ID: 947913964

View in Genome Browser
Species Human (GRCh38)
Location 2:233819988-233820010
Sequence GCTGCTGGCGCACCACCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947913959_947913964 12 Left 947913959 2:233819953-233819975 CCAGAGGTGCGGCGCCTTCTCAT 0: 1
1: 0
2: 0
3: 4
4: 50
Right 947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG 0: 1
1: 0
2: 0
3: 16
4: 180
947913955_947913964 27 Left 947913955 2:233819938-233819960 CCGGTGGTGGACCACCCAGAGGT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG 0: 1
1: 0
2: 0
3: 16
4: 180
947913958_947913964 13 Left 947913958 2:233819952-233819974 CCCAGAGGTGCGGCGCCTTCTCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG 0: 1
1: 0
2: 0
3: 16
4: 180
947913957_947913964 16 Left 947913957 2:233819949-233819971 CCACCCAGAGGTGCGGCGCCTTC 0: 1
1: 0
2: 3
3: 5
4: 92
Right 947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG 0: 1
1: 0
2: 0
3: 16
4: 180
947913961_947913964 -2 Left 947913961 2:233819967-233819989 CCTTCTCATTGACGGCATCCTGC 0: 1
1: 0
2: 1
3: 7
4: 89
Right 947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG 0: 1
1: 0
2: 0
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947913964 Original CRISPR GCTGCTGGCGCACCACCACC AGG Exonic
900530570 1:3151041-3151063 GCTGCTGGAGGACCAGCCCCCGG - Intronic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
901056788 1:6452036-6452058 GCATCTTGCGCACCATCACCTGG - Exonic
901234035 1:7657941-7657963 GCGGCTGCCGCACCCCCATCAGG + Intronic
903791200 1:25894273-25894295 GCTGCAGGCCCATCTCCACCAGG + Intronic
904462623 1:30689252-30689274 CCTGCTGGGGCACCACCAGTAGG + Intergenic
905410022 1:37762130-37762152 ACTGCTAGCGCTCCACCTCCTGG - Intronic
905512227 1:38530530-38530552 GGTGCTGACCAACCACCACCAGG - Intergenic
917035453 1:170743111-170743133 CCTGCAGGCTCACCACCACATGG + Intergenic
917920274 1:179744392-179744414 GCTGCTGGGACCCCGCCACCCGG + Intronic
918076331 1:181174002-181174024 GCTGCTGGGGCAGCATCCCCAGG + Intergenic
920381350 1:205536312-205536334 GCTGCTGCTCTACCACCACCTGG - Intergenic
922546091 1:226457910-226457932 GCAGCTGGTGAACCAGCACCTGG - Intergenic
1066432238 10:35363015-35363037 GCCGCCGGCGGCCCACCACCTGG - Intronic
1066531485 10:36345079-36345101 GATCCTTGCGCACAACCACCAGG - Intergenic
1068658365 10:59596972-59596994 GCTTCTGGGGCAGCACAACCAGG + Intergenic
1073447943 10:103592250-103592272 GGTCCTGGCACACCACCCCCTGG - Exonic
1074554528 10:114476183-114476205 GCACCTGGTGCACCTCCACCTGG - Intronic
1077451702 11:2652161-2652183 TCTGCTGGGGCCCCACCCCCAGG - Intronic
1078134523 11:8640868-8640890 GCTGCTGGGGCACCATCTCAGGG + Exonic
1081967649 11:47179192-47179214 GCTGGTGGCGCAGCACCCACGGG - Exonic
1083799470 11:65038212-65038234 GATGCTAGGCCACCACCACCAGG - Intronic
1083997847 11:66280850-66280872 GCAGCAGGCCCACCACCCCCAGG - Intronic
1084198388 11:67539407-67539429 GCTGCTGGCCCACCAGGTCCTGG + Intergenic
1084611115 11:70203603-70203625 GCTGCTGGAGCAGAACGACCTGG + Exonic
