTCTGGAGAGGAGG + Intronic
932732652 2:74232027-74232049 AGGGCCACAGACTGGGGAGCGGG + Intronic
937246356 2:120496605-120496627 AGTGCCAGACACTGGGGCAAGGG + Intergenic
938804028 2:134789397-134789419 AGGGTCAGCCTCTGGGGACAGGG + Intergenic
941859292 2:170262367-170262389 TGGGTGGGACTCTGGGGAACTGG + Intronic
942641640 2:178066877-178066899 GGGGACAGACTCTTGGGAAGGGG + Intronic
944496727 2:200314634-200314656 AGGGGCAGACAGTGGGGACCAGG - Intronic
946295529 2:218780954-218780976 AGGGTGAGACTCTGGGGAGTGGG + Intergenic
947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG + Intronic
948232934 2:236365357-236365379 TGGGCCAGCCTCTGAGGAATGGG + Intronic
948797460 2:240412235-240412257 AGGGTCAGATACTGGGGAGCAGG + Intergenic
1169205751 20:3739650-3739672 AGGGCCAGAGTCTGAGGTGCTGG - Intronic
1170517828 20:17149924-17149946 AGGGCAAGACTGTGGGGAATGGG + Intergenic
1170580168 20:17693222-17693244 AGGTCCAGGCCCTGGGGAATTGG + Intergenic
1170692133 20:18625464-18625486 TGGCCCAGCCTCTGGGGCACTGG + Intronic
1171365213 20:24618166-24618188 AGGGGGAGACCCTGGGGAAGGGG + Intronic
1172097598 20:32467940-32467962 AGGGCGGGTCTCTGGGGAGCAGG - Intronic
1172106078 20:32518045-32518067 AGGGACACACAGTGGGGAACAGG + Intronic
1172619455 20:36309427-36309449 AGGGCTGGGCTCTGGGGAATGGG + Intronic
1173125098 20:40329347-40329369 AAGGTCAGTCTCTGGGGTACAGG - Intergenic
1173513839 20:43650954-43650976 AGGGCAGGGCACTGGGGAACGGG + Intergenic
1173646041 20:44633777-44633799 AAGGCCAGAATCCTGGGAACTGG + Intronic
1175148168 20:56912244-56912266 AGTGCCAGCCCCTGCGGAACTGG - Intergenic
1175580371 20:60094318-60094340 AGGGCAAGACTCTCAGGAAATGG - Intergenic
1175889991 20:62311774-62311796 ACAGCCAGACTCTGGGGGGCGGG + Exonic
1175972453 20:62693567-62693589 AGGGGCTGCTTCTGGGGAACCGG - Intergenic
1177446745 21:21207562-21207584 AGGTCCTGACTATTGGGAACAGG + Intronic
1178928145 21:36792826-36792848 AGGGAGAGGCTCTGGGGAAAGGG + Intronic
1179644875 21:42769867-42769889 CGGGCCAGGCTGTGGGGAGCAGG - Intronic
1180757318 22:18171016-18171038 GGGGACAGTCTCTGAGGAACAGG - Intronic
1181074461 22:20366449-20366471 GGGGACAGTCTCTGAGGAACAGG + Intronic
1183302846 22:37066754-37066776 AGGGCCAGACCCTGGTGATGTGG + Intronic
1183438617 22:37809937-37809959 AGTGCCAGGCCCTGGGGAAATGG - Exonic
1183745836 22:39691196-39691218 AGGGGCAGCCTGAGGGGAACAGG - Intergenic
1183933169 22:41247702-41247724 GAGGCAAGACTCTGGGGGACTGG + Intronic
1184722003 22:46320244-46320266 AGGGACACGCTCTGGGAAACAGG - Intronic
1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG + Intronic
1185394534 22:50579946-50579968 TGGGCCAGAGGCTGGGGAGCAGG - Intronic
949946452 3:9193570-9193592 TGGGCCAGACCCTGGGGAGGTGG + Intronic
950100817 3:10355627-10355649 AGGCACAGACTCTGGGAAAGGGG - Intronic
950195274 3:11005205-11005227 AGGGCGAGCCCCTGTGGAACAGG - Intronic
950763521 3:15256164-15256186 AGGGCCAGGCCTTGGAGAACCGG - Exonic
953144978 3:40266725-40266747 TGTACCAGACTCTGGGGAGCAGG - Intergenic
954110955 3:48432788-48432810 AGGGCAGGACTCTGGGTCACAGG - Exonic