1088876784 11:113942978-113943000 GGTGCCTGCGCATCACCACCTGG - Exonic
1089556491 11:119318250-119318272 TCTGCTGGCGCGCCTCCACCAGG + Intronic
1089560465 11:119340750-119340772 GGGGCTGGAGCACCACCAACTGG - Exonic
1090988215 11:131792420-131792442 GCTGGTGAGTCACCACCACCAGG - Intronic
1091719344 12:2801257-2801279 GCTGCTGGCACACAGCCAGCTGG - Exonic
1091749022 12:3011095-3011117 GGTGCTGGGGTACCACCCCCGGG - Intronic
1093822655 12:23640834-23640856 GCTGCTGCCGCAGCAACACCAGG - Exonic
1096827706 12:54292520-54292542 GCTGTTGGCGCATGACCTCCAGG + Exonic
1096870078 12:54587712-54587734 GCTGCTGGCTCAGTCCCACCTGG + Intronic
1099614207 12:84913431-84913453 GCTGCTGAGGCACCAACACAGGG - Intronic
1099722586 12:86382991-86383013 CCTACTGGGGCACCACCTCCTGG + Intronic
1102948476 12:117011207-117011229 GCTGCTGGCGCCCCCTCCCCTGG + Intronic
1103209298 12:119154765-119154787 GCTGCTCGGGATCCACCACCAGG - Intronic
1103410867 12:120710597-120710619 GCGGCAGGCGCCCCACCACGCGG + Exonic
1104799745 12:131546606-131546628 TCTGTTGGCCCAGCACCACCTGG + Intergenic
1105774154 13:23640996-23641018 GCTGCTTGGGCACTACGACCTGG - Intronic
1106065081 13:26339494-26339516 GCTGGTGGCGTTACACCACCTGG - Intronic
1108219259 13:48216564-48216586 CCTGCAGGCTCAACACCACCTGG - Intergenic
1108460122 13:50657401-50657423 GCTTTTGGCACACCCCCACCTGG + Intronic
1108478374 13:50843214-50843236 GCTGCTGGGGCCCCTCCAGCAGG - Exonic
1108768388 13:53663507-53663529 GCTGCAGGCCCAACACCACATGG - Intergenic
1109109052 13:58292759-58292781 GCTGCAGGCTCAACACCACATGG - Intergenic
1109787584 13:67200362-67200384 CCTGCTGGGACACAACCACCTGG - Intronic
1110531421 13:76602996-76603018 GCTGCTGGTGTCCCATCACCCGG + Intergenic
1115199124 14:30834419-30834441 CCTGCAGGCTCACCACCACATGG + Intergenic
1120356652 14:83442765-83442787 GCTCCTGGAGTACCAGCACCAGG - Intergenic
1121109732 14:91303903-91303925 GCTGCTGCAGAACCACCACACGG - Exonic
1122711611 14:103662766-103662788 GCTGCGGACGCTCCACAACCTGG + Exonic
1122742451 14:103880134-103880156 GCTGCTGCCCCACCCCCACCCGG + Intergenic
1124223816 15:27871568-27871590 GCTGCAGGCGCCCCAGCCCCAGG - Intronic
1128269208 15:66293806-66293828 GCCGCTGGCGCTCCGCCTCCCGG - Intronic
1129852218 15:78799963-78799985 ACTACAGGTGCACCACCACCCGG + Intronic
1130250781 15:82299110-82299132 ACTACAGGTGCACCACCACCCGG - Intergenic
1132670743 16:1101417-1101439 GCTTCTCCCGCAGCACCACCAGG + Intergenic
1133284267 16:4683344-4683366 GGTGCTGGCCCAACACCACCTGG - Intronic
1138090584 16:54170518-54170540 GCTCCTGTCACACCACCCCCAGG + Intergenic
1138453992 16:57110755-57110777 GCTGCTGGGGCACCCCCACTGGG - Exonic
1140302413 16:73771317-73771339 GCTGTTGGGGCGCCATCACCAGG - Intergenic
1140514412 16:75531809-75531831 GCGGATGTCACACCACCACCAGG + Intronic
1141569058 16:84923140-84923162 GTTGCTGGCGCACCTCCCTCTGG - Intergenic
1142189685 16:88712197-88712219 GCTGCAGGGCCACCTCCACCTGG - Intronic
1142480114 17:213874-213896 GCTGCTGACGCAGCTCCAGCAGG - Exonic
1142892093 17:2950426-2950448 GCTGCTAGCCCACCTCCAACAGG + Intronic
1142985762 17:3694761-3694783 GCTGCTGGGGCCCCACCCTCAGG + Intronic
1143768881 17:9155242-9155264 GCCGCTGTCACACCAGCACCTGG + Intronic
1147539692 17:41346843-41346865 GCTGCAGGCCCAGCACAACCTGG - Exonic
1147541642 17:41365174-41365196 GCTGCAGGCCCAGCACAACCTGG - Exonic
1147543325 17:41379352-41379374 GCTGCAGGCCCAGCACAACCTGG - Exonic
1147545117 17:41395244-41395266 GCTGCAGGCCCAGCACAACCTGG - Exonic
1148871136 17:50659309-50659331 GCAGCTGCTGCACCACCATCTGG - Exonic
1150445670 17:65225433-65225455 GCTGCTGGCCCACGTCCCCCAGG - Exonic
1152644768 17:81463673-81463695 ACTGCTCGCGCGCCACGACCTGG - Exonic
1152809558 17:82375158-82375180 GCTGCTCGCCCAGTACCACCAGG + Exonic
1152924270 17:83080199-83080221 GCTGCAGGCGCGCCTCCCCCGGG - Intronic
1158706721 18:59798915-59798937 GCTGCTGGAGCATCACCACTTGG + Intergenic
1160658517 19:287455-287477 GCTGCTGGTCCACACCCACCTGG + Exonic
1160917853 19:1506281-1506303 AGTGCTGGGCCACCACCACCAGG - Exonic
1161459613 19:4389046-4389068 GCTGCTGTTGAGCCACCACCAGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162562756 19:11426956-11426978 GCCTCTGCCGCAACACCACCTGG + Exonic
1162615736 19:11798885-11798907 GCTGCGGGCCCAGCCCCACCTGG - Intronic
1163161869 19:15469697-15469719 GCTGCTGGGCCACCGCCAGCTGG - Exonic
1163595124 19:18216839-18216861 GGTGCTGGAGAACCATCACCTGG - Exonic
1165339740 19:35202641-35202663 GCTGCTGACCCTCCAACACCTGG + Intergenic
1166598440 19:44072228-44072250 GATGCTGGCTCGCAACCACCTGG + Exonic
1166731910 19:45064133-45064155 GCTGCTGCCGCAGCAGCATCAGG + Exonic
1166753543 19:45177033-45177055 GCTGCTGGCGCCACCACACCTGG - Intronic
1166766440 19:45254190-45254212 CCGGCTGGCGCCCCAACACCCGG - Intronic
1167499159 19:49835853-49835875 GCTTCTGGCCCACCCCCTCCTGG + Exonic
1167660000 19:50790770-50790792 GCTGCTGGCGGACCCCCTCCTGG - Exonic
1168254785 19:55159424-55159446 GCTCCTGCCGCACGTCCACCAGG + Exonic
1168266950 19:55228507-55228529 GCTCCTGTCCCACCCCCACCTGG + Intronic
927646280 2:24878975-24878997 CCTGCTGGCTCCCCAGCACCCGG + Intronic
927712385 2:25333874-25333896 GCTGCTGGCCCCAAACCACCTGG - Intronic
930076149 2:47407240-47407262 CCTGCAGGCTCAACACCACCTGG - Intronic
932494889 2:72141348-72141370 CCTGCTGGCCCAGGACCACCAGG + Intronic
932608088 2:73177504-73177526 AATGCTGGCGCCCCACCTCCCGG - Intergenic
933909132 2:86923577-86923599 GATGTTGGCTCACCACCTCCTGG + Intronic
934023592 2:87979808-87979830 GATGTTGGCTCACCACCTCCTGG - Intergenic
937325896 2:120989424-120989446 GCTTCTGCTGCACCACCGCCAGG - Exonic
940402878 2:153267459-153267481 CCTGCAGGCCCAACACCACCTGG + Intergenic
943324984 2:186486638-186486660 GCTGCTGGCGCCCCCGCACCTGG + Intronic
945030044 2:205654983-205655005 GCTGGTGGGACACCACAACCGGG + Intergenic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
946291677 2:218750125-218750147 GCTGCAGCAGCTCCACCACCAGG + Exonic