954429503 3:50462735-50462757 AGTGACAGCCTCTGGGGAGCTGG + Intronic
954453001 3:50581832-50581854 AGGGCAGGACACTGGGGCACTGG - Exonic
954814964 3:53273218-53273240 AGGGGCAGACTCTGAGGGGCAGG + Intergenic
955320139 3:57968476-57968498 AGGGCCAGCTACTGGGGAAGGGG - Intergenic
955350511 3:58189908-58189930 TGGCCCAGACTCTGGGAGACTGG + Intergenic
961527326 3:127513543-127513565 AGGGCCAGGCACAGGGGAAAGGG + Intergenic
962844052 3:139260108-139260130 AGAGCCAGAGCCTGGGGAGCAGG + Intronic
962903343 3:139779780-139779802 AGGGAAAGATTCTTGGGAACAGG - Intergenic
964844243 3:161028466-161028488 AGGGCAGAACCCTGGGGAACAGG + Intronic
968127272 3:196169202-196169224 AGGGCCAGCCTCTGAGCAGCAGG - Intergenic
968551565 4:1226187-1226209 AGGGCCTGTCTCTGGGGACAAGG - Intronic
968662397 4:1804139-1804161 AGGGCCAGACCCTGGAGAGAAGG - Intronic
969720081 4:8888707-8888729 AGGACCAGGCGCTGGGTAACCGG - Intergenic
970433747 4:16012999-16013021 AGGCGCACACTCTGGGGACCTGG + Intronic
973588905 4:52420513-52420535 AGGGCCAGCCTCTGGGTGAGGGG + Intergenic
979001934 4:115232483-115232505 AGGGCCAGACTTTGGTGAACAGG - Intergenic
979764252 4:124445685-124445707 AGTCCCACACCCTGGGGAACAGG - Intergenic
985516441 5:347764-347786 AGGGACCCACTCTGGGAAACTGG + Intronic
985531148 5:434462-434484 AGAGCCAGACTCTCGGCAACAGG + Exonic
985605780 5:857478-857500 CGGGACAGACTCTGGGGGCCTGG - Intronic
985605816 5:857617-857639 CGGGACAGACTCTGGGGGCCTGG - Intronic
985605970 5:858232-858254 CAGGACAGACTCTGGGGATCTGG - Intronic
985785052 5:1888962-1888984 ATGGGCGGACTCTGGGGCACAGG + Intergenic
986622099 5:9686679-9686701 AGGGCCAACATCTGGGGAAATGG + Intronic
989607315 5:43256941-43256963 AGAGCCAGACTCTGAGGCAGAGG - Intronic
993394839 5:87372941-87372963 AGAGCCAGACTTTGGGTTACAGG - Intronic
997242882 5:132320951-132320973 AAGGGCAGACTCTGTGGAAAGGG + Intronic
997410477 5:133687109-133687131 AGGGCAAGTGTCGGGGGAACTGG + Intergenic
998158288 5:139798323-139798345 GGGGCCAGACCCTGAGGAAACGG - Intronic
999809620 5:155115137-155115159 AGGACCCGACGCTGGGGAGCAGG - Intergenic
1000794121 5:165643752-165643774 AAAGCCAGACTATGGGGAGCAGG - Intergenic
1001609221 5:172986646-172986668 AGTGTCAGAGTCTGGGGAAGAGG + Intronic
1001904506 5:175460719-175460741 AGGTCCCCACCCTGGGGAACTGG + Intergenic
1002289297 5:178188752-178188774 AGGCCCAGACCCGGAGGAACTGG + Intergenic
1002536465 5:179878835-179878857 AGGGACAGAGGCTGGGGAATGGG - Intronic
1003269294 6:4593146-4593168 AGGGCCTGGCTCTGGGGCACAGG + Intergenic
1006828902 6:36957043-36957065 GAGGCCAGAAGCTGGGGAACAGG - Intronic
1007375239 6:41451905-41451927 AGGGCCAGCATCTGGGTGACTGG - Intergenic
1007718662 6:43872254-43872276 TGGGCAAGTCTCTGGGAAACTGG - Intergenic
1011645329 6:89452152-89452174 AGGGCCTCACTCTGTGGACCAGG - Intronic
1015286594 6:131492344-131492366 AGGGCTACATTCTGAGGAACTGG - Intergenic
1016914209 6:149229654-149229676 AGGGCCGGGATCTGGGGACCTGG + Intronic
1017773906 6:157664916-157664938 AGGGCAAGACACTGGAGAAGAGG - Intronic
1018008679 6:159647987-159648009 AGAGCGAGACTGTGGGGAAGAGG - Intergenic
1018757868 6:166864988-166865010 TGTGCCAGACACTGGGGAAGGGG + Intronic