946305675 2:218855754-218855776 GCTGCTCGCCCACCACAACTGGG - Intergenic
947425658 2:229980852-229980874 GCTGCTGGCGGGAAACCACCTGG - Intronic
947593184 2:231396279-231396301 GCTGCGGGCGCTCCACCTGCCGG - Intronic
947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG + Exonic
948457770 2:238114843-238114865 GCAGCTTTCGCACCACGACCAGG + Intronic
948463815 2:238142834-238142856 CCTGCCCGCCCACCACCACCAGG - Exonic
948727222 2:239942285-239942307 GCTGCTGGGGCCCACCCACCAGG + Intronic
948872565 2:240810916-240810938 GCAGAGGGCTCACCACCACCCGG - Intronic
1168847092 20:952667-952689 GCAGCTGGGGCACCACACCCAGG + Intergenic
1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG + Intergenic
1171001884 20:21423350-21423372 GCTGCAGGCCCAACACCACTTGG + Intergenic
1174415377 20:50362955-50362977 GCTGCTGGTTGACCCCCACCAGG + Intergenic
1175159199 20:56995410-56995432 GGTGCTGCCGCACCTCCAGCAGG - Intergenic
1175893290 20:62324722-62324744 GGTGCTGGCCCACCTCCAGCCGG - Intronic
1176704375 21:10101068-10101090 CCTACTGGGGCACCACCGCCTGG - Intergenic
1178513866 21:33230041-33230063 GCAGCCCGCGGACCACCACCCGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1182321006 22:29478684-29478706 GCGGCTGGCGCTTCAGCACCGGG - Intergenic
1183303316 22:37069181-37069203 GCTGCTGCAGCTCGACCACCCGG - Exonic
1185380265 22:50504661-50504683 GCTGGTGGGGCACCACAACCGGG + Exonic
1185380543 22:50505716-50505738 GCTGCTGGACGACCAGCACCTGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
952105506 3:30065412-30065434 CCTGCTGGGGCACCACCAAGTGG - Intergenic
953344027 3:42160167-42160189 GCTCCTGGCCCAGCATCACCCGG - Intronic
956867694 3:73385701-73385723 GCTGGAGGAGCAGCACCACCAGG - Exonic
960083506 3:113566476-113566498 TCTGCTGGCGAACCACAACAAGG - Exonic
966860209 3:184227553-184227575 GCTGCTGCCTCACCACCAGAGGG + Intronic
967939886 3:194757426-194757448 TCTGCTGGCCCACCACCCCTGGG - Intergenic
967971644 3:195003806-195003828 GCTGCTGTTGCAGGACCACCTGG + Intergenic
969274422 4:6125261-6125283 GCAGCGGGAGCACCCCCACCCGG + Intronic
969528798 4:7718159-7718181 GCTCCTGCCGCACCACAAACAGG - Exonic
969631714 4:8342905-8342927 ACTGCTGGCTCACCTCCTCCAGG - Intergenic
975986193 4:80202998-80203020 GCTTCTGGCCCAGCACCAGCGGG - Exonic
978391815 4:108235218-108235240 GCTACTGGTGCCCCAGCACCTGG + Intergenic
979218432 4:118193587-118193609 GCTGCTGGCACACAGCCAGCTGG + Intronic
983554894 4:169051265-169051287 GCTGCTGGCTCACACCCAGCGGG + Intergenic
987327997 5:16829684-16829706 GCTGCTGGCACACTAGCCCCTGG - Intronic
991457240 5:66817037-66817059 GCTTCTGCCCCACCAGCACCTGG + Intronic
996503579 5:124243553-124243575 CCTGCAGGCTCAACACCACCTGG - Intergenic
997786211 5:136716247-136716269 GCTGCTGCCTCAGCACCACTAGG - Intergenic
1006180419 6:32150627-32150649 GCTGCCGGGGCACCCCCACCCGG - Exonic
1006977398 6:38115903-38115925 GCTGCTGCTGCACCACCCCATGG + Intronic
1007696536 6:43737431-43737453 GCTGCTGGCCCACCGCCACTCGG - Intergenic
1015366622 6:132402984-132403006 GCTGGTGCCTCACCTCCACCAGG + Intergenic
1017360921 6:153570495-153570517 GCTCTTGGCTCACCACAACCCGG + Intergenic
1019436842 7:1026716-1026738 GTTGCTGCCGCTCCAGCACCTGG + Intronic
1019522153 7:1465903-1465925 ACTGCTGGCGCCCCAGCTCCGGG - Intergenic
1019560448 7:1653502-1653524 GCTGCTGGGGTAACACCACAAGG - Intergenic
1020010981 7:4805635-4805657 GCTGCTGACTCACTACCAGCTGG - Exonic
1020096984 7:5374743-5374765 GCTGATGGGGGACCTCCACCAGG + Intronic
1022474259 7:30699900-30699922 GCTCCTGGCGCCCCACCTCGTGG + Intronic
1023674906 7:42618784-42618806 GCTGCAGGCCAACCACCACTAGG + Intergenic
1024238917 7:47418978-47419000 GCTGCAGGGGCAGCACCAACCGG + Intronic
1026904144 7:74053237-74053259 GCTCCTGGGACACCAACACCTGG - Exonic
1027258146 7:76444430-76444452 GCTTCTGGATCACCACCTCCAGG - Intergenic
1028983205 7:96989711-96989733 GCTGCCGGCGCTCCAGCACGTGG - Intergenic
1029708507 7:102287394-102287416 GCTGCTCTCGCCCCACTACCCGG - Intronic
1032421250 7:131781800-131781822 GCTGCTGACACTCCATCACCTGG + Intergenic
1033014266 7:137655927-137655949 TCTGGAGGCACACCACCACCGGG + Intronic
1033899307 7:146116265-146116287 GCTGCTCGCGCTCCGCCGCCCGG + Intergenic
1035285773 7:157805967-157805989 GCAGCTGGCACAAAACCACCTGG - Intronic
1035901801 8:3465133-3465155 GCTGCTGGGGCCTCACCAGCAGG + Intronic
1037980064 8:23246893-23246915 GACGCAGGCGCACCACCCCCTGG - Exonic
1038450273 8:27634795-27634817 GCTGCTGGCTCACCACCCTGGGG - Intronic
1039129119 8:34241639-34241661 GCTGCAGCCTCACCAACACCAGG - Intergenic
1039558827 8:38496614-38496636 GCTGCTGCCGCCCCCTCACCAGG + Intergenic
1046747202 8:117888992-117889014 GCTCCTGGTGAACCACCATCAGG - Intronic
1048306281 8:133286975-133286997 GCTGCTGGCGGTCCACCATCTGG + Intronic
1049064023 8:140298882-140298904 GCTGCTGTCTCCCCAGCACCTGG - Intronic
1049441382 8:142611387-142611409 GCTAGTGGCCCACCAGCACCAGG + Exonic
1051936431 9:22447479-22447501 GCTGCCTGCGCAGCGCCACCTGG - Exonic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1057448899 9:95138709-95138731 GCAGCTTCCCCACCACCACCTGG - Intronic
1057776853 9:98018367-98018389 GCTCCTGTATCACCACCACCAGG + Intergenic
1059593820 9:115694128-115694150 GGTACTGGAGCACCACCTCCTGG - Intergenic
1060838745 9:126777920-126777942 GCTGCAGCAGCACCACCTCCAGG + Intergenic
1061238910 9:129357992-129358014 GCTGCTGGAGCTGCACCACAAGG - Intergenic
1061821339 9:133228525-133228547 CCTGCAGGCCCACCACCTCCTGG - Intergenic
1061834109 9:133317838-133317860 CCTGCAGGCCCACCACCTCCTGG + Intergenic
1062237907 9:135521542-135521564 CCTGCAGGCCCACCACCTCCTGG + Exonic
1062384292 9:136303007-136303029 TCTGCTGGGGCCCCAACACCTGG + Exonic
1189407127 X:40735379-40735401 GCAGCTGGAGAACCACCAGCTGG - Exonic
1191226955 X:58054059-58054081 GCTGCTGCCCCACCCCCACCTGG + Intergenic
1194496342 X:94621389-94621411 CCTGCTGGCTCAACACCACATGG + Intergenic
1197301671 X:124788896-124788918 CCTGCTGGGGCACCACCAAGTGG - Intronic
1198426053 X:136521278-136521300 GCTGCAGCAGCAGCACCACCTGG - Intergenic