1018798540 6:167205720-167205742 AGTGCCAGACTCTGTGTGACAGG - Intergenic
1018814169 6:167318445-167318467 AGTGCCAGACTCTGTGTGACAGG + Intergenic
1019562345 7:1665188-1665210 AGGGCGAGTCTCTGGGGACGCGG + Intergenic
1019596596 7:1861202-1861224 ACGGCTAGGCTCTGGGGAGCAGG + Intronic
1019715802 7:2538754-2538776 AGGAACAGGCTCTGGGGGACAGG + Exonic
1021669766 7:23023558-23023580 AGGGCCAGCCTTGGGGAAACTGG - Intergenic
1024119025 7:46218972-46218994 AGGGCCAGGGTTTGGGGAACGGG - Intergenic
1024253265 7:47521938-47521960 AGGGCCAGACCCAGGGAAGCTGG + Intronic
1026442951 7:70459844-70459866 AGAGCCAGACTGTGGGGCAGAGG + Intronic
1028869230 7:95748976-95748998 GGAGCCAGATTCTGGGGAAAAGG + Intergenic
1030040455 7:105445439-105445461 AGGGCCATTATCTGGGGAATGGG - Intronic
1030447130 7:109660456-109660478 AGGACCAGACTCTTGGGATGTGG + Intergenic
1031918830 7:127587011-127587033 AAGGACAGACTTTGGGAAACAGG - Intronic
1034672218 7:152867380-152867402 AGGGCCTGACTGTGGCGAGCCGG - Intergenic
1035462263 7:159049382-159049404 AGGGCTGGACTCTGGGGAGAAGG + Intronic
1035705551 8:1671763-1671785 AGGGCCAGACTCAGGTGGCCGGG - Intronic
1036165462 8:6428841-6428863 AGGAGCTGCCTCTGGGGAACAGG - Intronic
1037519011 8:19661836-19661858 AGGCCCAGACACTGGTGAACTGG - Intronic
1037685924 8:21139352-21139374 AGGGCCAGACACTGAGCAAGGGG + Intergenic
1038895624 8:31778457-31778479 ACTGCCAGACCCTGGAGAACAGG + Intronic
1044641338 8:94385075-94385097 AGGGTCTCACTCTGGGGCACAGG - Intronic
1047763906 8:127974330-127974352 AGGATAAAACTCTGGGGAACTGG - Intergenic
1048402660 8:134086468-134086490 AATGCCATAATCTGGGGAACAGG + Intergenic
1048672368 8:136737205-136737227 AGGGCCAGACACCGGACAACTGG - Intergenic
1049001125 8:139826196-139826218 AAAGCCAGACTCTGGGGGCCTGG + Intronic
1049439448 8:142602539-142602561 AGGACCAGACGCTGGAGAAGGGG + Intergenic
1052788489 9:32851969-32851991 GTGTCCAGACTCTGGGGAAGTGG - Intergenic
1053286067 9:36850266-36850288 AGTGCCAGAATCTGGAGGACAGG + Intronic
1056943187 9:90972561-90972583 AGGGCTTGTCTCTGGGCAACTGG + Intergenic
1059752065 9:117257240-117257262 AGGACTAGAGTTTGGGGAACAGG + Intronic
1060135575 9:121150283-121150305 AGGGCCATGCCCTGGGGTACAGG - Exonic
1060344276 9:122803042-122803064 AGGGCCAGGCTTTGGGGCACTGG - Intronic
1060509112 9:124219177-124219199 AGGGCCAGGCTCTGGTGGGCTGG + Intergenic
1060587439 9:124795284-124795306 GGGTCCAGCCTCTGGGGAAGAGG + Intronic
1060844543 9:126825708-126825730 ATAGCCAGACTCTGAGGTACAGG + Intronic
1060981199 9:127793290-127793312 TGGGGTAGACTCTGGGGAAGAGG - Intergenic
1062148834 9:135007112-135007134 AGGGCCTGGCTGTGGGGAGCCGG - Intergenic
1186481096 X:9896327-9896349 TGGGCAGGCCTCTGGGGAACAGG - Exonic
1187260575 X:17681998-17682020 AAGGAAAGACTCTGGGAAACTGG + Intronic
1192549509 X:72042690-72042712 AGAGGCAGACTCTTGGGAAGAGG + Intergenic
1194760873 X:97794815-97794837 AGGGCCAGACTCTGGCAAGCTGG - Intergenic
1196418576 X:115499550-115499572 AGGGCAATTCTCTGGGGAAGAGG - Intergenic
1198100183 X:133415795-133415817 GGGCCCAGGTTCTGGGGAACGGG + Intergenic